lyve1

LYVE1 Antibody
ABF4202	Lifescience Market	100 ug	EUR 438.00

LYVE1 siRNA
20-abx923216	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

LYVE1 siRNA
20-abx923217	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

LYVE1 antibody
70R-LR003	Fitzgerald	50 ug	EUR 507.00
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR004	Fitzgerald	100 ug	EUR 422.00
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR005	Fitzgerald	100 ug	EUR 422.00
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-LR006	Fitzgerald	200 ug	EUR 497.00
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-6181	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal LYVE1 antibody raised against the N terminal of LYVE1

LYVE1 Antibody
35806-100ul	SAB	100ul	EUR 252.00

LYVE1 Antibody
49343-100ul	SAB	100ul	EUR 333.00

LYVE1 Antibody
49343-50ul	SAB	50ul	EUR 239.00

LYVE1 antibody
10R-1025	Fitzgerald	100 ul	EUR 316.00
Description: Mouse monoclonal LYVE1 antibody

LYVE1 antibody
10R-6400	Fitzgerald	100 ug	EUR 343.00
Description: Rat monoclonal LYVE1 antibody

LYVE1 protein
30R-AL010	Fitzgerald	20 ug	EUR 242.00
Description: Purified recombinant Human LYVE1 protein

LYVE1 antibody
20R-2482	Fitzgerald	50 ug	EUR 281.00
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-18338	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-11548	Fitzgerald	100 ug	EUR 527.00
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody
70R-11549	Fitzgerald	100 ug	EUR 527.00
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 Antibody
1-CSB-PA897574EA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

LYVE1 Antibody
1-CSB-PA897574ESR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

LYVE1 Antibody
1-CSB-PA897574ESR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LYVE1 Antibody
1-CSB-PA915341	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

LYVE1 Antibody
1-CSB-PA013282GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

LYVE1 Antibody
1-CSB-PA561582	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:100-1:500, IHC:1:25-1:100

LYVE1 Antibody
CSB-PA566878-	Cusabio		EUR 335.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

LYVE1 Antibody
CSB-PA566878-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

anti-LYVE1
YF-PA17283	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to LYVE1

LYVE1 Blocking Peptide
AF4202-BP	Affbiotech	1mg	EUR 195.00

LYVE1 Conjugated Antibody
C35806	SAB	100ul	EUR 397.00

LYVE1 Polyclonal Antibody
ES11131-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LYVE1 Polyclonal Antibody
ES11131-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- LYVE1 antibody
FNab04911	FN Test	100µg	EUR 585.00
Recommended dilution: WB: 1:500 - 1:2000 Immunogen: LYVE1 Uniprot ID: Q9Y5Y7 Gene ID: 10894 Research Area: Cardiovascular
Description: Antibody raised against LYVE1

LYVE1 Polyclonal Antibody
ABP59171-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Polyclonal Antibody
ABP59171-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Polyclonal Antibody
ABP59171-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Rabbit mAb
A4352-100ul	Abclonal	100 ul	EUR 410.00

LYVE1 Rabbit mAb
A4352-200ul	Abclonal	200 ul	EUR 571.00

LYVE1 Rabbit mAb
A4352-20ul	Abclonal	20 ul	EUR 221.00

LYVE1 Rabbit mAb
A4352-50ul	Abclonal	50 ul	EUR 287.00

LYVE1 Rabbit pAb
A6452-100ul	Abclonal	100 ul	EUR 308.00

LYVE1 Rabbit pAb
A6452-200ul	Abclonal	200 ul	EUR 459.00

LYVE1 Rabbit pAb
A6452-20ul	Abclonal	20 ul	EUR 183.00

LYVE1 Rabbit pAb
A6452-50ul	Abclonal	50 ul	EUR 223.00

LYVE1 Blocking Peptide
33R-1461	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LYVE1 antibody, catalog no. 70R-6181

LYVE1 protein (Mouse)
30R-AL009	Fitzgerald	20 ug	EUR 242.00
Description: Purified recombinant Mouse LYVE1 protein

LYVE1 antibody (biotin)
61R-1501	Fitzgerald	100 ug	EUR 457.00
Description: Rat monoclonal LYVE1 antibody (biotin)

LYVE1 cloning plasmid
CSB-CL897574HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 969 Sequence: atggccaggtgcttcagcctggtgttgcttctcacttccatctggaccacgaggctcctggtccaaggctctttgcgtgcagaagagctttccatccaggtgtcatgcagaattatggggatcacccttgtgagcaaaaaggcgaaccagcagctgaatttcacagaagctaagga Show more
Description: A cloning plasmid for the LYVE1 gene.

Anti-LYVE1 antibody
PAab04911	Lifescience Market	100 ug	EUR 412.00

Anti-LYVE1 antibody
STJ73129	St John's Laboratory	100 µg	EUR 359.00

Anti-LYVE1 antibody
STJ28535	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a type I integral membrane glycoprotein. The encoded protein acts as a receptor and binds to both soluble and immobilized hyaluronan. This protein may function in lymphatic hyaluronan transport and have a role in tumor metastasis.

