Anti-human Interleukin(IL)-4 Clone 8D4-8 Cross-Reacts With Myosin-9 Associated With Apoptotic Cells and Should Not Be Used for Flow Cytometry Applications Querying IL-4 Expression.

In den Nachrichten

Anti-human Interleukin(IL)-4 Clone 8D4-8 Cross-Reacts With Myosin-9 Associated With Apoptotic Cells and Should Not Be Used for Flow Cytometry Applications Querying IL-4 Expression.

Interleukin(IL)-Four is produced by T cells and different leukocytes and is a crucial mediator of monocyte and B cell responses. During routine circulation cytometry panel validation for the investigation of intracellular cytokines, we noticed distinctive IL-4 expression patterns related to the broadly obtainable monoclonal antibody 8D4-8.

Namely, IL-4 (8D4-8) expression was noticed within the absence of mobile activation and enhanced following staurosporine publicity. Mass spectrometry evaluation of immunoprecipitates from peripheral blood lymphocytes (PBL) revealed that 8D4-8 cross-reacts with the ever-present cytoskeletal protein myosin-9.

We confirmed these outcomes by western blotting immunoprecipitates, utilizing immunofluorescence amongst staurosporine-treated Caco-2 cells, and by surface-labeling PBL for 8D4-8 and myosin-9 and analyzing by circulation cytometry. Although beforehand reported from a number of impartial teams, we discovered no proof to help the speculation that IL-4 is produced by apoptotic cells. Rather, this seems to have been myosin-9. Our information point out clone 8D4-8 shouldn’t be used within the circulation cytometric examine of IL-4. Furthermore, our work calls for a reevaluation of earlier circulation cytometric research which have used this clone for IL-4 evaluation and highlights the significance of validation in antibody-based assays.

Anti-human Interleukin(IL)-4 Clone 8D4-8 Cross-Reacts With Myosin-9 Associated With Apoptotic Cells and Should Not Be Used for Flow Cytometry Applications Querying IL-4 Expression.
Anti-human Interleukin(IL)-4 Clone 8D4-8 Cross-Reacts With Myosin-9 Associated With Apoptotic Cells and Should Not Be Used for Flow Cytometry Applications Querying IL-4 Expression.

Anti-EGFR-resistant clones decay exponentially after development: implications for anti-EGFR re-challenge.

<AbstractText>Colorectal most cancers (CRC) has been proven to accumulate RAS and EGFR ectodomain mutations as mechanisms of resistance to epidermal progress issue receptor (EGFR) inhibition (anti-EGFR). After anti-EGFR withdrawal, RAS and EGFR mutant clones lack a progress benefit relative to different clones and decay; nonetheless, the kinetics of decay stay unclear.

We sought to find out the kinetics of acquired RAS/EGFR mutations after discontinuation of anti-EGFR remedy.</AbstractText><AbstractText>We current the post-progression circulating tumor DNA (ctDNA) profiles of 135 sufferers with RAS/BRAF wild-type metastatic CRC handled with anti-EGFR who acquired RAS and/or EGFR mutations throughout remedy. Our validation cohort consisted of an exterior dataset of 73 sufferers with a ctDNA profile suggestive of prior anti-EGFR publicity and serial sampling. A separate retrospective cohort of 80 sufferers was used to guage total response fee and development free survival throughout re-challenge therapies.</AbstractText><p><div><b>RESULTS</b></div>Our evaluation confirmed that RAS and EGFR relative mutant allele frequency decays exponentially (r<sup>2</sup>=0.93 for RAS; r<sup>2</sup>=0.94 for EGFR) with a cumulative half-life of 4.Four months.

 

We validated our findings utilizing an exterior dataset of 73 sufferers with a ctDNA profile suggestive of prior anti-EGFR publicity and serial sampling, confirming exponential decay with an estimated half-life of 4.three months. A separate retrospective cohort of 80 sufferers confirmed that sufferers had the next total response fee throughout re-challenge therapies after growing time intervals, as predicted by our mannequin.</p><AbstractText>These outcomes present scientific help for anti-EGFR re-challenge and information the optimum timing of re-challenge initiation.</AbstractText>

Primary and secondary anti-viral response captured by the dynamics and phenotype of particular person T cell clones.

