RAB9A antibody

70R-19726 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB9A antibody

RAB9A Antibody

42726-100ul 100ul
EUR 252.00

RAB9A Antibody

39742-100ul 100ul
EUR 390.00

RAB9A Antibody

40067-100ul 100ul
EUR 252.00

RAB9A Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB9A. Recognizes RAB9A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RAB9A Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB9A. Recognizes RAB9A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

RAB9A antibody

70R-8642 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB9A antibody

RAB9A antibody

70R-8643 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB9A antibody

RAB9A Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB9A. Recognizes RAB9A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB9A Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB9A. Recognizes RAB9A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Rab9A, Member Ras Oncogene Family (RAB9A) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody

abx036518-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody

abx237048-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB9A Blocking Peptide

33R-2883 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB9A antibody, catalog no. 70R-8642

RAB9A Blocking Peptide

33R-8619 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB9A antibody, catalog no. 70R-8643

RAB9A Conjugated Antibody

C42726 100ul
EUR 397.00

RAB9A Conjugated Antibody

C40067 100ul
EUR 397.00

RAB9A-Specific Antibody

abx237049-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB9A cloning plasmid

CSB-CL019224HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 606
  • Sequence: atggcaggaaaatcatcactttttaaagtaattctccttggagatggtggagttgggaagagttcacttatgaacagatatgtaactaataagtttgatacccagctcttccatacaataggtgtggaatttttaaataaagatttggaagtggatggacattttgttaccatgca
  • Show more
Description: A cloning plasmid for the RAB9A gene.

RAB9A Rabbit pAb

A7041-100ul 100 ul
EUR 308.00

RAB9A Rabbit pAb

A7041-200ul 200 ul
EUR 459.00

RAB9A Rabbit pAb

A7041-20ul 20 ul
EUR 183.00

RAB9A Rabbit pAb

A7041-50ul 50 ul
EUR 223.00

RAB9A Polyclonal Antibody

ABP60073-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB9A from Human, Mouse, Rat. This RAB9A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160

RAB9A Polyclonal Antibody

ABP60073-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB9A from Human, Mouse, Rat. This RAB9A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160

RAB9A Polyclonal Antibody

ABP60073-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB9A from Human, Mouse, Rat. This RAB9A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160

anti- RAB9A antibody

FNab07048 100µg
EUR 505.25
  • Immunogen: RAB9A, member RAS oncogene family
  • Uniprot ID: P51151
  • Gene ID: 9367
  • Research Area: Signal Transduction
Description: Antibody raised against RAB9A

RAB9A Polyclonal Antibody

ES10135-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB9A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB9A Polyclonal Antibody

ES10135-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB9A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RAB9A antibody

PAab07048 100 ug
EUR 355.00

Anti-RAB9A antibody

STJ117832 100 µl
EUR 277.00

Anti-Rab9a antibody

STJ140136 150 µg
EUR 231.00
Description: Goat polyclonal antibody to Rab9a. Rab9a belongs to the small GTPase superfamily, Rab family. This protein may be involved in endosome-to-Golgi transport.

Anti-RAB9A antibody

STJ191293 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB9A


ELI-22151d 96 Tests
EUR 928.00


EF002262 96 Tests
EUR 689.00

Mouse RAB9A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RAB9A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human RAB9A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

anti- RAB9A-Specific antibody

FNab07049 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: RAB9A, member RAS oncogene family
  • Research Area: Signal Transduction
Description: Antibody raised against RAB9A-Specific

Anti-Rab9/RAB9A Antibody

PA2281 100ug/vial
EUR 294.00

Anti-RAB9A-Specific antibody

PAab07049 100 ug
EUR 355.00

Anti-Rab9/RAB9A Antibody

PB9884 100ug/vial
EUR 294.00

RAB9A Recombinant Protein (Human)

RP025555 100 ug Ask for price

RAB9A Recombinant Protein (Rat)

RP223400 100 ug Ask for price

Rab9a ORF Vector (Rat) (pORF)

ORF074468 1.0 ug DNA
EUR 506.00

RAB9A ORF Vector (Human) (pORF)

ORF008519 1.0 ug DNA
EUR 95.00

Rab9a sgRNA CRISPR Lentivector set (Rat)

K6942801 3 x 1.0 ug
EUR 339.00

RAB9A sgRNA CRISPR Lentivector set (Human)

K1770501 3 x 1.0 ug
EUR 339.00

Ras-Related Protein Rab-9A (RAB9A) Antibody

  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Monoclonal RAB9A Antibody (monoclonal) (M02), Clone: 4F8

AMM07498G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human RAB9A (monoclonal) (M02). The antibodies are raised in mouse and are from clone 4F8. This antibody is applicable in WB, E

Rab9a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6942802 1.0 ug DNA
EUR 154.00

Rab9a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6942803 1.0 ug DNA
EUR 154.00

Rab9a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6942804 1.0 ug DNA
EUR 154.00

RAB9A sgRNA CRISPR Lentivector (Human) (Target 1)

K1770502 1.0 ug DNA
EUR 154.00

RAB9A sgRNA CRISPR Lentivector (Human) (Target 2)

K1770503 1.0 ug DNA
EUR 154.00

RAB9A sgRNA CRISPR Lentivector (Human) (Target 3)

K1770504 1.0 ug DNA
EUR 154.00

RAB9A Protein Vector (Rat) (pPB-C-His)

PV297870 500 ng
EUR 603.00

RAB9A Protein Vector (Rat) (pPB-N-His)

PV297871 500 ng
EUR 603.00

RAB9A Protein Vector (Rat) (pPM-C-HA)

PV297872 500 ng
EUR 603.00

RAB9A Protein Vector (Rat) (pPM-C-His)

PV297873 500 ng
EUR 603.00

RAB9A Protein Vector (Human) (pPB-C-His)

PV034073 500 ng
EUR 329.00

RAB9A Protein Vector (Human) (pPB-N-His)

PV034074 500 ng
EUR 329.00

RAB9A Protein Vector (Human) (pPM-C-HA)

PV034075 500 ng
EUR 329.00

RAB9A Protein Vector (Human) (pPM-C-His)

PV034076 500 ng
EUR 329.00

Rab9a 3'UTR Luciferase Stable Cell Line

TU217226 1.0 ml Ask for price

Rab9a 3'UTR GFP Stable Cell Line

TU267226 1.0 ml Ask for price

RAB9A 3'UTR GFP Stable Cell Line

TU069350 1.0 ml
EUR 1394.00

RAB9A 3'UTR Luciferase Stable Cell Line

TU019350 1.0 ml
EUR 1394.00

Monoclonal RAB9A Antibody (monoclonal) (M01), Clone: 1.0E+12

AMM07497G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human RAB9A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1.0E+12. This antibody is applicable in WB and IF, E

RAB9A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV689695 1.0 ug DNA
EUR 514.00

RAB9A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV689699 1.0 ug DNA
EUR 514.00

RAB9A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV689700 1.0 ug DNA
EUR 514.00

Mouse Ras- related protein Rab- 9A, Rab9a ELISA KIT

ELI-22152m 96 Tests
EUR 865.00

Human Ras- related protein Rab- 9A, RAB9A ELISA KIT

ELI-36023h 96 Tests
EUR 824.00

Rab9a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6942805 3 x 1.0 ug
EUR 376.00

RAB9A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1770505 3 x 1.0 ug
EUR 376.00

RAB9A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV689696 1.0 ug DNA
EUR 514.00

RAB9A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV689697 1.0 ug DNA
EUR 572.00