Recombinant Human ATP5F1A

P0550 100ug
EUR 522.36
  • Formulation: pH7.4, Lyophilized from a 0.2um filtered solution in PBS with 5% trehalose
  • Reconstitution: Sterile distilled water
  • Purity: Greater than 95% by SDS-PAGE gel analyses
  • Uniprot ID: P25705
Description: Recombinant Human protein for ATP5F1A


PVT13074 2 ug
EUR 391.00

ATP5F1A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP5F1A. Recognizes ATP5F1A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ATP5F1A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP5F1A. Recognizes ATP5F1A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ATP5F1A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ATP5F1A. Recognizes ATP5F1A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human ATP synthase subunit alpha, mitochondrial (ATP5F1A)

  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 57.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human ATP synthase subunit alpha, mitochondrial(ATP5F1A) expressed in Yeast

Human ATP synthase subunit alpha, mitochondrial (ATP5F1A)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 59.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human ATP synthase subunit alpha, mitochondrial(ATP5F1A) expressed in E.coli

Human ATP synthase subunit alpha, mitochondrial (ATP5F1A)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 71.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human ATP synthase subunit alpha, mitochondrial(ATP5F1A) expressed in E.coli


SLC25A6 Antibody
34388-100ul 100ul
EUR 252.00
SLC25A6 Antibody
34388-50ul 50ul
EUR 187.00
SLC25A6 Antibody
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
SLC25A6 Antibody
DF3742 200ul
EUR 304.00
Description: SLC25A6 Antibody detects endogenous levels of total SLC25A6.
SLC25A6 Antibody
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SLC25A6 Antibody
CSB-PA238544-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SLC25A6 antibody
70R-6466 50 ug
EUR 467.00
Description: Rabbit polyclonal SLC25A6 antibody
SLC25A6 antibody
70R-33998 100 ug
EUR 327.00
Description: Rabbit polyclonal SLC25A6 antibody
SLC25A6 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SLC25A6 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:1000-1:2000
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SLC25A6 Antibody
ABD3742 100 ug
EUR 438.00
YF-PA10214 100 ug
EUR 403.00
Description: Rabbit polyclonal to SLC25A6
YF-PA23214 50 ul
EUR 334.00
Description: Mouse polyclonal to SLC25A6
Anti-SLC25A6 Antibody
A09457 100ul
EUR 397.00
Description: Rabbit Polyclonal SLC25A6 Antibody. Validated in WB and tested in Human.
SLC25A6 Blocking Peptide
33R-5346 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC25A6 antibody, catalog no. 70R-6466
SLC25A6 Blocking Peptide
DF3742-BP 1mg
EUR 195.00
SLC25A6-Specific Antibody
abx237947-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
SLC25A6 Conjugated Antibody
C34388 100ul
EUR 397.00
SLC25A6 cloning plasmid
CSB-CL021520HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt
  • Show more
Description: A cloning plasmid for the SLC25A6 gene.
SLC25A6 cloning plasmid
CSB-CL021520HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt
  • Show more
Description: A cloning plasmid for the SLC25A6 gene.
SLC25A6 cloning plasmid
CSB-CL021520HU3-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt
  • Show more
Description: A cloning plasmid for the SLC25A6 gene.
SLC25A6 Rabbit pAb
A3585-100ul 100 ul
EUR 308.00
SLC25A6 Rabbit pAb
A3585-200ul 200 ul
EUR 459.00
SLC25A6 Rabbit pAb
A3585-20ul 20 ul
EUR 183.00
SLC25A6 Rabbit pAb
A3585-50ul 50 ul
EUR 223.00
SLC25A6 Rabbit pAb
A15029-100ul 100 ul
EUR 308.00
SLC25A6 Rabbit pAb
A15029-200ul 200 ul
EUR 459.00
SLC25A6 Rabbit pAb
A15029-20ul 20 ul
EUR 183.00
SLC25A6 Rabbit pAb
A15029-50ul 50 ul
EUR 223.00
anti- SLC25A6 antibody
FNab07946 100µg
EUR 548.75
  • Immunogen: solute carrier family 25(mitochondrial carrier
  • adenine nucleotide translocator), member 6
  • Uniprot ID: P12236
  • Gene ID: 293
  • Research Area: Metabolism
Description: Antibody raised against SLC25A6
Anti-SLC25A6 antibody
PAab07946 100 ug
EUR 386.00
