BMI1

BMI1 antibody
70R-12196	Fitzgerald	100 ug	EUR 403.00
Description: Rabbit polyclonal BMI1 antibody

BMI1 antibody
70R-15307	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal BMI1 antibody

BMI1 antibody
70R-16009	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal BMI1 antibody

BMI1 Antibody
32015-100ul	SAB	100ul	EUR 252.00

BMI1 antibody
10R-8131	Fitzgerald	100 ug	EUR 457.00
Description: Mouse monoclonal BMI1 antibody

Bmi1 Antibody
48484-100ul	SAB	100ul	EUR 333.00

Bmi1 Antibody
48484-50ul	SAB	50ul	EUR 239.00

Bmi1 Antibody
49303-100ul	SAB	100ul	EUR 333.00

Bmi1 Antibody
49303-50ul	SAB	50ul	EUR 239.00

BMI1 Antibody
1-CSB-PA002726GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

BMI1 Antibody
DF6017	Affbiotech	200ul	EUR 304.00
Description: BMI1 Antibody detects endogenous levels of total BMI1.

BMI1 Antibody
1-CSB-PA288653	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

BMI1 Antibody
1-CSB-PA03345A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

BMI1 Antibody
BF0118	Affbiotech	200ul	EUR 376.00
Description: BMI1 antibody detects endogenous levels of total BMI1.

BMI1 siRNA
20-abx909160	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BMI1 siRNA
20-abx909161	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BMI1 Antibody
ABD6017	Lifescience Market	100 ug	EUR 438.00

anti-Bmi1
YF-PA10492	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to Bmi1

Bmi1 Monoclonal Antibody
27170-100ul	SAB	100ul	EUR 252.00

Bmi1 Monoclonal Antibody
27170-50ul	SAB	50ul	EUR 187.00

BMI1 polyclonal antibody
6862-50	Biovision		EUR 251.00

BMI1 Rabbit pAb
A13472-100ul	Abclonal	100 ul	EUR 308.00

BMI1 Rabbit pAb
A13472-200ul	Abclonal	200 ul	EUR 459.00

BMI1 Rabbit pAb
A13472-20ul	Abclonal	20 ul	EUR 183.00

BMI1 Rabbit pAb
A13472-50ul	Abclonal	50 ul	EUR 223.00

BMI1 Blocking Peptide
33R-11004	Fitzgerald	50 ug	EUR 191.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BMI1 antibody, catalog no. 70R-12196

BMI1 antibody (HRP)
60R-1751	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal BMI1 antibody (HRP)

BMI1 antibody (FITC)
60R-1752	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal BMI1 antibody (FITC)

BMI1 antibody (biotin)
60R-1753	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal BMI1 antibody (biotin)

BMI1 Blocking Peptide
DF6017-BP	Affbiotech	1mg	EUR 195.00

Bmi1 Rabbit pAb
A0147-100ul	Abclonal	100 ul	EUR 308.00

Bmi1 Rabbit pAb
A0147-200ul	Abclonal	200 ul	EUR 459.00

Bmi1 Rabbit pAb
A0147-20ul	Abclonal	20 ul	Ask for price

Bmi1 Rabbit pAb
A0147-50ul	Abclonal	50 ul	Ask for price

BMI1 Rabbit pAb
A0211-100ul	Abclonal	100 ul	EUR 308.00

BMI1 Rabbit pAb
A0211-200ul	Abclonal	200 ul	EUR 459.00

BMI1 Rabbit pAb
A0211-20ul	Abclonal	20 ul	EUR 183.00

BMI1 Rabbit pAb
A0211-50ul	Abclonal	50 ul	EUR 223.00

BMI1 Polyclonal Antibody
A-2739	EpiGentek	100 µl	EUR 724.25
Description: reagents widely cited

BMI1 Conjugated Antibody
C32015	SAB	100ul	EUR 397.00

Polyclonal BMI1 Antibody
APR06119G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 . This antibody is tested and proven to work in the following applications:

BMI1 Blocking Peptide
BF0118-BP	Affbiotech	1mg	EUR 195.00

Monoclonal Bmi1 Antibody
AMM03214G	Leading Biology	0.1ml	EUR 484.00
Description: A Monoclonal antibody against Human Bmi1. The antibodies are raised in Mouse. This antibody is applicable in WB

BMI1 cloning plasmid
CSB-CL002726HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 981 Sequence: atgcatcgaacaacgagaatcaagatcactgagctaaatccccacctgatgtgtgtgctttgtggagggtacttcattgatgccacaaccataatagaatgtctacattccttctgtaaaacgtgtattgttcgttacctggagaccagcaagtattgtcctatttgtgatgtcca Show more
Description: A cloning plasmid for the BMI1 gene.

