NUP93

NUP93 siRNA

20-abx903712
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

NUP93 siRNA

20-abx926649
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

NUP93 siRNA

20-abx926650
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

NUP93 Antibody

ABD4252 100 ug
EUR 438.00

NUP93 antibody

10R-1445 100 ug
EUR 512.00
Description: Mouse monoclonal NUP93 antibody

NUP93 antibody

70R-19008 50 ul
EUR 435.00
Description: Rabbit polyclonal NUP93 antibody

NUP93 Antibody

DF4252 200ul
EUR 304.00
Description: NUP93 Antibody detects endogenous levels of total NUP93.

NUP93 Antibody

1-CSB-PA822683LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

NUP93 Antibody

1-CSB-PA080050
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/40000

NUP93 Antibody

1-CSB-PA016208GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Nup93 Polyclonal Antibody

ES8086-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against Nup93 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Nup93 Polyclonal Antibody

ES8086-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against Nup93 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- NUP93 antibody

FNab05931 100µg
EUR 548.75
  • Immunogen: nucleoporin 93kDa
  • Uniprot ID: Q8N1F7
  • Gene ID: 9688
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP93

Nup93 Polyclonal Antibody

ABP57087-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup93 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Nup93 from Human, Mouse, Rat. This Nup93 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup93 at AA range: 190-270

Nup93 Polyclonal Antibody

ABP57087-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup93 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Nup93 from Human, Mouse, Rat. This Nup93 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup93 at AA range: 190-270

Nup93 Polyclonal Antibody

ABP57087-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nup93 at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Nup93 from Human, Mouse, Rat. This Nup93 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nup93 at AA range: 190-270

Anti-NUP93 Antibody

A07090 100ul
EUR 397.00
Description: Rabbit Polyclonal NUP93 Antibody. Validated in WB and tested in Human, Mouse, Rat.

NUP93 Rabbit pAb

A4333-100ul 100 ul
EUR 308.00

NUP93 Rabbit pAb

A4333-200ul 200 ul
EUR 459.00

NUP93 Rabbit pAb

A4333-20ul 20 ul
EUR 183.00

NUP93 Rabbit pAb

A4333-50ul 50 ul
EUR 223.00

NUP93 Polyclonal Antibody

30548-100ul 100ul
EUR 252.00

NUP93 Polyclonal Antibody

30548-50ul 50ul
EUR 187.00

NUP93 Blocking Peptide

DF4252-BP 1mg
EUR 195.00

NUP93 cloning plasmid

CSB-CL822683HU-10ug 10ug
EUR 798.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2460
  • Sequence: atggatactgaggggtttggtgagctccttcagcaagctgaacagcttgctgctgagactgagggcatctcagagcttccccatgtggaacggaacttacaggagatccagcaggcgggagagcgcctgcgttcccgtaccctaacacgcacgtcccaggagacggcagatgtca
  • Show more
Description: A cloning plasmid for the NUP93 gene.

Anti-NUP93 antibody

PAab05931 100 ug
EUR 386.00

Anti-Nup93 antibody

STJ94577 200 µl
EUR 197.00
Description: Rabbit polyclonal to Nup93.

Anti-NUP93 antibody

STJ24852 100 µl
EUR 277.00
Description: The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms.

Human Nuclear pore complex protein Nup93, NUP93 ELISA KIT

ELI-36781h 96 Tests
EUR 824.00

Bovine Nuclear pore complex protein Nup93, NUP93 ELISA KIT

ELI-44229b 96 Tests
EUR 928.00

Mouse Nuclear pore complex protein Nup93, Nup93 ELISA KIT

ELI-44561m 96 Tests
EUR 865.00

NUP93 Polyclonal Conjugated Antibody

C30548 100ul
EUR 397.00

Mouse NUP93 shRNA Plasmid

20-abx977524
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat NUP93 shRNA Plasmid

20-abx988529
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NUP93 ELISA KIT|Human

EF001396 96 Tests
EUR 689.00

Nucleoporin 93 (NUP93) Antibody

20-abx003224
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

20-abx327868
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

20-abx334363
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody

abx235931-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Human NUP93 shRNA Plasmid

20-abx956460
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NUP93 Antibody, HRP conjugated

1-CSB-PA822683LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP93 Antibody, FITC conjugated

1-CSB-PA822683LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP93 Antibody, Biotin conjugated

1-CSB-PA822683LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP93. Recognizes NUP93 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NUP93 Recombinant Protein (Human)

RP021943 100 ug Ask for price

NUP93 Recombinant Protein (Rat)

RP214877 100 ug Ask for price

pEGFP-C1X-Nup93-mut

PVT17940 2 ug
EUR 258.00

NUP93 Recombinant Protein (Mouse)