The various repertoire of T-cell receptors (TCR) performs a key position within the adaptive immune response to infections. Using TCR alpha and beta repertoire sequencing for T-cell subsets, in addition to single-cell RNAseq and TCRseq, we observe the concentrations and phenotypes of particular person T-cell clones in response to major and secondary yellow fever immunization – the mannequin for acute an infection in people – exhibiting their massive variety. We affirm the secondary response is an order of magnitude weaker, albeit ∼ 10 days quicker than the first one.

Mouse Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

DLR-MyD88-Mu-48T 48T
EUR 508.00
  • Should the Mouse Myeloid Differentiation Factor 88 (MyD88) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myeloid Differentiation Factor 88 (MyD88) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

DLR-MyD88-Mu-96T 96T
EUR 661.00
  • Should the Mouse Myeloid Differentiation Factor 88 (MyD88) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myeloid Differentiation Factor 88 (MyD88) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

DLR-MyD88-Ra-48T 48T
EUR 528.00
  • Should the Rat Myeloid Differentiation Factor 88 (MyD88) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myeloid Differentiation Factor 88 (MyD88) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

DLR-MyD88-Ra-96T 96T
EUR 690.00
  • Should the Rat Myeloid Differentiation Factor 88 (MyD88) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Myeloid Differentiation Factor 88 (MyD88) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RD-MyD88-Hu-48Tests 48 Tests
EUR 500.00

Human Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RD-MyD88-Hu-96Tests 96 Tests
EUR 692.00

Mouse Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RD-MyD88-Mu-48Tests 48 Tests
EUR 511.00

Mouse Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RD-MyD88-Mu-96Tests 96 Tests
EUR 709.00

Rat Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RD-MyD88-Ra-48Tests 48 Tests
EUR 534.00

Rat Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RD-MyD88-Ra-96Tests 96 Tests
EUR 742.00

Human Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RDR-MyD88-Hu-48Tests 48 Tests
EUR 522.00

Human Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RDR-MyD88-Hu-96Tests 96 Tests
EUR 724.00

Mouse Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RDR-MyD88-Mu-48Tests 48 Tests
EUR 534.00

Mouse Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RDR-MyD88-Mu-96Tests 96 Tests
EUR 742.00

Rat Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RDR-MyD88-Ra-48Tests 48 Tests
EUR 558.00

Rat Myeloid Differentiation Factor 88 (MyD88) ELISA Kit

RDR-MyD88-Ra-96Tests 96 Tests
EUR 776.00

MyD88 Antibody

AF5195 200ul
EUR 304.00
Description: MyD88 Antibody detects endogenous levels of total MyD88.

MYD88 siRNA

20-abx903411
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MyD88 Antibody

ABF5195 100 ug
EUR 438.00

MYD88 siRNA

20-abx925124
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MYD88 siRNA

20-abx925125
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MYD88 antibody

70R-50098 100 ul
EUR 244.00
Description: Purified Polyclonal MYD88 antibody

MYD88 antibody

70R-5823 50 ug
EUR 467.00
Description: Rabbit polyclonal MYD88 antibody

MYD88 antibody

70R-5825 50 ug
EUR 467.00
Description: Rabbit polyclonal MYD88 antibody

MyD88 Antibody

ABD6162 100 ug
EUR 438.00

MyD88 Antibody

48999-100ul 100ul
EUR 333.00

MyD88 Antibody

48999-50ul 50ul
EUR 239.00

MYD88 antibody

10R-8668 50 ul
EUR 219.00
Description: Mouse monoclonal MYD88 antibody

MyD88 Antibody

3244R-100
EUR 316.00

MyD88 Antibody

3244R-30T
EUR 146.00

MyD88 Antibody

32107-100ul 100ul
EUR 252.00

MYD88 antibody

10R-4917 100 ul
EUR 691.00
Description: Mouse monoclonal MYD88 antibody

MYD88 antibody

10R-4918 100 ul
EUR 691.00
Description: Mouse monoclonal MYD88 antibody

MYD88 antibody

10R-4920 100 ul
EUR 691.00
Description: Mouse monoclonal MYD88 antibody

MYD88 Antibody

24065-100ul 100ul
EUR 390.00

MYD88 Antibody

24066-100ul 100ul
EUR 390.00

MYD88 antibody

70R-14197 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal MYD88 antibody

MyD88 antibody

70R-11710 100 ug
EUR 403.00
Description: Rabbit polyclonal MyD88 antibody

MyD88 Antibody

DF6162 200ul
EUR 304.00
Description: MyD88 Antibody detects endogenous levels of total MyD88.

