GMPPB antibody

70R-1204 100 ug
EUR 377.00
Description: Rabbit polyclonal GMPPB antibody raised against the C terminal of GMPPB

GMPPB Antibody

47393-100ul 100ul
EUR 252.00

GMPPB Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GMPPB Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GMPPB Blocking Peptide

33R-7838 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GMPPB antibody, catalog no. 70R-1204

GMPPB cloning plasmid

CSB-CL896740HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atgaaggcactgatcttagtggggggctatgggacgcggctacggccgctgacgctgagcaccccgaagccactggtggacttctgcaataagcccatcttgctgcaccaagtggaggcgctagccgcggcaggcgtggaccacgtgatcctggccgtgagctacatgtcgcagg
  • Show more
Description: A cloning plasmid for the GMPPB gene.

GMPPB Conjugated Antibody

C47393 100ul
EUR 397.00

GMPPB Polyclonal Antibody

A59258 100 µg
EUR 570.55
Description: The best epigenetics products

GMPPB Rabbit pAb

A16520-100ul 100 ul
EUR 308.00

GMPPB Rabbit pAb

A16520-200ul 200 ul
EUR 459.00

GMPPB Rabbit pAb

A16520-20ul 20 ul
EUR 183.00

GMPPB Rabbit pAb

A16520-50ul 50 ul
EUR 223.00

anti- GMPPB antibody

FNab03527 100µg
EUR 548.75
  • Immunogen: GDP-mannose pyrophosphorylase B
  • Uniprot ID: Q9Y5P6
  • Gene ID: 29925
  • Research Area: Metabolism
Description: Antibody raised against GMPPB

Anti-GMPPB antibody

PAab03527 100 ug
EUR 386.00

pENTR223-GMPPB vector

PVT11908 2 ug
EUR 308.00

Anti-GMPPB antibody

STJ118959 100 µl
EUR 277.00

Anti-GMPPB (2B5)

YF-MA11473 100 ug
EUR 363.00
Description: Mouse monoclonal to GMPPB

GMPPB Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GMPPB Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GMPPB Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GMPPB. Recognizes GMPPB from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Gmppb ELISA KIT

ELI-08218m 96 Tests
EUR 865.00


EF009902 96 Tests
EUR 689.00

Human GMPPB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Polyclonal GMPPB Antibody (Center)

AMM04824G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GMPPB (Center). This antibody is tested and proven to work in the following applications:

Mouse GMPPB shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


ELI-48017b 96 Tests
EUR 928.00


ELI-47240h 96 Tests
EUR 824.00

GMPPB Recombinant Protein (Human)

RP013432 100 ug Ask for price

GMPPB Recombinant Protein (Rat)

RP202916 100 ug Ask for price

GMPPB Recombinant Protein (Mouse)

RP138869 100 ug Ask for price

Polyclonal GMPPB Antibody (N-Term)

AMM04826G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GMPPB (N-Term). This antibody is tested and proven to work in the following applications:

GMPPB Polyclonal Antibody, Biotin Conjugated

A59259 100 µg
EUR 570.55
Description: kits suitable for this type of research

GMPPB Polyclonal Antibody, FITC Conjugated

A59260 100 µg
EUR 570.55
Description: fast delivery possible

GMPPB Polyclonal Antibody, HRP Conjugated

A59261 100 µg
EUR 570.55
Description: reagents widely cited

Gmppb ORF Vector (Rat) (pORF)

ORF067640 1.0 ug DNA
EUR 506.00

GMPPB ORF Vector (Human) (pORF)

ORF004478 1.0 ug DNA
EUR 95.00

Gmppb ORF Vector (Mouse) (pORF)

ORF046291 1.0 ug DNA
EUR 506.00

Polyclonal Gmppb antibody - N-terminal region

APR16174G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Gmppb - N-terminal region. This antibody is tested and proven to work in the following applications:

Gmppb sgRNA CRISPR Lentivector set (Mouse)

K4764801 3 x 1.0 ug
EUR 339.00

Gmppb sgRNA CRISPR Lentivector set (Rat)

K6473801 3 x 1.0 ug
EUR 339.00

GMPPB sgRNA CRISPR Lentivector set (Human)

K0873601 3 x 1.0 ug
EUR 339.00

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody

abx233527-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Mannose 1 Phosphate Guanyltransferase Beta (GMPPB) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Monoclonal GMPPB Antibody (monoclonal) (M07), Clone: 2B5

AMM04825G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human GMPPB (monoclonal) (M07). The antibodies are raised in mouse and are from clone 2B5. This antibody is applicable in WB and IHC, E

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4764802 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4764803 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4764804 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 1)

K6473802 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 2)

K6473803 1.0 ug DNA
EUR 154.00

Gmppb sgRNA CRISPR Lentivector (Rat) (Target 3)

K6473804 1.0 ug DNA
EUR 154.00

GMPPB sgRNA CRISPR Lentivector (Human) (Target 1)

K0873602 1.0 ug DNA
EUR 154.00

GMPPB sgRNA CRISPR Lentivector (Human) (Target 2)

K0873603 1.0 ug DNA
EUR 154.00

GMPPB sgRNA CRISPR Lentivector (Human) (Target 3)

K0873604 1.0 ug DNA
EUR 154.00

GMPPB Protein Vector (Rat) (pPB-C-His)

PV270558 500 ng
EUR 603.00

GMPPB Protein Vector (Rat) (pPB-N-His)

PV270559 500 ng
EUR 603.00

GMPPB Protein Vector (Rat) (pPM-C-HA)

PV270560 500 ng
EUR 603.00

GMPPB Protein Vector (Rat) (pPM-C-His)

PV270561 500 ng
EUR 603.00