pDONR223-SLC25A6 Plasmid
PVTB01143-1 2 ug
EUR 356.00
Anti-SLC25A6 antibody
STJ25572 100 µl
EUR 277.00
Description: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.
Anti-SLC25A6 antibody
STJ117223 100 µl
EUR 277.00
Description: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.
Anti-SLC25A6 (2A9)
YF-MA11936 100 ug
EUR 363.00
Description: Mouse monoclonal to SLC25A6
Anti-SLC25A6 (4B9)
YF-MA11937 100 ug
EUR 363.00
Description: Mouse monoclonal to SLC25A6
Human SLC25A6 ELISA Kit
ELA-E11022h 96 Tests
EUR 824.00
EF003120 96 Tests
EUR 689.00
SLC25A6 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC25A6 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC25A6 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SLC25A6 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
anti- SLC25A6-Specific antibody
FNab07947 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: solute carrier family 25(mitochondrial carrier
  • adenine nucleotide translocator), member 6
  • Uniprot ID: P12236
  • Research Area: Metabolism
Description: Antibody raised against SLC25A6-Specific
Anti-SLC25A6-Specific antibody
PAab07947 100 ug
EUR 386.00
pENTR223-SLC25A6-C408T vector
PVT11711 2 ug
EUR 304.00
SLC25A6 Recombinant Protein (Human)
RP028915 100 ug Ask for price
SLC25A6 Recombinant Protein (Human)
RP028918 100 ug Ask for price
SLC25A6 Recombinant Protein (Human)
RP028921 100 ug Ask for price
SLC25A6 ORF Vector (Human) (pORF)
ORF009639 1.0 ug DNA
EUR 95.00
SLC25A6 ORF Vector (Human) (pORF)
ORF009640 1.0 ug DNA
EUR 95.00
SLC25A6 ORF Vector (Human) (pORF)
ORF009641 1.0 ug DNA
EUR 95.00
SLC25A6 ELISA Kit (Human) (OKEH02131)
OKEH02131 96 Wells
EUR 662.00
Description: Description of target: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.045 ng/mL
SLC25A6 ELISA Kit (Bovine) (OKEH07686)
OKEH07686 96 Wells
EUR 1092.00
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
SLC25A6 ELISA Kit (Pig) (OKEH07687)
OKEH07687 96 Wells
EUR 1092.00
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
Polyclonal SLC25A6 antibody - N-terminal region
APR01388G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC25A6 - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal SLC25A6 / ANT3 Antibody (aa121-170)
APR10035G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC25A6 / ANT3 (aa121-170). This antibody is tested and proven to work in the following applications:
ADP/ATP Translocase 3 (SLC25A6) Antibody
abx026644-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
abx026644-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
abx237946-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
ADP/ATP translocase 3 (SLC25A6) Antibody
abx331163-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.
ADP/ATP translocase 3 (SLC25A6) Antibody
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
SLC25A6 sgRNA CRISPR Lentivector set (Human)
K2176901 3 x 1.0 ug
EUR 339.00
Monoclonal SLC25A6 Antibody (monoclonal) (M01), Clone: 2A9
APR10036G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human SLC25A6 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A9. This antibody is applicable in WB, E
ADP/ATP Translocase 3 (SLC25A6) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2176902 1.0 ug DNA
EUR 154.00
SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2176903 1.0 ug DNA
EUR 154.00
SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2176904 1.0 ug DNA
EUR 154.00
SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038553 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038554 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038555 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPM-C-His)
PV038556 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038557 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038558 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038559 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPM-C-His)
PV038560 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038561 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038562 500 ng
EUR 329.00
SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038563 500 ng
EUR 329.00