MYD88 Antibody

1-CSB-PA995911
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYD88. Recognizes MYD88 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

MYD88 Antibody

1-CSB-PA003338
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MYD88. Recognizes MYD88 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IHC:1/200-1/1000.ELISA:1/20000

MYD88 Antibody

1-CSB-PA859945LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYD88. Recognizes MYD88 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

MYD88 Antibody

CSB-PA015282KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against MYD88. Recognizes MYD88 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

MYD88 Antibody

CSB-PA015282KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against MYD88. Recognizes MYD88 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

MYD88 antibody

PAab09835 100 ug
EUR 386.00

anti-MYD88

YF-PA13299 50 ug
EUR 363.00
Description: Mouse polyclonal to MYD88

anti-MYD88

YF-PA13300 50 ug
EUR 363.00
Description: Mouse polyclonal to MYD88

anti-MYD88

YF-PA13301 100 ul
EUR 403.00
Description: Rabbit polyclonal to MYD88

anti-MYD88

YF-PA13302 100 ug
EUR 403.00
Description: Rabbit polyclonal to MYD88

anti-MYD88

YF-PA27304 50 ul
EUR 363.00
Description: Mouse polyclonal to MYD88

Human Myeloid differentiation primary response protein MyD88 (MYD88)

1-CSB-EP859945HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 37.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Myeloid differentiation primary response protein MyD88(MYD88) expressed in E.coli

MyD88 Blocking Peptide

AF5195-BP 1mg
EUR 195.00

Polyclonal MYD88 Antibody

APR00051G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYD88 . This antibody is tested and proven to work in the following applications:

Polyclonal MyD88 Antibody

APR00052G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MyD88 . This antibody is tested and proven to work in the following applications:

MyD88 Conjugated Antibody

C48999 100ul
EUR 397.00

MyD88 Conjugated Antibody

C32107 100ul
EUR 397.00

anti- MYD88 antibody

FNab09835 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: myeloid differentiation primary response gene
  • Uniprot ID: Q99836
  • Gene ID: 4615
  • Research Area: Immunology, Signal Transduction
Description: Antibody raised against MYD88

MyD88 Polyclonal Antibody

ES2871-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against MyD88 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MyD88 Polyclonal Antibody

ES2871-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against MyD88 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

MYD88 Blocking Peptide

20-abx062973
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MyD88 Polyclonal Antibody

ABP51872-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human MyD88
  • Applications tips:
Description: A polyclonal antibody for detection of MyD88 from Human, Mouse, Rat. This MyD88 antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MyD88

MyD88 Polyclonal Antibody

ABP51872-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human MyD88
  • Applications tips:
Description: A polyclonal antibody for detection of MyD88 from Human, Mouse, Rat. This MyD88 antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MyD88

MyD88 Polyclonal Antibody

ABP51872-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human MyD88
  • Applications tips:
Description: A polyclonal antibody for detection of MyD88 from Human, Mouse, Rat. This MyD88 antibody is for WB, IF, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human MyD88

Myd88 (pY257) Antibody

abx216998-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Anti-MyD88 Antibody

A00025-1 100ug/vial
EUR 294.00

Anti-MyD88 Antibody

A00025-2 100ug/vial
EUR 294.00

MYD88 Rabbit pAb

A0786-100ul 100 ul
EUR 308.00

MYD88 Rabbit pAb

A0786-200ul 200 ul
EUR 459.00

MYD88 Rabbit pAb

A0786-20ul 20 ul
EUR 183.00

MYD88 Rabbit pAb

A0786-50ul 50 ul
EUR 223.00

MyD88 Rabbit pAb

A0980-100ul 100 ul
EUR 308.00

MyD88 Rabbit pAb

A0980-200ul 200 ul
EUR 459.00

MyD88 Rabbit pAb

A0980-20ul 20 ul
EUR 183.00

MyD88 Rabbit pAb

A0980-50ul 50 ul
EUR 223.00

MyD88 Rabbit pAb

A16889-100ul 100 ul
EUR 308.00

MyD88 Rabbit pAb

A16889-200ul 200 ul
EUR 459.00

MyD88 Rabbit pAb

A16889-20ul 20 ul
EUR 183.00

MyD88 Rabbit pAb

A16889-50ul 50 ul
EUR 223.00

MYD88 Blocking Peptide

33R-10165 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYD88 antibody, catalog no. 70R-5825

