GMPPB

GMPPB antibody
70R-1204	Fitzgerald	100 ug	EUR 377.00
Description: Rabbit polyclonal GMPPB antibody raised against the C terminal of GMPPB

GMPPB Antibody
47393-100ul	SAB	100ul	EUR 252.00

GMPPB Antibody
1-CSB-PA896740LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GMPPB Antibody
1-CSB-PA009579GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GMPPB siRNA
20-abx918124	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GMPPB siRNA
20-abx918125	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GMPPB Blocking Peptide
33R-7838	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GMPPB antibody, catalog no. 70R-1204

GMPPB cloning plasmid
CSB-CL896740HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1083 Sequence: atgaaggcactgatcttagtggggggctatgggacgcggctacggccgctgacgctgagcaccccgaagccactggtggacttctgcaataagcccatcttgctgcaccaagtggaggcgctagccgcggcaggcgtggaccacgtgatcctggccgtgagctacatgtcgcagg Show more
Description: A cloning plasmid for the GMPPB gene.

GMPPB Conjugated Antibody
C47393	SAB	100ul	EUR 397.00

GMPPB Polyclonal Antibody
A59258	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GMPPB Rabbit pAb
A16520-100ul	Abclonal	100 ul	EUR 308.00

GMPPB Rabbit pAb
A16520-200ul	Abclonal	200 ul	EUR 459.00

GMPPB Rabbit pAb
A16520-20ul	Abclonal	20 ul	EUR 183.00

GMPPB Rabbit pAb
A16520-50ul	Abclonal	50 ul	EUR 223.00

anti- GMPPB antibody
FNab03527	FN Test	100µg	EUR 548.75
Immunogen: GDP-mannose pyrophosphorylase B Uniprot ID: Q9Y5P6 Gene ID: 29925 Research Area: Metabolism
Description: Antibody raised against GMPPB

Anti-GMPPB antibody
PAab03527	Lifescience Market	100 ug	EUR 386.00

pENTR223-GMPPB vector
PVT11908	Lifescience Market	2 ug	EUR 308.00

Anti-GMPPB antibody
STJ118959	St John's Laboratory	100 µl	EUR 277.00

Anti-GMPPB (2B5)
YF-MA11473	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to GMPPB

GMPPB Antibody, HRP conjugated
1-CSB-PA896740LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GMPPB Antibody, FITC conjugated
1-CSB-PA896740LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GMPPB Antibody, Biotin conjugated
1-CSB-PA896740LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Gmppb ELISA KIT
ELI-08218m	Lifescience Market	96 Tests	EUR 865.00

GMPPB ELISA KIT|Human
EF009902	Lifescience Market	96 Tests	EUR 689.00

Human GMPPB shRNA Plasmid
20-abx959272	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Polyclonal GMPPB Antibody (Center)
AMM04824G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GMPPB (Center). This antibody is tested and proven to work in the following applications:

Mouse GMPPB shRNA Plasmid
20-abx983647	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Bovine GMPPB ELISA KIT
ELI-48017b	Lifescience Market	96 Tests	EUR 928.00

Human GMPPB ELISA KIT
ELI-47240h	Lifescience Market	96 Tests	EUR 824.00

GMPPB Recombinant Protein (Human)
RP013432	ABM	100 ug	Ask for price

GMPPB Recombinant Protein (Rat)
RP202916	ABM	100 ug	Ask for price

GMPPB Recombinant Protein (Mouse)
RP138869	ABM	100 ug	Ask for price

Polyclonal GMPPB Antibody (N-Term)
AMM04826G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GMPPB (N-Term). This antibody is tested and proven to work in the following applications:

GMPPB Polyclonal Antibody, Biotin Conjugated
A59259	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GMPPB Polyclonal Antibody, FITC Conjugated
A59260	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GMPPB Polyclonal Antibody, HRP Conjugated
A59261	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Gmppb ORF Vector (Rat) (pORF)
ORF067640	ABM	1.0 ug DNA	EUR 506.00

GMPPB ORF Vector (Human) (pORF)
ORF004478	ABM	1.0 ug DNA	EUR 95.00

Gmppb ORF Vector (Mouse) (pORF)
ORF046291	ABM	1.0 ug DNA	EUR 506.00

Polyclonal Gmppb antibody - N-terminal region
APR16174G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Gmppb - N-terminal region. This antibody is tested and proven to work in the following applications:

Gmppb sgRNA CRISPR Lentivector set (Mouse)
K4764801	ABM	3 x 1.0 ug	EUR 339.00

Gmppb sgRNA CRISPR Lentivector set (Rat)
K6473801	ABM	3 x 1.0 ug	EUR 339.00

GMPPB sgRNA CRISPR Lentivector set (Human)
K0873601	ABM	3 x 1.0 ug	EUR 339.00

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody
20-abx112695	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody
abx233527-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody
20-abx312411	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Monoclonal GMPPB Antibody (monoclonal) (M07), Clone: 2B5
AMM04825G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human GMPPB (monoclonal) (M07). The antibodies are raised in mouse and are from clone 2B5. This antibody is applicable in WB and IHC, E

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4764802	ABM	1.0 ug DNA	EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4764803	ABM	1.0 ug DNA	EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4764804	ABM	1.0 ug DNA	EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6473802	ABM	1.0 ug DNA	EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6473803	ABM	1.0 ug DNA	EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6473804	ABM	1.0 ug DNA	EUR 154.00

GMPPB sgRNA CRISPR Lentivector (Human) (Target 1)
K0873602	ABM	1.0 ug DNA	EUR 154.00

GMPPB sgRNA CRISPR Lentivector (Human) (Target 2)
K0873603	ABM	1.0 ug DNA	EUR 154.00

GMPPB sgRNA CRISPR Lentivector (Human) (Target 3)
K0873604	ABM	1.0 ug DNA	EUR 154.00

GMPPB Protein Vector (Rat) (pPB-C-His)
PV270558	ABM	500 ng	EUR 603.00

GMPPB Protein Vector (Rat) (pPB-N-His)
PV270559	ABM	500 ng	EUR 603.00

GMPPB Protein Vector (Rat) (pPM-C-HA)
PV270560	ABM	500 ng	EUR 603.00

GMPPB Protein Vector (Rat) (pPM-C-His)
PV270561	ABM	500 ng	EUR 603.00