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SLC34A2 Antibody
ABD13266 100 ug
EUR 438.00
SLC34A2 Antibody
ABD2244 100 ug
EUR 438.00
SLC34A2 Antibody
37035-100ul 100ul
EUR 252.00
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SLC34A2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC34A2. Recognizes SLC34A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
SLC34A2 Antibody
DF2244 200ul
EUR 304.00
Description: SLC34A2 antibody detects endogenous levels of total SLC34A2.
SLC34A2 Antibody
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SLC34A2. Recognizes SLC34A2 from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
SLC34A2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SLC34A2. Recognizes SLC34A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300
SLC34A2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC34A2. Recognizes SLC34A2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SLC34A2 Conjugated Antibody
C37035 100ul
EUR 397.00
anti- SLC34A2 antibody
FNab07952 100µg
EUR 585.00
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: solute carrier family 34(sodium phosphate), member 2
  • Uniprot ID: O95436
  • Gene ID: 10568
  • Research Area: Metabolism
Description: Antibody raised against SLC34A2
SLC34A2 Rabbit pAb
A9460-100ul 100 ul
EUR 308.00
SLC34A2 Rabbit pAb
A9460-200ul 200 ul
EUR 459.00
SLC34A2 Rabbit pAb
A9460-20ul 20 ul
EUR 183.00
SLC34A2 Rabbit pAb
A9460-50ul 50 ul
EUR 223.00
Anti-SLC34A2 Antibody
A03957-1 100ug/vial
EUR 334.00
SLC34A2 Blocking Peptide
DF2244-BP 1mg
EUR 195.00
Anti-SLC34A2 antibody
PAab07952 100 ug
EUR 412.00
Anti-SLC34A2 antibody
STJ111708 100 µl
EUR 277.00
Description: The protein encoded by this gene is a pH-sensitive sodium-dependent phosphate transporter. Phosphate uptake is increased at lower pH. Defects in this gene are a cause of pulmonary alveolar microlithiasis. Three transcript variants encoding two different isoforms have been found for this gene.
Rat SLC34A2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse Slc34a2 ELISA KIT
ELI-13705m 96 Tests
EUR 865.00
EF003001 96 Tests
EUR 689.00
ELI-38125b 96 Tests
EUR 928.00
ELI-38126h 96 Tests
EUR 824.00
Human SLC34A2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse SLC34A2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
SLC34A2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC34A2. Recognizes SLC34A2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC34A2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC34A2. Recognizes SLC34A2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC34A2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC34A2. Recognizes SLC34A2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
SLC34A2 Recombinant Protein (Human)
RP097389 100 ug Ask for price
SLC34A2 Recombinant Protein (Rat)
RP229427 100 ug Ask for price
SLC34A2 Recombinant Protein (Mouse)
RP172913 100 ug Ask for price
pCMV-SPORT6-SLC34A2 Plasmid
PVT17147 2 ug
EUR 325.00
SLC34A2 ORF Vector (Human) (pORF)
ORF032464 1.0 ug DNA
EUR 405.00
Slc34a2 ORF Vector (Mouse) (pORF)
ORF057639 1.0 ug DNA
EUR 506.00
Slc34a2 ORF Vector (Rat) (pORF)
ORF076477 1.0 ug DNA
EUR 506.00
Anti-SLC34A2 (Lifastuzumab )-SMCC-DM1 ADC
ADC-W-2571 1mg Ask for price
Description: This ADC product is comprised of an anti-SLC34A2 monoclonal antibody conjugated via a SMCC linker to DM1
Anti-SLC34A2 (Lifastuzumab )-SPDB-DM4 ADC
ADC-W-2572 1mg Ask for price
Description: This ADC product is comprised of an anti-SLC34A2 monoclonal antibody conjugated via a SPDB linker to DM4
Anti-SLC34A2 (Lifastuzumab )-MC-MMAF ADC
ADC-W-2573 1mg Ask for price
Description: This ADC product is comprised of an anti-SLC34A2 monoclonal antibody conjugated via a MC linker to MMAF
Anti-SLC34A2 (Lifastuzumab)-VC-MMAE ADC
ADC-W-499 1mg Ask for price