MyD88 Blocking Peptide

33R-10680 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MyD88 antibody, catalog no. 70R-11710

MYD88 Blocking Peptide

33R-9003 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYD88 antibody, catalog no. 70R-5823

Human MyD88 Antibody

33480-05111 150 ug
EUR 261.00

MyD88 Polyclonal Antibody

41191-100ul 100ul
EUR 252.00

MyD88 Polyclonal Antibody

41191-50ul 50ul
EUR 187.00

MyD88 Blocking Peptide

3244RBP-50
EUR 153.00

MyD88 Monoclonal Antibody

26020-100ul 100ul
EUR 390.00

MYD88 cloning plasmid

CSB-CL859945HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 891
  • Sequence: atggctgcaggaggtcccggcgcggggtctgcggccccggtctcctccacatcctcccttcccctggctgctctcaacatgcgagtgcggcgccgcctgtctctgttcttgaacgtgcggacacaggtggcggccgactggaccgcgctggcggaggagatggactttgagtactt
  • Show more
Description: A cloning plasmid for the MYD88 gene.

MyD88 Blocking Peptide

DF6162-BP 1mg
EUR 195.00

Anti-MyD88 Antibody

PB9148 100ug/vial
EUR 334.00

anti- MYD88 antibody

LSMab09835 100 ug
EUR 386.00

Anti-MyD88 Antibody

PA1660 100ug/vial
EUR 334.00

pCMV-SPORT6-MYD88

PVT13143 2 ug
EUR 391.00

pCMV-HA-MYD88

PVT14254 2 ug
EUR 599.00

Anti-MyD88 antibody

STJ94293 200 µl
EUR 197.00
Description: MyD88 is a protein encoded by the MYD88 gene which is approximately 33,2 in kDa. MyD88 is localised to the cytoplasm. It is involved in activated TLR4 signalling and diseases associated with the TLR signalling cascade. It is a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. It functions as an essential signal transducer in the interleukin-1 and toll-like receptor signalling pathways that regulate the activation of numerous proinflammatory genes. MyD88 is expressed ubiquitously expressed in human tissues. Mutations in the MYD88 gene may result in macroglobulinemia and a MyD88 deficiency. STJ94293 was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen. This polyclonal antibody detects endogenous levels of MyD88 protein.

Anti-MYD88 Antibody

STJ501828 100 µg
EUR 476.00

Anti-MYD88 antibody

STJ70667 100 µg
EUR 359.00

Anti-MYD88 antibody

STJ24659 100 µl
EUR 277.00
Description: This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants.

Anti-MYD88 antibody

STJ114899 100 µl
EUR 277.00
Description: This gene encodes a cytosolic adapter protein that plays a central role in the innate and adaptive immune response. This protein functions as an essential signal transducer in the interleukin-1 and Toll-like receptor signaling pathways. These pathways regulate that activation of numerous proinflammatory genes. The encoded protein consists of an N-terminal death domain and a C-terminal Toll-interleukin1 receptor domain. Patients with defects in this gene have an increased susceptibility to pyogenic bacterial infections. Alternate splicing results in multiple transcript variants.

Anti-MYD88 antibody

STJ119242 100 µl
EUR 277.00

Rat Myd88/ Myeloid differentiation primary response protein MyD88 ELISA Kit

E0652Ra 1 Kit
EUR 571.00

Rat Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E02M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E02M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E02M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E03M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E03M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E03M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E01M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E01M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E01M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E04M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E04M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E04M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E08M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E08M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E08M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myd88/ Myeloid differentiation primary response protein MyD88 ELISA Kit

E0995Mo 1 Kit
EUR 571.00

Pig Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E07M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E07M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E07M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E06M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E06M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E06M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human MYD88/ Myeloid differentiation primary response protein MyD88 ELISA Kit

