BMI1

BMI1 antibody

70R-12196 100 ug
EUR 403.00
Description: Rabbit polyclonal BMI1 antibody

BMI1 antibody

70R-15307 100 ug
EUR 327.00
Description: Rabbit polyclonal BMI1 antibody

BMI1 antibody

70R-16009 50 ul
EUR 435.00
Description: Rabbit polyclonal BMI1 antibody

BMI1 Antibody

32015-100ul 100ul
EUR 252.00

BMI1 antibody

10R-8131 100 ug
EUR 457.00
Description: Mouse monoclonal BMI1 antibody

Bmi1 Antibody

48484-100ul 100ul
EUR 333.00

Bmi1 Antibody

48484-50ul 50ul
EUR 239.00

Bmi1 Antibody

49303-100ul 100ul
EUR 333.00

Bmi1 Antibody

49303-50ul 50ul
EUR 239.00

BMI1 Antibody

1-CSB-PA002726GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

BMI1 Antibody

DF6017 200ul
EUR 304.00
Description: BMI1 Antibody detects endogenous levels of total BMI1.

BMI1 Antibody

1-CSB-PA288653
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

BMI1 Antibody

1-CSB-PA03345A0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

BMI1 Antibody

BF0118 200ul
EUR 376.00
Description: BMI1 antibody detects endogenous levels of total BMI1.

BMI1 siRNA

20-abx909160
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BMI1 siRNA

20-abx909161
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BMI1 Antibody

ABD6017 100 ug
EUR 438.00

anti-Bmi1

YF-PA10492 100 ug
EUR 403.00
Description: Rabbit polyclonal to Bmi1

Bmi1 Monoclonal Antibody

27170-100ul 100ul
EUR 252.00

Bmi1 Monoclonal Antibody

27170-50ul 50ul
EUR 187.00

BMI1 polyclonal antibody

6862-50
EUR 251.00

BMI1 Rabbit pAb

A13472-100ul 100 ul
EUR 308.00

BMI1 Rabbit pAb

A13472-200ul 200 ul
EUR 459.00

BMI1 Rabbit pAb

A13472-20ul 20 ul
EUR 183.00

BMI1 Rabbit pAb

A13472-50ul 50 ul
EUR 223.00

BMI1 Blocking Peptide

33R-11004 50 ug
EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BMI1 antibody, catalog no. 70R-12196

BMI1 antibody (HRP)

60R-1751 100 ug
EUR 327.00
Description: Rabbit polyclonal BMI1 antibody (HRP)

BMI1 antibody (FITC)

60R-1752 100 ug
EUR 327.00
Description: Rabbit polyclonal BMI1 antibody (FITC)

BMI1 antibody (biotin)

60R-1753 100 ug
EUR 327.00
Description: Rabbit polyclonal BMI1 antibody (biotin)

BMI1 Blocking Peptide

DF6017-BP 1mg
EUR 195.00

Bmi1 Rabbit pAb

A0147-100ul 100 ul
EUR 308.00

Bmi1 Rabbit pAb

A0147-200ul 200 ul
EUR 459.00

Bmi1 Rabbit pAb

A0147-20ul 20 ul Ask for price

Bmi1 Rabbit pAb

A0147-50ul 50 ul Ask for price

BMI1 Rabbit pAb

A0211-100ul 100 ul
EUR 308.00

BMI1 Rabbit pAb

A0211-200ul 200 ul
EUR 459.00

BMI1 Rabbit pAb

A0211-20ul 20 ul
EUR 183.00

BMI1 Rabbit pAb

A0211-50ul 50 ul
EUR 223.00

BMI1 Polyclonal Antibody

A-2739 100 µl
EUR 724.25
Description: reagents widely cited

BMI1 Conjugated Antibody

C32015 100ul
EUR 397.00

Polyclonal BMI1 Antibody

APR06119G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 . This antibody is tested and proven to work in the following applications:

BMI1 Blocking Peptide

BF0118-BP 1mg
EUR 195.00

Monoclonal Bmi1 Antibody

AMM03214G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human Bmi1. The antibodies are raised in Mouse. This antibody is applicable in WB

BMI1 cloning plasmid

CSB-CL002726HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 981
  • Sequence: atgcatcgaacaacgagaatcaagatcactgagctaaatccccacctgatgtgtgtgctttgtggagggtacttcattgatgccacaaccataatagaatgtctacattccttctgtaaaacgtgtattgttcgttacctggagaccagcaagtattgtcctatttgtgatgtcca
  • Show more
Description: A cloning plasmid for the BMI1 gene.