Description: This ADC product is comprised of an anti-SLC34A2 monoclonal antibody conjugated via a mc-VC-PABC linker to MMAE
SLC34A2 sgRNA CRISPR Lentivector set (Human)
K2185001 3 x 1.0 ug
EUR 339.00
Slc34a2 sgRNA CRISPR Lentivector set (Mouse)
K3417501 3 x 1.0 ug
EUR 339.00
Slc34a2 sgRNA CRISPR Lentivector set (Rat)
K7034101 3 x 1.0 ug
EUR 339.00
SLC34A2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2185002 1.0 ug DNA
EUR 154.00
SLC34A2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2185003 1.0 ug DNA
EUR 154.00
SLC34A2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2185004 1.0 ug DNA
EUR 154.00
Slc34a2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3417502 1.0 ug DNA
EUR 154.00
Slc34a2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3417503 1.0 ug DNA
EUR 154.00
Slc34a2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3417504 1.0 ug DNA
EUR 154.00
Slc34a2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7034102 1.0 ug DNA
EUR 154.00
Slc34a2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7034103 1.0 ug DNA
EUR 154.00
Slc34a2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7034104 1.0 ug DNA
EUR 154.00
SLC34A2 Protein Vector (Human) (pPB-C-His)
PV129854 500 ng
EUR 811.00
SLC34A2 Protein Vector (Human) (pPB-N-His)
PV129855 500 ng
EUR 811.00
SLC34A2 Protein Vector (Human) (pPM-C-HA)
PV129856 500 ng
EUR 811.00
SLC34A2 Protein Vector (Human) (pPM-C-His)
PV129857 500 ng
EUR 811.00
Recombinant Human SLC34A2 Protein, His, Yeast-100ug
QP9403-ye-100ug 100ug
EUR 480.00
Recombinant Human SLC34A2 Protein, His, Yeast-10ug
QP9403-ye-10ug 10ug
EUR 236.00
Recombinant Human SLC34A2 Protein, His, Yeast-1mg
QP9403-ye-1mg 1mg
EUR 1885.00
Recombinant Human SLC34A2 Protein, His, Yeast-200ug
QP9403-ye-200ug 200ug
EUR 744.00
Recombinant Human SLC34A2 Protein, His, Yeast-500ug
QP9403-ye-500ug 500ug
EUR 1206.00
Recombinant Human SLC34A2 Protein, His, Yeast-50ug
QP9403-ye-50ug 50ug
EUR 299.00
SLC34A2 Protein Vector (Rat) (pPB-C-His)
PV305906 500 ng
EUR 1166.00
SLC34A2 Protein Vector (Rat) (pPB-N-His)
PV305907 500 ng
EUR 1166.00
SLC34A2 Protein Vector (Rat) (pPM-C-HA)
PV305908 500 ng
EUR 1166.00
SLC34A2 Protein Vector (Rat) (pPM-C-His)
PV305909 500 ng
EUR 1166.00
SLC34A2 Protein Vector (Mouse) (pPB-C-His)
PV230554 500 ng
EUR 1065.00
SLC34A2 Protein Vector (Mouse) (pPB-N-His)
PV230555 500 ng
EUR 1065.00
SLC34A2 Protein Vector (Mouse) (pPM-C-HA)
PV230556 500 ng
EUR 1065.00
SLC34A2 Protein Vector (Mouse) (pPM-C-His)
PV230557 500 ng
EUR 1065.00
Slc34a2 3'UTR GFP Stable Cell Line
TU169081 1.0 ml Ask for price
SLC34A2 3'UTR Luciferase Stable Cell Line
TU023567 1.0 ml
EUR 1521.00
Slc34a2 3'UTR Luciferase Stable Cell Line
TU119081 1.0 ml Ask for price
SLC34A2 3'UTR GFP Stable Cell Line
TU073567 1.0 ml
EUR 1521.00
Slc34a2 3'UTR Luciferase Stable Cell Line
TU220605 1.0 ml Ask for price
Slc34a2 3'UTR GFP Stable Cell Line
TU270605 1.0 ml Ask for price
Anti-SLC34A2 (Lifastuzumab )-MC-Vc-PAB-MMAE ADC
ADC-W-2574 1mg Ask for price
Description: This ADC product is comprised of an anti-SLC34A2 monoclonal antibody conjugated via a MC-Vc linker to MMAE
Anti-SLC34A2 (Lifastuzumab )-MC-Vc-PAB-SN38 ADC
ADC-W-2575 1mg Ask for price
Description: This ADC product is comprised of an anti-SLC34A2 monoclonal antibody conjugated via a MC-Vc-PAB linker to SN38
Solute Carrier Family 34 Member 2 (SLC34A2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Solute Carrier Family 34 Member 2 (SLC34A2) Antibody
abx217038-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.
Solute Carrier Family 34 Member 2 (SLC34A2) Antibody
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Solute Carrier Family 34 Member 2 (SLC34A2) Antibody
abx237952-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.
Solute Carrier Family 34 Member 2 (SLC34A2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.