E1686Hu 1 Kit
EUR 571.00

Human MYD88(Myeloid differentiation primary response protein MyD88) ELISA Kit

EH0240 96T
EUR 524.10
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q99836
  • Alias: MYD88/MYD88D/myeloid differentiation primary response protein MyD88
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Monkey Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E09M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E09M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E09M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Myd88(Myeloid differentiation primary response protein MyD88) ELISA Kit

EM0669 96T
EUR 567.60
  • Detection range: 78-5000 pg/ml
  • Uniprot ID: P22366
  • Alias: Myd88/MYD88D/myeloid differentiation primary response gene(88)/myeloid differentiation primary response protein MyD88
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 46.9pg/ml

Phospho-Myd88 (Tyr257) Antibody

AF8490 200ul
EUR 376.00
Description: Myd88 (Phospho-Tyr257) Antibody detects endogenous levels of Myd88 only when phosphorylated at Tyr257.

Rat MYD88 shRNA Plasmid

20-abx989103
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human MYD88 ELISA Kit

ELA-E1707h 96 Tests
EUR 824.00

MYD88 ELISA KIT|Human

EF000194 96 Tests
EUR 689.00

Chicken MYD88 ELISA Kit

ELI-05537c 96 Tests
EUR 928.00

Mouse MyD88 ELISA Kit

ELI-05539m 96 Tests
EUR 865.00

Myd88 (Phospho- Tyr257) Antibody

ABF8490 100 ug
EUR 438.00

Human MYD88 shRNA Plasmid

20-abx953043
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

MyD88 recombinant monoclonal antibody

A5440 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human MyD88 for WB,ELISA

Myd88 (Phospho-Tyr257) Antibody

12764-100ul 100ul
EUR 252.00

Myd88 (Phospho-Tyr257) Antibody

12764-50ul 50ul
EUR 187.00

MYD88 protein (His tag)

30R-2958 100 ug
EUR 322.00
Description: Purified recombinant Human MYD88 protein (His tag)

Mouse MYD88 shRNA Plasmid

20-abx971641
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

MYD88 Antibody, HRP conjugated

1-CSB-PA859945LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYD88. Recognizes MYD88 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MYD88 Antibody, FITC conjugated

1-CSB-PA859945LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYD88. Recognizes MYD88 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MYD88 Antibody, Biotin conjugated

1-CSB-PA859945LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MYD88. Recognizes MYD88 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MyD88 Monoclonal Antibody

M00025 100ug
EUR 397.00
Description: Rabbit Monoclonal MyD88 Antibody. Validated in IF, IHC, WB and tested in Human.

Human MyD88 ELISA Kit

LF-EK50967 1×96T
EUR 648.00

MyD88 Recombinant Protein (Human)

RP020464 100 ug Ask for price

MyD88 Recombinant Protein (Rat)

RP212903 100 ug Ask for price

pEYFP-C1-Myd88-m

PVT18176 2 ug
EUR 258.00

pCMV-Flag--Myd88 Plasmid

PVTB00323-2a 2 ug
EUR 356.00

MyD88 Recombinant Protein (Mouse)

RP152522 100 ug Ask for price

Anti-MYD88, Biotinylated antibody

STJ73268 100 µg
EUR 359.00

Anti-MYD88 Antibody (Biotin)

STJ501829 100 µg
EUR 586.00

Anti-MYD88 Antibody (FITC)

STJ501830 100 µg
EUR 586.00

Guinea pig Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E05M0411-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E05M0411-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Myeloid differentiation primary response protein MyD88(MYD88) ELISA kit

E05M0411-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Myeloid differentiation primary response protein MyD88(MYD88) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Polyclonal MYD88 Antibody (aa233-248)

APR02374G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYD88 (aa233-248). This antibody is tested and proven to work in the following applications:

Polyclonal MYD88 Antibody (aa233-248)

APR02457G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYD88 (aa233-248). This antibody is tested and proven to work in the following applications:

Phospho-Myd88 (Tyr257) Blocking Peptide

AF8490-BP 1mg
EUR 195.00

Estimating the fraction of the T-cell response directed in opposition to the one immunodominant epitope, we establish the sequence options of TCRs that outline the excessive precursor frequency of the 2 main TCR motifs particular for this explicit epitope. We additionally present the consistency of clonal growth dynamics between bulk alpha and beta repertoires, utilizing a brand new methodology to reconstruct alpha-beta pairings from clonal trajectories.