Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

DLR-RAB8B-Hu-96T 96T
EUR 673
  • Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RDR-RAB8B-Hu-48Tests 48 Tests
EUR 544

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RDR-RAB8B-Hu-96Tests 96 Tests
EUR 756

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RD-RAB8B-Hu-48Tests 48 Tests
EUR 521

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RD-RAB8B-Hu-96Tests 96 Tests
EUR 723

Rab8b/ Rat Rab8b ELISA Kit

ELI-52483r 96 Tests
EUR 886

RAB8B antibody

70R-19725 50 ul
EUR 435
Description: Rabbit polyclonal RAB8B antibody

RAB8B Antibody

37853-100ul 100ul
EUR 252

RAB8B Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB8B. Recognizes RAB8B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:200-1:1000, IHC:1:30-1:150

RAB8B Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB8B. Recognizes RAB8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB8B Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB8B. Recognizes RAB8B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:30-1:150

RAB8B Antibody

DF9837 200ul
EUR 304
Description: RAB8B Antibody detects endogenous levels of total RAB8B.

RAB8B antibody

70R-9843 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAB8B antibody

RAB8B antibody

70R-9844 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal RAB8B antibody

RAB8B Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB8B. Recognizes RAB8B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RAB8B Antibody

ABD9837 100 ug
EUR 438

Rab8B, Member Ras Oncogene Family (RAB8B) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

abx036571-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

abx030728-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

abx030728-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

abx237046-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

abx237047-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB8B, Member RAS Oncogene Family (RAB8B) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

RAB8B Blocking Peptide

33R-2882 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB8B antibody, catalog no. 70R-9843

RAB8B Blocking Peptide

33R-8301 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB8B antibody, catalog no. 70R-9844

RAB8B Blocking Peptide

DF9837-BP 1mg
EUR 195

RAB8B Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

RAB8B Conjugated Antibody

C37853 100ul
EUR 397

RAB8B cloning plasmid

CSB-CL838820HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggcgaagacgtacgattatctcttcaagctcctgctgatcggcgactcgggggtaggcaagacctgcctcctgttccgcttctcagaggacgccttcaacaccaccttcatctccaccatcggaattgattttaaaattagaacgatagaactagatggaaagaaaattaagct
  • Show more
Description: A cloning plasmid for the RAB8B gene.

RAB8B Polyclonal Antibody

A66578 100 µg
EUR 570.55
Description: reagents widely cited

RAB8B Rabbit pAb

A3678-100ul 100 ul
EUR 308

RAB8B Rabbit pAb

A3678-200ul 200 ul
EUR 459

RAB8B Rabbit pAb

A3678-20ul 20 ul
EUR 183

RAB8B Rabbit pAb

A3678-50ul 50 ul
EUR 223

RAB8B Polyclonal Antibody

ABP60072-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human RAB8B protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB8B from Human, Mouse, Rat. This RAB8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB8B protein at amino acid sequence of 120-200

RAB8B Polyclonal Antibody

ABP60072-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human RAB8B protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB8B from Human, Mouse, Rat. This RAB8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB8B protein at amino acid sequence of 120-200

RAB8B Polyclonal Antibody

ABP60072-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human RAB8B protein at amino acid sequence of 120-200
  • Applications tips:
Description: A polyclonal antibody for detection of RAB8B from Human, Mouse, Rat. This RAB8B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB8B protein at amino acid sequence of 120-200

anti- RAB8B antibody

FNab07046 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:50-1:500
  • Immunogen: RAB8B, member RAS oncogene family
  • Uniprot ID: Q92930
  • Gene ID: 51762
  • Research Area: Signal Transduction
Description: Antibody raised against RAB8B

anti- RAB8B antibody

FNab07047 100µg
EUR 548.75
  • Immunogen: RAB8B, member RAS oncogene family
  • Uniprot ID: Q92930
  • Gene ID: 51762
  • Research Area: Signal Transduction
Description: Antibody raised against RAB8B

RAB8B Polyclonal Antibody

ES10134-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against RAB8B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB8B Polyclonal Antibody