  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ADAMTS15 Antibody

35644-100ul 100ul
EUR 252.00

ADAMTS15 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

ADAMTS15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

ADAMTS15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADAMTS15 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ADAMTS15 Conjugated Antibody

C35644 100ul
EUR 397.00

ADAMTS15 Polyclonal Antibody

A70063 100 ?g
EUR 628.55
Description: kits suitable for this type of research

ADAMTS15 cloning plasmid

CSB-CL837445HU-10ug 10ug
EUR 909.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2853
  • Show more
Description: A cloning plasmid for the ADAMTS15 gene.


YF-PA26950 50 ul
EUR 334.00
Description: Mouse polyclonal to Anti-ADAMTS15

Human ADAMTS15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Adamts15 ELISA KIT

ELI-11462m 96 Tests
EUR 865.00


ELI-24449h 96 Tests
EUR 824.00

Mouse ADAMTS15 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

ADAMTS15 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ADAMTS15 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ADAMTS15 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ADAMTS15. Recognizes ADAMTS15 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ADAMTS15 Polyclonal Antibody, HRP Conjugated

A70064 100 ?g
EUR 628.55
Description: fast delivery possible

ADAMTS15 Polyclonal Antibody, FITC Conjugated

A70065 100 ?g
EUR 628.55
Description: reagents widely cited

ADAMTS15 Polyclonal Antibody, Biotin Conjugated

A70066 100 ?g
EUR 628.55
Description: Ask the seller for details

Adamts15 ORF Vector (Mouse) (pORF)

ORF038101 1.0 ug DNA
EUR 506.00

ADAMTS15 ORF Vector (Human) (pORF)

ORF012152 1.0 ug DNA
EUR 354.00

Adamts15 ORF Vector (Rat) (pORF)

ORF063065 1.0 ug DNA
EUR 506.00

ADAMTS15 sgRNA CRISPR Lentivector set (Human)

K0044901 3 x 1.0 ug
EUR 339.00

Adamts15 sgRNA CRISPR Lentivector set (Mouse)

K3586201 3 x 1.0 ug
EUR 339.00

Adamts15 sgRNA CRISPR Lentivector set (Rat)

K6380501 3 x 1.0 ug
EUR 339.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 1)

K0044902 1.0 ug DNA
EUR 154.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 2)

K0044903 1.0 ug DNA
EUR 154.00

ADAMTS15 sgRNA CRISPR Lentivector (Human) (Target 3)

K0044904 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3586202 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3586203 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3586204 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6380502 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6380503 1.0 ug DNA
EUR 154.00

Adamts15 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6380504 1.0 ug DNA
EUR 154.00

ADAMTS15 Protein Vector (Human) (pPB-C-His)

PV048605 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPB-N-His)

PV048606 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPM-C-HA)

PV048607 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPM-C-His)

PV048608 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPB-His-MBP)

PV319854 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Human) (pPB-His-GST)

PV319855 500 ng
EUR 481.00

ADAMTS15 Protein Vector (Mouse) (pPB-C-His)

PV152402 500 ng
EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPB-N-His)

PV152403 500 ng
EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPM-C-HA)

PV152404 500 ng
EUR 1065.00

ADAMTS15 Protein Vector (Mouse) (pPM-C-His)

PV152405 500 ng
EUR 1065.00

ADAMTS15 Protein Vector (Rat) (pPB-C-His)

PV252258 500 ng
EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPB-N-His)

PV252259 500 ng
EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPM-C-HA)

PV252260 500 ng
EUR 1191.00

ADAMTS15 Protein Vector (Rat) (pPM-C-His)

PV252261 500 ng
EUR 1191.00

Adamts15 3'UTR Luciferase Stable Cell Line

TU200275 1.0 ml Ask for price



  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GMPPB Antibody

47393-100ul 100ul
EUR 252.00

GMPPB antibody

70R-17516 50 ul
EUR 435.00
Description: Rabbit polyclonal GMPPB antibody

GMPPB antibody

70R-1204 100 ug
EUR 377.00
Description: Rabbit polyclonal GMPPB antibody raised against the C terminal of GMPPB

GMPPB Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GMPPB Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GMPPB Conjugated Antibody

C47393 100ul
EUR 397.00

anti- GMPPB antibody

FNab03527 100µg
EUR 548.75
  • Immunogen: GDP-mannose pyrophosphorylase B
  • Uniprot ID: Q9Y5P6
  • Gene ID: 29925
  • Research Area: Metabolism
Description: Antibody raised against GMPPB

GMPPB Polyclonal Antibody

A59258 100 µg
EUR 570.55
Description: The best epigenetics products

GMPPB Rabbit pAb

A16520-100ul 100 ul
EUR 308.00

GMPPB Rabbit pAb

A16520-200ul 200 ul
EUR 459.00

GMPPB Rabbit pAb

A16520-20ul 20 ul
EUR 183.00

GMPPB Rabbit pAb

A16520-50ul 50 ul
EUR 223.00

GMPPB Blocking Peptide

33R-7838 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GMPPB antibody, catalog no. 70R-1204

GMPPB cloning plasmid

CSB-CL896740HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgaaggcactgatcttagtggggggctatgggacgcggctacggccgctgacgctgagcaccccgaagccactggtggacttctgcaataagcccatcttgctgcaccaagtggaggcgctagccgcggcaggcgtggaccacgtgatcctggccgtgagctacatgtcgcagg
  • Show more
Description: A cloning plasmid for the GMPPB gene.

Anti-GMPPB antibody

PAab03527 100 ug
EUR 386.00

pENTR223-GMPPB vector

PVT11908 2 ug
EUR 308.00

Anti-GMPPB antibody

STJ118959 100 µl
EUR 277.00

Anti-GMPPB (2B5)

YF-MA11473 100 ug
EUR 363.00
Description: Mouse monoclonal to GMPPB

Polyclonal GMPPB Antibody (Center)

AMM04824G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GMPPB (Center). This antibody is tested and proven to work in the following applications:

Mouse GMPPB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Gmppb ELISA KIT

ELI-08218m 96 Tests
EUR 865.00


EF009902 96 Tests
EUR 689.00


ELI-47240h 96 Tests
EUR 824.00


ELI-48017b 96 Tests
EUR 928.00

Human GMPPB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GMPPB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GMPPB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GMPPB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GMPPB Recombinant Protein (Human)

RP013432 100 ug Ask for price

GMPPB Recombinant Protein (Rat)

RP202916 100 ug Ask for price

GMPPB Recombinant Protein (Mouse)

RP138869 100 ug Ask for price

Polyclonal GMPPB Antibody (N-Term)

AMM04826G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GMPPB (N-Term). This antibody is tested and proven to work in the following applications:

GMPPB Polyclonal Antibody, Biotin Conjugated

A59259 100 µg
EUR 570.55
Description: kits suitable for this type of research

GMPPB Polyclonal Antibody, FITC Conjugated

A59260 100 µg
EUR 570.55
Description: fast delivery possible

GMPPB Polyclonal Antibody, HRP Conjugated

A59261 100 µg
EUR 570.55
Description: reagents widely cited

GMPPB ORF Vector (Human) (pORF)

ORF004478 1.0 ug DNA
EUR 95.00

Gmppb ORF Vector (Rat) (pORF)

ORF067640 1.0 ug DNA
EUR 506.00

Gmppb ORF Vector (Mouse) (pORF)

ORF046291 1.0 ug DNA
EUR 506.00

Polyclonal Gmppb antibody - N-terminal region

APR16174G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Gmppb - N-terminal region. This antibody is tested and proven to work in the following applications:

GMPPB sgRNA CRISPR Lentivector set (Human)

K0873601 3 x 1.0 ug
EUR 339.00

Gmppb sgRNA CRISPR Lentivector set (Mouse)

K4764801 3 x 1.0 ug
EUR 339.00

Gmppb sgRNA CRISPR Lentivector set (Rat)

K6473801 3 x 1.0 ug
EUR 339.00

Monoclonal GMPPB Antibody (monoclonal) (M07), Clone: 2B5

AMM04825G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human GMPPB (monoclonal) (M07). The antibodies are raised in mouse and are from clone 2B5. This antibody is applicable in WB and IHC, E

GMPPB sgRNA CRISPR Lentivector (Human) (Target 1)

K0873602 1.0 ug DNA
EUR 154.00

GMPPB sgRNA CRISPR Lentivector (Human) (Target 2)

K0873603 1.0 ug DNA
EUR 154.00

GMPPB sgRNA CRISPR Lentivector (Human) (Target 3)

K0873604 1.0 ug DNA
EUR 154.00

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody

abx233527-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4764802 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4764803 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4764804 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6473802 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6473803 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 3)

K6473804 1.0 ug DNA
EUR 154.00

GMPPB Protein Vector (Rat) (pPB-C-His)

PV270558 500 ng
EUR 603.00

GMPPB Protein Vector (Rat) (pPB-N-His)

PV270559 500 ng
EUR 603.00

GMPPB Protein Vector (Rat) (pPM-C-HA)

PV270560 500 ng
EUR 603.00

GMPPB Protein Vector (Rat) (pPM-C-His)