BMI1 Polyclonal Antibody
A53945	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Bmi1 Rabbit mAb
A17914-100ul	Abclonal	100 ul	EUR 410.00

Bmi1 Rabbit mAb
A17914-200ul	Abclonal	200 ul	EUR 571.00

Bmi1 Rabbit mAb
A17914-20ul	Abclonal	20 ul	EUR 221.00

Bmi1 Rabbit mAb
A17914-50ul	Abclonal	50 ul	EUR 287.00

BMI1 Rabbit pAb
A2253-100ul	Abclonal	100 ul	EUR 384.00

BMI1 Rabbit pAb
A2253-200ul	Abclonal	200 ul	Ask for price

BMI1 Rabbit pAb
A2253-20ul	Abclonal	20 ul	Ask for price

BMI1 Rabbit pAb
A2253-50ul	Abclonal	50 ul	EUR 265.00

anti- BMI1 antibody
FNab00913	FN Test	100µg	EUR 548.75
Immunogen: BMI1 polycomb ring finger oncogene Uniprot ID: P35226 Gene ID: 648 Research Area: Epigenetics, Metabolism, Cancer, Developmental biology, Stem Cells, Cell Division and Proliferation
Description: Antibody raised against BMI1

anti- BMI1 antibody
FNab00914	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:2000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: BMI1 polycomb ring finger oncogene Uniprot ID: P35226 Gene ID: 648 Research Area: Epigenetics, Metabolism, Cancer, Developmental biology, Stem Cells, Show more
Description: Antibody raised against BMI1

Lenti-Bmi1 Virus
LV610	ABM	10 ml	EUR 811.00

Anti-Bmi1 Antibody
PA1807	BosterBio	100ug/vial	EUR 294.00

anti-BMI1 (3E3)
LF-MA30648	Abfrontier	100 ul	EUR 527.00
Description: Mouse Monoclonal to BMI1

Anti-BMI1 antibody
PAab00913	Lifescience Market	100 ug	EUR 386.00

Anti-Bmi1 Antibody
PB9133	BosterBio	100ug/vial	EUR 294.00

pOTB7-Bmi1 Plasmid
PVTB00138	Lifescience Market	2 ug	EUR 356.00

Anti-BMI1 antibody
STJ110920	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene.

Anti-BMI1 antibody
STJ115433	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene.

Anti-BMI1 antibody
STJ73429	St John's Laboratory	100 µg	EUR 359.00

Anti-BMI1 antibody
STJ22809	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene.

Anti-BMI1 antibody
STJ22810	St John's Laboratory	100 µl	EUR 393.00
Description: This gene encodes a ring finger protein that is major component of the polycomb group complex 1 (PRC1). This complex functions through chromatin remodeling as an essential epigenetic repressor of multiple regulatory genes involved in embryonic development and self-renewal in somatic stem cells. This protein also plays a central role in DNA damage repair. This gene is an oncogene and aberrant expression is associated with numerous cancers and is associated with resistance to certain chemotherapies. A pseudogene of this gene is found on chromosome X. Read-through transcription also exists between this gene and the upstream COMM domain containing 3 (COMMD3) gene.

Polyclonal BMI1 polyclonal antibody
APR00376G	Leading Biology	0.05ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 polyclonal . This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 polyclonal antibody
APR00457G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 polyclonal . This antibody is tested and proven to work in the following applications:

BMI1 Antibody, HRP conjugated
1-CSB-PA03345B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BMI1 Antibody, FITC conjugated
1-CSB-PA03345C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BMI1 Antibody, Biotin conjugated
1-CSB-PA03345D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BMI1. Recognizes BMI1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

BMI1 ELISA KIT|Human
EF008126	Lifescience Market	96 Tests	EUR 689.00

Bmi1 Conjugated Monoclonal Antibody
C27170	SAB	100ul	EUR 397.00

Mouse BMI1 shRNA Plasmid
20-abx969363	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human BMI1 shRNA Plasmid
20-abx950443	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Bmi1 recombinant monoclonal antibody
A5694	Bimake	100ul X 3	EUR 595.00
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human Bmi1 for WB, IF,ELISA

pCDNA3.1- BMI1- 6*His
PVT10366	Lifescience Market	2 ug	EUR 301.00

Bmi1 Recombinant Protein (Human)
RP003106	ABM	100 ug	Ask for price

Bmi1 Recombinant Protein (Rat)
RP192251	ABM	100 ug	Ask for price

Bmi1 Recombinant Protein (Mouse)
RP119657	ABM	100 ug	Ask for price

Anti-Bmi1 (4E10-1C5)
YF-MA10096	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to Bmi1

Human Polycomb complex protein BMI-1 (BMI1) control (BMI1- phosphor) peptide
AB-23273-P	Alpha Diagnostics	100ug	EUR 164.00

Polyclonal BMI1 Antibody (C-term)
APR04885G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 Antibody (C-term)
AMM08756G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 Antibody (C-Term)
APG00938G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human BMI1 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal BMI1 Antibody (C-term)
APR06944G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BMI1 (C-term). This antibody is tested and proven to work in the following applications:

Monoclonal BMI1 Antibody, Clone: 282CT3.7.6
AMM02364G	Leading Biology	0.1ml	EUR 484.00
Description: A Monoclonal antibody against Human BMI1. The antibodies are raised in Mouse and are from clone 282CT3.7.6. This antibody is applicable in WB and IF, E

BMI1 Polyclonal Antibody, HRP Conjugated
A53946	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

BMI1 Polyclonal Antibody, FITC Conjugated
A53947	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

BMI1 Polyclonal Antibody, Biotin Conjugated
A53948	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible