
LYVE1 protein

30R-AL010 20 ug
EUR 242.00
Description: Purified recombinant Human LYVE1 protein

LYVE1 antibody

70R-18338 50 ul
EUR 435.00
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody

70R-11548 100 ug
EUR 527.00
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 antibody

70R-11549 100 ug
EUR 527.00
Description: Rabbit polyclonal LYVE1 antibody

LYVE1 Antibody

35806-100ul 100ul
EUR 252.00

LYVE1 antibody

10R-1025 100 ul
EUR 316.00
Description: Mouse monoclonal LYVE1 antibody

LYVE1 antibody

10R-6400 100 ug
EUR 343.00
Description: Rat monoclonal LYVE1 antibody

LYVE1 Antibody

49343-100ul 100ul
EUR 333.00

LYVE1 Antibody

49343-50ul 50ul
EUR 239.00

LYVE1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

LYVE1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

LYVE1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200

LYVE1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

LYVE1 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:100-1:500, IHC:1:25-1:100

LYVE1 Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

LYVE1 Antibody

CSB-PA566878-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

LYVE1 antibody

70R-LR003 50 ug
EUR 507.00
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody

70R-LR004 100 ug
EUR 422.00
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody

70R-LR005 100 ug
EUR 422.00
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody

70R-LR006 200 ug
EUR 497.00
Description: Affinity purified Rabbit polyclonal LYVE1 antibody

LYVE1 antibody

70R-6181 50 ug
EUR 467.00
Description: Rabbit polyclonal LYVE1 antibody raised against the N terminal of LYVE1

LYVE1 Antibody

AF4202 200ul
EUR 376.00
Description: The antibody detects endogenous level of total Lymphatic vessel endothelial hyaluronic acid receptor 1 protein.

LYVE1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

LYVE1 Antibody

ABF4202 100 ug
EUR 438.00


YF-PA17283 50 ul
EUR 363.00
Description: Mouse polyclonal to LYVE1

LYVE1 protein (Mouse)

30R-AL009 20 ug
EUR 242.00
Description: Purified recombinant Mouse LYVE1 protein

LYVE1 Blocking Peptide

33R-1461 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LYVE1 antibody, catalog no. 70R-6181

LYVE1 antibody (biotin)

61R-1501 100 ug
EUR 457.00
Description: Rat monoclonal LYVE1 antibody (biotin)

LYVE1 cloning plasmid

CSB-CL897574HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 969
  • Sequence: atggccaggtgcttcagcctggtgttgcttctcacttccatctggaccacgaggctcctggtccaaggctctttgcgtgcagaagagctttccatccaggtgtcatgcagaattatggggatcacccttgtgagcaaaaaggcgaaccagcagctgaatttcacagaagctaagga
  • Show more
Description: A cloning plasmid for the LYVE1 gene.

LYVE1 Blocking Peptide

AF4202-BP 1mg
EUR 195.00

LYVE1 Conjugated Antibody

C35806 100ul
EUR 397.00

LYVE1 Rabbit mAb

A4352-100ul 100 ul
EUR 410.00

LYVE1 Rabbit mAb

A4352-200ul 200 ul
EUR 571.00

LYVE1 Rabbit mAb

A4352-20ul 20 ul
EUR 221.00

LYVE1 Rabbit mAb

A4352-50ul 50 ul
EUR 287.00

LYVE1 Rabbit pAb

A6452-100ul 100 ul
EUR 308.00

LYVE1 Rabbit pAb

A6452-200ul 200 ul
EUR 459.00

LYVE1 Rabbit pAb

A6452-20ul 20 ul
EUR 183.00

LYVE1 Rabbit pAb

A6452-50ul 50 ul
EUR 223.00

LYVE1 Polyclonal Antibody

ABP59171-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Polyclonal Antibody

ABP59171-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

LYVE1 Polyclonal Antibody

ABP59171-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human LYVE1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of LYVE1 from Human, Mouse. This LYVE1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human LYVE1 protein

anti- LYVE1 antibody

FNab04911 100µg
EUR 585.00
  • Recommended dilution: WB: 1:500 - 1:2000
  • Immunogen: LYVE1
  • Uniprot ID: Q9Y5Y7
  • Gene ID: 10894
  • Research Area: Cardiovascular
Description: Antibody raised against LYVE1

LYVE1 Polyclonal Antibody

ES11131-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LYVE1 Polyclonal Antibody

ES11131-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against LYVE1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-LYVE1 antibody

PAab04911 100 ug
EUR 412.00

Anti-LYVE1 antibody

STJ28535 100 µl
EUR 277.00
Description: This gene encodes a type I integral membrane glycoprotein. The encoded protein acts as a receptor and binds to both soluble and immobilized hyaluronan. This protein may function in lymphatic hyaluronan transport and have a role in tumor metastasis.