PV270561 500 ng
EUR 603.00


LONP2 Antibody

AF9105 200ul
EUR 304.00
Description: LONP2 Antibody detects endogenous levels of total LONP2.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LONP2 Antibody

ABF9105 100 ug
EUR 438.00


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LONP2 Antibody

44353-100ul 100ul
EUR 252.00

LONP2 Antibody

44353-50ul 50ul
EUR 187.00

LONP2 antibody

70R-10129 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal LONP2 antibody

LONP2 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against LONP2. Recognizes LONP2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

LONP2 Blocking Peptide

AF9105-BP 1mg
EUR 195.00

LONP2 Conjugated Antibody

C44353 100ul
EUR 397.00

Polyclonal LONP2 Antibody

APR05633G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LONP2 . This antibody is tested and proven to work in the following applications:

LONP2 Polyclonal Antibody

ES7708-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against LONP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

LONP2 Polyclonal Antibody

ES7708-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against LONP2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

LONP2 Polyclonal Antibody

ABP56709-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human LONP2 at AA range: 750-830
  • Applications tips:
Description: A polyclonal antibody for detection of LONP2 from Human, Mouse, Rat. This LONP2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human LONP2 at AA range: 750-830

LONP2 Polyclonal Antibody

ABP56709-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human LONP2 at AA range: 750-830
  • Applications tips:
Description: A polyclonal antibody for detection of LONP2 from Human, Mouse, Rat. This LONP2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human LONP2 at AA range: 750-830

LONP2 Polyclonal Antibody

ABP56709-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human LONP2 at AA range: 750-830
  • Applications tips:
Description: A polyclonal antibody for detection of LONP2 from Human, Mouse, Rat. This LONP2 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human LONP2 at AA range: 750-830

LONP2 Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Anti-LONP2 Antibody

A11643 100ul
EUR 397.00
Description: Rabbit Polyclonal LONP2 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

LONP2 Rabbit pAb

A15909-100ul 100 ul
EUR 308.00

LONP2 Rabbit pAb

A15909-200ul 200 ul
EUR 459.00

LONP2 Rabbit pAb

A15909-20ul 20 ul
EUR 183.00

LONP2 Rabbit pAb

A15909-50ul 50 ul
EUR 223.00

LONP2 Blocking Peptide

33R-1260 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GCNT3 antibody, catalog no. 70R-1911

Anti-LONP2 antibody

STJ93944 200 µl
EUR 197.00
Description: Rabbit polyclonal to LONP2.

Anti-LONP2 antibody

STJ118368 100 µl
EUR 277.00

Mouse LONP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat LONP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human LONP2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

pECMV- 3*Flag- LONP2

PVT10298 2 ug
EUR 301.00

Polyclonal LONP2 Antibody (N-term)

APR06181G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LONP2 (N-term). This antibody is tested and proven to work in the following applications:

Lonp2 ORF Vector (Rat) (pORF)

ORF069922 1.0 ug DNA
EUR 506.00

Lonp2 ORF Vector (Mouse) (pORF)

ORF049296 1.0 ug DNA
EUR 506.00

Lonp2 ORF Vector (Mouse) (pORF)

ORF049297 1.0 ug DNA
EUR 506.00

LONP2 ORF Vector (Human) (pORF)

ORF023053 1.0 ug DNA
EUR 405.00

Polyclonal LONP2 / LONP Antibody (aa780-829)

APR03025G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LONP2 / LONP (aa780-829). This antibody is tested and proven to work in the following applications:

Lon Peptidase 2, Peroxisomal (LONP2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Lon Peptidase 2, Peroxisomal (LONP2) Antibody

abx034448-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Lon Peptidase 2, Peroxisomal (LONP2) Antibody

abx034448-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Lon Peptidase 2, Peroxisomal (LONP2) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Lon Peptidase 2, Peroxisomal (LONP2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LONP2 sgRNA CRISPR Lentivector set (Human)

K1224201 3 x 1.0 ug
EUR 339.00

Lonp2 sgRNA CRISPR Lentivector set (Rat)

K6298301 3 x 1.0 ug
EUR 339.00

Lonp2 sgRNA CRISPR Lentivector set (Mouse)

K3104301 3 x 1.0 ug
EUR 339.00

LONP2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1224202 1.0 ug DNA
EUR 154.00

LONP2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1224203 1.0 ug DNA
EUR 154.00

LONP2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1224204 1.0 ug DNA
EUR 154.00