Anti-LYVE1 antibody
STJ192289	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to LYVE1

Mouse LYVE1 shRNA Plasmid
20-abx980157	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Bovine LYVE1 ELISA KIT
ELI-16394b	Lifescience Market	96 Tests	EUR 928.00

LYVE1 ELISA KIT|Human
EF005219	Lifescience Market	96 Tests	EUR 689.00

Mouse Lyve1 ELISA KIT
ELI-31437m	Lifescience Market	96 Tests	EUR 865.00

Human LYVE1 ELISA KIT
ELI-48081h	Lifescience Market	96 Tests	EUR 824.00

Human LYVE1 shRNA Plasmid
20-abx957424	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

LYVE1 protein (His tag)
80R-1071	Fitzgerald	50 ug	EUR 586.00
Description: Purified recombinant Human LYVE1 protein

LYVE1 recombinant monoclonal antibody
A5450	Bimake	100ul X 3	EUR 595.00
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human LYVE1 for WB,ELISA

LYVE1 Antibody, HRP conjugated
1-CSB-PA897574EB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LYVE1 Antibody, FITC conjugated
1-CSB-PA897574EC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LYVE1 Antibody, Biotin conjugated
1-CSB-PA897574ED01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LYVE1 Recombinant Protein (Human)
RP018505	ABM	100 ug	Ask for price

LYVE1 Recombinant Protein (Rat)
RP210452	ABM	100 ug	Ask for price

LYVE1 Recombinant Protein (Mouse)
RP148823	ABM	100 ug	Ask for price

LYVE1 ORF Vector (Human) (pORF)
ORF006169	ABM	1.0 ug DNA	EUR 95.00

Anti-LYVE1 Rabbit Monoclonal Antibody
M04027	BosterBio	100ug/vial	EUR 397.00
Description: Rabbit Monoclonal LYVE1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

Lyve1 ORF Vector (Mouse) (pORF)
ORF049609	ABM	1.0 ug DNA	EUR 506.00

Lyve1 ORF Vector (Rat) (pORF)
ORF070152	ABM	1.0 ug DNA	EUR 506.00

LYVE1 ELISA Kit (Mouse) (OKCD09112)
OKCD09112	Aviva Systems Biology	96 Wells	EUR 1001.00
Description: Description of target: Recombinant Mouse Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1, Sf9;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

LYVE1 ELISA Kit (Mouse) (OKEH03641)
OKEH03641	Aviva Systems Biology	96 Wells	EUR 779.00
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL

LYVE1 ELISA Kit (Human) (OKEH07052)
OKEH07052	Aviva Systems Biology	96 Wells	EUR 662.00
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

Polyclonal LYVE1 (XLKD1) Antibody (C-term)
APR04522G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LYVE1 (XLKD1) (C-term). This antibody is tested and proven to work in the following applications:

LYVE1 sgRNA CRISPR Lentivector set (Human)
K1249101	ABM	3 x 1.0 ug	EUR 339.00

Lyve1 sgRNA CRISPR Lentivector set (Mouse)
K4410801	ABM	3 x 1.0 ug	EUR 339.00

Lyve1 sgRNA CRISPR Lentivector set (Rat)
K6588901	ABM	3 x 1.0 ug	EUR 339.00

Polyclonal Goat Anti-LYVE1 Antibody (internal region)
APG00978G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LYVE1 (internal region). This antibody is tested and proven to work in the following applications:

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1249102	ABM	1.0 ug DNA	EUR 154.00

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1249103	ABM	1.0 ug DNA	EUR 154.00

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1249104	ABM	1.0 ug DNA	EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4410802	ABM	1.0 ug DNA	EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4410803	ABM	1.0 ug DNA	EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4410804	ABM	1.0 ug DNA	EUR 154.00

Rabbit Anti-LYVE1 monoclonal antibody, clone KG1080
DCABH-7677	Creative Diagnostics	100 ul	EUR 777.00

Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6588902	ABM	1.0 ug DNA	EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6588903	ABM	1.0 ug DNA	EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6588904	ABM	1.0 ug DNA	EUR 154.00

Recombinant Human LYVE1 Protein, Untagged, Insect-100ug
QP12609-0.1mg	EnQuireBio	100ug	EUR 1161.00

Recombinant Human LYVE1 Protein, Untagged, Insect-10ug
QP12609-10ug	EnQuireBio	10ug	EUR 201.00

Recombinant Human LYVE1 Protein, Untagged, Insect-2ug
QP12609-2ug	EnQuireBio	2ug	EUR 155.00

Recombinant Human LYVE1 Protein, GST, E.coli-10ug
QP12609-GST-10ug	EnQuireBio	10ug	EUR 553.00

Recombinant Human LYVE1 Protein, GST, E.coli-2ug
QP12609-GST-2ug	EnQuireBio	2ug	EUR 245.00

Recombinant Human LYVE1 Protein, GST, E.coli-5ug
QP12609-GST-5ug	EnQuireBio	5ug	EUR 336.00

Recombinant Human LYVE1 Protein, His, E.coli-1mg
QP12609-HIS-1mg	EnQuireBio	1mg	EUR 5251.00

Recombinant Mouse LYVE1 Protein, His, Insect-10ug
QP12610-10ug	EnQuireBio	10ug	EUR 201.00