Anti-LYVE1 antibody

STJ73129 100 µg
EUR 359.00

Anti-LYVE1 antibody

STJ192289 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to LYVE1

LYVE1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LYVE1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LYVE1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LYVE1. Recognizes LYVE1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

LYVE1 protein (His tag)

80R-1071 50 ug
EUR 586.00
Description: Purified recombinant Human LYVE1 protein


ELI-16394b 96 Tests
EUR 928.00

Mouse Lyve1 ELISA KIT

ELI-31437m 96 Tests
EUR 865.00


EF005219 96 Tests
EUR 689.00

Human LYVE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse LYVE1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

LYVE1 recombinant monoclonal antibody

A5450 100ul X 3
EUR 595.00
  • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
  • Show more
Description: A recombinant monoclonal antibody from rabbit against human LYVE1 for WB,ELISA


ELI-48081h 96 Tests
EUR 824.00

LYVE1 Recombinant Protein (Human)

RP018505 100 ug Ask for price

LYVE1 Recombinant Protein (Mouse)

RP148823 100 ug Ask for price

LYVE1 Recombinant Protein (Rat)

RP210452 100 ug Ask for price

Lyve1 ORF Vector (Rat) (pORF)

ORF070152 1.0 ug DNA
EUR 506.00

Anti-LYVE1 Rabbit Monoclonal Antibody

M04027 100ug/vial
EUR 397.00
Description: Rabbit Monoclonal LYVE1 Antibody. Validated in WB and tested in Human, Mouse, Rat.

LYVE1 ORF Vector (Human) (pORF)

ORF006169 1.0 ug DNA
EUR 95.00

Lyve1 ORF Vector (Mouse) (pORF)

ORF049609 1.0 ug DNA
EUR 506.00

LYVE1 ELISA Kit (Mouse) (OKCD09112)

OKCD09112 96 Wells
EUR 1001.00
Description: Description of target: Recombinant Mouse Lymphatic Vessel Endothelial Hyaluronic Acid Receptor 1, Sf9;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 6.1pg/mL

LYVE1 ELISA Kit (Human) (OKEH07052)

OKEH07052 96 Wells
EUR 662.00
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9 pg/mL

LYVE1 ELISA Kit (Mouse) (OKEH03641)

OKEH03641 96 Wells
EUR 779.00
Description: Description of target: Ligand-specific transporter trafficking between intracellular organelles (TGN) and the plasma membrane. Plays a role in autocrine regulation of cell growth mediated by growth regulators containing cell surface retention sequence binding (CRS). May act as a hyaluronan (HA) transporter, either mediating its uptake for catabolism within lymphatic endothelial cells themselves, or its transport into the lumen of afferent lymphatic vessels for subsequent re-uptake and degradation in lymph nodes.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40 pg/mL

Polyclonal LYVE1 (XLKD1) Antibody (C-term)

APR04522G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LYVE1 (XLKD1) (C-term). This antibody is tested and proven to work in the following applications:

Lyve1 sgRNA CRISPR Lentivector set (Rat)

K6588901 3 x 1.0 ug
EUR 339.00

Lyve1 sgRNA CRISPR Lentivector set (Mouse)

K4410801 3 x 1.0 ug
EUR 339.00

LYVE1 sgRNA CRISPR Lentivector set (Human)

K1249101 3 x 1.0 ug
EUR 339.00

Rabbit Anti-LYVE1 monoclonal antibody, clone KG1080

DCABH-7677 100 ul
EUR 777.00

Polyclonal Goat Anti-LYVE1 Antibody (internal region)

APG00978G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-LYVE1 (internal region). This antibody is tested and proven to work in the following applications:

Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6588902 1.0 ug DNA
EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6588903 1.0 ug DNA
EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6588904 1.0 ug DNA
EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4410802 1.0 ug DNA
EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4410803 1.0 ug DNA
EUR 154.00

Lyve1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4410804 1.0 ug DNA
EUR 154.00

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1249102 1.0 ug DNA
EUR 154.00

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1249103 1.0 ug DNA
EUR 154.00

LYVE1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1249104 1.0 ug DNA
EUR 154.00

LYVE1 Protein Vector (Human) (pPB-C-His)

PV024673 500 ng
EUR 329.00

LYVE1 Protein Vector (Human) (pPB-N-His)

PV024674 500 ng
EUR 329.00

LYVE1 Protein Vector (Human) (pPM-C-HA)

PV024675 500 ng
EUR 329.00

LYVE1 Protein Vector (Human) (pPM-C-His)

PV024676 500 ng
EUR 329.00

LYVE1 Protein Vector (Rat) (pPB-C-His)

PV280606 500 ng
EUR 603.00

LYVE1 Protein Vector (Rat) (pPB-N-His)

PV280607 500 ng
EUR 603.00

LYVE1 Protein Vector (Rat) (pPM-C-HA)

PV280608 500 ng
EUR 603.00

LYVE1 Protein Vector (Rat) (pPM-C-His)

PV280609 500 ng
EUR 603.00