Lonp2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6298302 1.0 ug DNA
EUR 154.00

Lonp2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6298303 1.0 ug DNA
EUR 154.00

Lonp2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6298304 1.0 ug DNA
EUR 154.00

Lonp2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3104302 1.0 ug DNA
EUR 154.00

Lonp2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3104303 1.0 ug DNA
EUR 154.00

Lonp2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3104304 1.0 ug DNA
EUR 154.00

LONP2 Protein Vector (Human) (pPB-C-His)

PV092210 500 ng
EUR 552.00

LONP2 Protein Vector (Human) (pPB-N-His)

PV092211 500 ng
EUR 552.00

LONP2 Protein Vector (Human) (pPM-C-HA)

PV092212 500 ng
EUR 552.00

LONP2 Protein Vector (Human) (pPM-C-His)

PV092213 500 ng
EUR 552.00

LONP2 Protein Vector (Rat) (pPB-C-His)

PV279686 500 ng
EUR 1166.00

LONP2 Protein Vector (Rat) (pPB-N-His)

PV279687 500 ng
EUR 1166.00

LONP2 Protein Vector (Rat) (pPM-C-HA)

PV279688 500 ng
EUR 1166.00

LONP2 Protein Vector (Rat) (pPM-C-His)

PV279689 500 ng
EUR 1166.00

LONP2 Protein Vector (Mouse) (pPB-C-His)

PV197182 500 ng
EUR 603.00

LONP2 Protein Vector (Mouse) (pPB-N-His)

PV197183 500 ng
EUR 603.00

LONP2 Protein Vector (Mouse) (pPM-C-HA)

PV197184 500 ng
EUR 603.00

LONP2 Protein Vector (Mouse) (pPM-C-His)

PV197185 500 ng
EUR 603.00

LONP2 Protein Vector (Mouse) (pPB-C-His)

PV197186 500 ng
EUR 1065.00

LONP2 Protein Vector (Mouse) (pPB-N-His)

PV197187 500 ng
EUR 1065.00

LONP2 Protein Vector (Mouse) (pPM-C-HA)

PV197188 500 ng
EUR 1065.00

LONP2 Protein Vector (Mouse) (pPM-C-His)

PV197189 500 ng
EUR 1065.00

Lonp2 3'UTR GFP Stable Cell Line

TU162518 1.0 ml Ask for price

Lonp2 3'UTR Luciferase Stable Cell Line

TU212474 1.0 ml Ask for price

LONP2 3'UTR Luciferase Stable Cell Line

TU012555 1.0 ml
EUR 2333.00

Lonp2 3'UTR Luciferase Stable Cell Line

TU112518 1.0 ml Ask for price

LONP2 3'UTR GFP Stable Cell Line

TU062555 1.0 ml
EUR 2333.00

Lonp2 3'UTR GFP Stable Cell Line

TU262474 1.0 ml Ask for price

LONP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV659941 1.0 ug DNA
EUR 1355.00

LONP2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV659945 1.0 ug DNA
EUR 1355.00

LONP2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV659946 1.0 ug DNA
EUR 1355.00

Mouse Lon protease homolog 2, peroxisomal, Lonp2 ELISA KIT

ELI-22881m 96 Tests
EUR 865.00

Human Lon protease homolog 2, peroxisomal, LONP2 ELISA KIT

ELI-16005h 96 Tests
EUR 824.00

Bovine Lon protease homolog 2, peroxisomal, LONP2 ELISA KIT

ELI-41999b 96 Tests
EUR 928.00

LONP2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1224205 3 x 1.0 ug
EUR 376.00

Lonp2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6298305 3 x 1.0 ug
EUR 376.00

Lonp2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3104305 3 x 1.0 ug
EUR 376.00

LONP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1224206 1.0 ug DNA
EUR 167.00

LONP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1224207 1.0 ug DNA
EUR 167.00

LONP2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1224208 1.0 ug DNA
EUR 167.00

Lonp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6298306 1.0 ug DNA
EUR 167.00

Lonp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6298307 1.0 ug DNA
EUR 167.00

Lonp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6298308 1.0 ug DNA
EUR 167.00

Lonp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3104306 1.0 ug DNA
EUR 167.00

Lonp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3104307 1.0 ug DNA
EUR 167.00

Lonp2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3104308 1.0 ug DNA
EUR 167.00

LONP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV659942 1.0 ug DNA
EUR 1355.00

LONP2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV659943 1.0 ug DNA