GMPPB

GMPPB antibody
70R-1204 100 ug
EUR 377
Description: Rabbit polyclonal GMPPB antibody raised against the C terminal of GMPPB

GMPPB Antibody
47393-100ul 100ul
EUR 252

GMPPB Antibody
1-CSB-PA896740LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GMPPB Antibody
1-CSB-PA009579GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

GMPPB siRNA
20-abx918124
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GMPPB siRNA
20-abx918125
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GMPPB Blocking Peptide
33R-7838 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GMPPB antibody, catalog no. 70R-1204

GMPPB cloning plasmid
CSB-CL896740HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgaaggcactgatcttagtggggggctatgggacgcggctacggccgctgacgctgagcaccccgaagccactggtggacttctgcaataagcccatcttgctgcaccaagtggaggcgctagccgcggcaggcgtggaccacgtgatcctggccgtgagctacatgtcgcagg
  • Show more
Description: A cloning plasmid for the GMPPB gene.

GMPPB Conjugated Antibody
C47393 100ul
EUR 397

GMPPB Polyclonal Antibody
A59258 100 µg
EUR 570.55
Description: The best epigenetics products

GMPPB Rabbit pAb
A16520-100ul 100 ul
EUR 308

GMPPB Rabbit pAb
A16520-200ul 200 ul
EUR 459

GMPPB Rabbit pAb
A16520-20ul 20 ul
EUR 183

GMPPB Rabbit pAb
A16520-50ul 50 ul
EUR 223

anti- GMPPB antibody
FNab03527 100µg
EUR 548.75
  • Immunogen: GDP-mannose pyrophosphorylase B
  • Uniprot ID: Q9Y5P6
  • Gene ID: 29925
  • Research Area: Metabolism
Description: Antibody raised against GMPPB

Anti-GMPPB antibody
PAab03527 100 ug
EUR 386

pENTR223-GMPPB vector
PVT11908 2 ug
EUR 308

Anti-GMPPB antibody
STJ118959 100 µl
EUR 277

Anti-GMPPB (2B5)
YF-MA11473 100 ug
EUR 363
Description: Mouse monoclonal to GMPPB

GMPPB Antibody, HRP conjugated
1-CSB-PA896740LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GMPPB Antibody, FITC conjugated
1-CSB-PA896740LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GMPPB Antibody, Biotin conjugated
1-CSB-PA896740LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Gmppb ELISA KIT
ELI-08218m 96 Tests
EUR 865

GMPPB ELISA KIT|Human
EF009902 96 Tests
EUR 689

Human GMPPB shRNA Plasmid
20-abx959272
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal GMPPB Antibody (Center)
AMM04824G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GMPPB (Center). This antibody is tested and proven to work in the following applications:

Mouse GMPPB shRNA Plasmid
20-abx983647
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Bovine GMPPB ELISA KIT
ELI-48017b 96 Tests
EUR 928

Human GMPPB ELISA KIT
ELI-47240h 96 Tests
EUR 824

GMPPB Recombinant Protein (Human)
RP013432 100 ug Ask for price

GMPPB Recombinant Protein (Rat)
RP202916 100 ug Ask for price

GMPPB Recombinant Protein (Mouse)
RP138869 100 ug Ask for price

Polyclonal GMPPB Antibody (N-Term)
AMM04826G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GMPPB (N-Term). This antibody is tested and proven to work in the following applications:

GMPPB Polyclonal Antibody, Biotin Conjugated
A59259 100 µg
EUR 570.55
Description: kits suitable for this type of research

GMPPB Polyclonal Antibody, FITC Conjugated
A59260 100 µg
EUR 570.55
Description: fast delivery possible

GMPPB Polyclonal Antibody, HRP Conjugated
A59261 100 µg
EUR 570.55
Description: reagents widely cited

Gmppb ORF Vector (Rat) (pORF)
ORF067640 1.0 ug DNA
EUR 506

GMPPB ORF Vector (Human) (pORF)
ORF004478 1.0 ug DNA
EUR 95

Gmppb ORF Vector (Mouse) (pORF)
ORF046291 1.0 ug DNA
EUR 506

Polyclonal Gmppb antibody - N-terminal region
APR16174G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Gmppb - N-terminal region. This antibody is tested and proven to work in the following applications:

Gmppb sgRNA CRISPR Lentivector set (Mouse)
K4764801 3 x 1.0 ug
EUR 339

Gmppb sgRNA CRISPR Lentivector set (Rat)
K6473801 3 x 1.0 ug
EUR 339

GMPPB sgRNA CRISPR Lentivector set (Human)
K0873601 3 x 1.0 ug
EUR 339

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody
20-abx112695
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody
abx233527-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody
20-abx312411
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Monoclonal GMPPB Antibody (monoclonal) (M07), Clone: 2B5
AMM04825G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human GMPPB (monoclonal) (M07). The antibodies are raised in mouse and are from clone 2B5. This antibody is applicable in WB and IHC, E

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4764802 1.0 ug DNA
EUR 154

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4764803 1.0 ug DNA
EUR 154

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4764804 1.0 ug DNA
EUR 154

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 1)
K6473802 1.0 ug DNA
EUR 154

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 2)
K6473803 1.0 ug DNA
EUR 154

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 3)
K6473804 1.0 ug DNA
EUR 154

GMPPB sgRNA CRISPR Lentivector (Human) (Target 1)
K0873602 1.0 ug DNA
EUR 154

GMPPB sgRNA CRISPR Lentivector (Human) (Target 2)
K0873603 1.0 ug DNA
EUR 154

GMPPB sgRNA CRISPR Lentivector (Human) (Target 3)
K0873604 1.0 ug DNA
EUR 154

GMPPB Protein Vector (Rat) (pPB-C-His)
PV270558 500 ng
EUR 603

GMPPB Protein Vector (Rat) (pPB-N-His)
PV270559 500 ng
EUR 603

GMPPB Protein Vector (Rat) (pPM-C-HA)
PV270560 500 ng
EUR 603

GMPPB Protein Vector (Rat) (pPM-C-His)
PV270561 500 ng
EUR 603