RP155525 100 ug Ask for price

Polyclonal NUP93 Antibody (C-Term)

APR17625G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal NUP93 Antibody (N-Term)

APR17626G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NUP93 (N-Term). This antibody is tested and proven to work in the following applications:

Nucleoporin 93 kDa (NUP93) Antibody

20-abx114232
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (HRP)

20-abx336847
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (FITC)

20-abx336848
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Nucleoporin 93 (NUP93) Antibody (Biotin)

20-abx336849
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

NUP93 ORF Vector (Human) (pORF)

ORF007315 1.0 ug DNA
EUR 95.00

Nup93 ORF Vector (Rat) (pORF)

ORF071627 1.0 ug DNA
EUR 506.00

Nup93 ORF Vector (Mouse) (pORF)

ORF051843 1.0 ug DNA
EUR 506.00

NUP93 sgRNA CRISPR Lentivector set (Human)

K1468601 3 x 1.0 ug
EUR 339.00

Nup93 sgRNA CRISPR Lentivector set (Mouse)

K4879401 3 x 1.0 ug
EUR 339.00

Nup93 sgRNA CRISPR Lentivector set (Rat)

K6522901 3 x 1.0 ug
EUR 339.00

Human Nucleoporin 93kDa(NUP93)ELISA Kit

QY-E05178 96T
EUR 361.00

Human Nucleoporin 93 kDa (NUP93) ELISA Kit

abx381937-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

NUP93 sgRNA CRISPR Lentivector (Human) (Target 1)

K1468602 1.0 ug DNA
EUR 154.00

NUP93 sgRNA CRISPR Lentivector (Human) (Target 2)

K1468603 1.0 ug DNA
EUR 154.00

NUP93 sgRNA CRISPR Lentivector (Human) (Target 3)

K1468604 1.0 ug DNA
EUR 154.00

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4879402 1.0 ug DNA
EUR 154.00

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4879403 1.0 ug DNA
EUR 154.00

Nup93 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4879404 1.0 ug DNA
EUR 154.00

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6522902 1.0 ug DNA
EUR 154.00

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6522903 1.0 ug DNA
EUR 154.00

Nup93 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6522904 1.0 ug DNA
EUR 154.00

NUP93 Protein Vector (Human) (pPB-C-His)

PV029257 500 ng
EUR 329.00

NUP93 Protein Vector (Human) (pPB-N-His)

PV029258 500 ng
EUR 329.00

NUP93 Protein Vector (Human) (pPM-C-HA)

PV029259 500 ng
EUR 329.00

NUP93 Protein Vector (Human) (pPM-C-His)

PV029260 500 ng
EUR 329.00

NUP93 Protein Vector (Mouse) (pPB-C-His)

PV207370 500 ng
EUR 1065.00

NUP93 Protein Vector (Mouse) (pPB-N-His)

PV207371 500 ng
EUR 1065.00

NUP93 Protein Vector (Mouse) (pPM-C-HA)

PV207372 500 ng
EUR 1065.00

NUP93 Protein Vector (Mouse) (pPM-C-His)

PV207373 500 ng
EUR 1065.00

NUP93 Protein Vector (Rat) (pPB-C-His)

PV286506 500 ng
EUR 1166.00

NUP93 Protein Vector (Rat) (pPB-N-His)

PV286507 500 ng
EUR 1166.00

NUP93 Protein Vector (Rat) (pPM-C-HA)

PV286508 500 ng
EUR 1166.00

NUP93 Protein Vector (Rat) (pPM-C-His)

PV286509 500 ng
EUR 1166.00

Nup93 3'UTR GFP Stable Cell Line

TU164448 1.0 ml Ask for price

NUP93 3'UTR Luciferase Stable Cell Line

TU016107 1.0 ml
EUR 1394.00

Nup93 3'UTR Luciferase Stable Cell Line

TU114448 1.0 ml Ask for price

NUP93 3'UTR GFP Stable Cell Line

TU066107 1.0 ml
EUR 1394.00

Nup93 3'UTR GFP Stable Cell Line

TU264309 1.0 ml Ask for price

Nup93 3'UTR Luciferase Stable Cell Line

TU214309 1.0 ml Ask for price

NUP93 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV661669 1.0 ug DNA
EUR 1355.00

NUP93 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV661673 1.0 ug DNA
EUR 1355.00

NUP93 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV661674 1.0 ug DNA
EUR 1355.00

NUP93 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1468605 3 x 1.0 ug
EUR 376.00

Nup93 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4879405 3 x 1.0 ug
EUR 376.00

Nup93 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6522905 3 x 1.0 ug
EUR 376.00

NUP93 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1468606 1.0 ug DNA
EUR 167.00