ES10134-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against RAB8B from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RAB8B antibody

PAab07046 100 ug
EUR 386

Anti-RAB8B antibody

PAab07047 100 ug
EUR 386

Anti-RAB8B antibody

STJ26440 100 µl
EUR 277

Anti-Rab8b antibody

STJ140088 150 µg
EUR 231
Description: Goat polyclonal antibody to mouse Rab8. Rab8 belongs to the small GTPase superfamily, Rab family. It has cell-type specific function during the process of exocytosis and coordinates regulation of the cytoskeleton. Rab8 also appears to interface with endocytic recycling circuits. At the molecular level, this GTPase regulates both the export of vesicles from the trans- Golgi apparatus, and the directed translocation along actin filaments and microtubules.

Anti-RAB8B antibody

STJ191292 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to RAB8B

Anti-RAB8B (1E4)

YF-MA18574 100 ug
EUR 363
Description: Mouse monoclonal to RAB8B

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

for RAB8B, Member RAS Oncogene Family (RAB8B)ELISA kit

SES078Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for RAB8B, Member RAS Oncogene Family (RAB8B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for RAB8B, Member RAS Oncogene Family (RAB8B) in tissue homogenates, cell lysates and other biological fluids.

for RAB8B, Member RAS Oncogene Family (RAB8B)ELISA kit

SES078Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for RAB8B, Member RAS Oncogene Family (RAB8B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for RAB8B, Member RAS Oncogene Family (RAB8B) in tissue homogenates, cell lysates and other biological fluids.

for RAB8B, Member RAS Oncogene Family (RAB8B)ELISA kit

SES078Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for RAB8B, Member RAS Oncogene Family (RAB8B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for RAB8B, Member RAS Oncogene Family (RAB8B) in tissue homogenates, cell lysates and other biological fluids.

for RAB8B, Member RAS Oncogene Family (RAB8B)ELISA kit

SES078Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for RAB8B, Member RAS Oncogene Family (RAB8B) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Ass
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for RAB8B, Member RAS Oncogene Family (RAB8B) in tissue homogenates, cell lysates and other biological fluids.

ELISA Kit for RAB8B, Member RAS Oncogene Family (RAB8B)

  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as RAB8B, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of RAB8B, Member RAS Oncogene Family (RAB8B) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

RAB8B Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB8B. Recognizes RAB8B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB8B Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB8B. Recognizes RAB8B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB8B Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB8B. Recognizes RAB8B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RAB8B protein (His tag)

80R-2881 100 ug
EUR 327
Description: Purified recombinant RAB8B protein (His tag)


EF002261 96 Tests
EUR 689

Rat RAB8B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human RAB8B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse RAB8B shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RAB8B Recombinant Protein (Human)

RP025552 100 ug Ask for price

RAB8B Recombinant Protein (Mouse)

RP166379 100 ug Ask for price

RAB8B Recombinant Protein (Rat)

RP223397 100 ug Ask for price

RAB8B Polyclonal Antibody, HRP Conjugated

A66579 100 µg
EUR 570.55
Description: Ask the seller for details

RAB8B Polyclonal Antibody, FITC Conjugated

A66580 100 µg
EUR 570.55
Description: The best epigenetics products

RAB8B Polyclonal Antibody, Biotin Conjugated

A66581 100 µg
EUR 570.55
Description: kits suitable for this type of research

Rab8b ORF Vector (Rat) (pORF)

ORF074467 1.0 ug DNA
EUR 506

RAB8B ORF Vector (Human) (pORF)

ORF008518 1.0 ug DNA
EUR 95

Rab8b ORF Vector (Mouse) (pORF)

ORF055461 1.0 ug DNA
EUR 506

Rab8b sgRNA CRISPR Lentivector set (Rat)

K7131201 3 x 1.0 ug
EUR 339

Rab8b sgRNA CRISPR Lentivector set (Mouse)

K3350001 3 x 1.0 ug
EUR 339

RAB8B sgRNA CRISPR Lentivector set (Human)

K1770401 3 x 1.0 ug
EUR 339

Ras-Related Protein Rab-8B (RAB8B) Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.