BMI1 Polyclonal Antibody

A53945 100 µg
EUR 570.55
Description: Ask the seller for details

Bmi1 Rabbit mAb

A17914-100ul 100 ul
EUR 410.00

Bmi1 Rabbit mAb

A17914-200ul 200 ul
EUR 571.00

Bmi1 Rabbit mAb

A17914-20ul 20 ul
EUR 221.00

Bmi1 Rabbit mAb

A17914-50ul 50 ul
EUR 287.00

BMI1 Rabbit pAb

A2253-100ul 100 ul
EUR 384.00

BMI1 Rabbit pAb

A2253-200ul 200 ul Ask for price

BMI1 Rabbit pAb

A2253-20ul 20 ul Ask for price

BMI1 Rabbit pAb

A2253-50ul 50 ul
EUR 265.00

anti- BMI1 antibody

FNab00913 100µg
EUR 548.75
  • Immunogen: BMI1 polycomb ring finger oncogene
  • Uniprot ID: P35226
  • Gene ID: 648
  • Research Area: Epigenetics, Metabolism, Cancer, Developmental biology, Stem Cells, Cell Division and Proliferation
Description: Antibody raised against BMI1

anti- BMI1 antibody

FNab00914 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:2000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: BMI1 polycomb ring finger oncogene
  • Uniprot ID: P35226
  • Gene ID: 648
  • Research Area: Epigenetics, Metabolism, Cancer, Developmental biology, Stem Cells,
  • Show more
Description: Antibody raised against BMI1

Lenti-Bmi1 Virus

LV610 10 ml
EUR 811.00

Anti-Bmi1 Antibody

PA1807 100ug/vial
EUR 294.00

anti-BMI1 (3E3)

LF-MA30648 100 ul
EUR 527.00
Description: Mouse Monoclonal to BMI1

Anti-BMI1 antibody

PAab00913 100 ug
EUR 386.00

Anti-Bmi1 Antibody

PB9133 100ug/vial
EUR 294.00

pOTB7-Bmi1 Plasmid

PVTB00138 2 ug
EUR 356.00

Anti-BMI1 antibody

STJ110920 100 µl
EUR 277.00
Description: This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene.

Anti-BMI1 antibody

STJ115433 100 µl
EUR 277.00
Description: This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene.

Anti-BMI1 antibody

STJ73429 100 µg
EUR 359.00

Anti-BMI1 antibody

STJ22809 100 µl
EUR 277.00
Description: This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene.

Anti-BMI1 antibody

STJ22810 100 µl
EUR 393.00
Description: This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene.

Polyclonal BMI1 polyclonal antibody

APR00376G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 polyclonal antibody

APR00457G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 polyclonal . This antibody is tested and proven to work in the following applications:

BMI1 Antibody, HRP conjugated

1-CSB-PA03345B0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BMI1 Antibody, FITC conjugated

1-CSB-PA03345C0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BMI1 Antibody, Biotin conjugated

1-CSB-PA03345D0Rb
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

BMI1 ELISA KIT|Human

EF008126 96 Tests
EUR 689.00

Bmi1 Conjugated Monoclonal Antibody

C27170 100ul
EUR 397.00

Mouse BMI1 shRNA Plasmid

20-abx969363
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human BMI1 shRNA Plasmid

20-abx950443
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Bmi1 recombinant monoclonal antibody

A5694 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human Bmi1 for WB, IF,ELISA

pCDNA3.1- BMI1- 6*His

PVT10366 2 ug
EUR 301.00

Bmi1 Recombinant Protein (Human)

RP003106 100 ug Ask for price

Bmi1 Recombinant Protein (Rat)

RP192251 100 ug Ask for price

Bmi1 Recombinant Protein (Mouse)

RP119657 100 ug Ask for price

Anti-Bmi1 (4E10-1C5)

YF-MA10096 100 ug
EUR 363.00
Description: Mouse monoclonal to Bmi1

Human Polycomb complex protein BMI-1 (BMI1) control (BMI1- phosphor) peptide

AB-23273-P 100ug
EUR 164.00

Polyclonal BMI1 Antibody (C-term)

APR04885G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 Antibody (C-term)

AMM08756G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 Antibody (C-Term)

APG00938G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human BMI1 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 Antibody (C-term)

APR06944G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 (C-term). This antibody is tested and proven to work in the following applications:

Monoclonal BMI1 Antibody, Clone: 282CT3.7.6

AMM02364G 0.1ml
EUR 484.00
Description: A Monoclonal antibody against Human BMI1. The antibodies are raised in Mouse and are from clone 282CT3.7.6. This antibody is applicable in WB and IF, E

BMI1 Polyclonal Antibody, HRP Conjugated

A53946 100 µg
EUR 570.55
Description: The best epigenetics products

BMI1 Polyclonal Antibody, FITC Conjugated

A53947 100 µg
EUR 570.55
Description: kits suitable for this type of research

BMI1 Polyclonal Antibody, Biotin Conjugated

A53948 100 µg
EUR 570.55
Description: fast delivery possible