RAB9A antibody
70R-19726	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal RAB9A antibody

RAB9A Antibody
42726-100ul	SAB	100ul	EUR 252.00

RAB9A Antibody
39742-100ul	SAB	100ul	EUR 390.00

RAB9A Antibody
40067-100ul	SAB	100ul	EUR 252.00

RAB9A Antibody
1-CSB-PA994941	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB9A. Recognizes RAB9A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

RAB9A Antibody
1-CSB-PA172973	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against RAB9A. Recognizes RAB9A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:25-1:100

RAB9A antibody
70R-8642	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal RAB9A antibody

RAB9A antibody
70R-8643	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal RAB9A antibody

RAB9A Antibody
1-CSB-PA019224DSR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB9A. Recognizes RAB9A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

RAB9A Antibody
1-CSB-PA019224GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RAB9A. Recognizes RAB9A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

RAB9A siRNA
20-abx904437	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB9A siRNA
20-abx930714	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

RAB9A siRNA
20-abx930715	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

Rab9A, Member Ras Oncogene Family (RAB9A) Antibody
20-abx115005	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody
20-abx125388	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	0 1 2
Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody
abx036518-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody
20-abx241003	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody
20-abx241911	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody
abx237048-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

RAB9A, Member RAS Oncogene Family (RAB9A) Antibody
20-abx321837	Abbexa	EUR 439.00 EUR 328.00	0 1
Shipped within 5-10 working days.

RAB9A Blocking Peptide
33R-2883	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB9A antibody, catalog no. 70R-8642

RAB9A Blocking Peptide
33R-8619	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB9A antibody, catalog no. 70R-8643

RAB9A Conjugated Antibody
C42726	SAB	100ul	EUR 397.00

RAB9A Conjugated Antibody
C40067	SAB	100ul	EUR 397.00

RAB9A-Specific Antibody
abx237049-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

RAB9A cloning plasmid
CSB-CL019224HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 606 Sequence: atggcaggaaaatcatcactttttaaagtaattctccttggagatggtggagttgggaagagttcacttatgaacagatatgtaactaataagtttgatacccagctcttccatacaataggtgtggaatttttaaataaagatttggaagtggatggacattttgttaccatgca Show more
Description: A cloning plasmid for the RAB9A gene.

RAB9A Rabbit pAb
A7041-100ul	Abclonal	100 ul	EUR 308.00

RAB9A Rabbit pAb
A7041-200ul	Abclonal	200 ul	EUR 459.00

RAB9A Rabbit pAb
A7041-20ul	Abclonal	20 ul	EUR 183.00

RAB9A Rabbit pAb
A7041-50ul	Abclonal	50 ul	EUR 223.00

RAB9A Polyclonal Antibody
ABP60073-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB9A from Human, Mouse, Rat. This RAB9A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160

RAB9A Polyclonal Antibody
ABP60073-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB9A from Human, Mouse, Rat. This RAB9A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160

RAB9A Polyclonal Antibody
ABP60073-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160 Applications tips:
Description: A polyclonal antibody for detection of RAB9A from Human, Mouse, Rat. This RAB9A antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9A protein at amino acid sequence of 80-160

anti- RAB9A antibody
FNab07048	FN Test	100µg	EUR 505.25
Immunogen: RAB9A, member RAS oncogene family Uniprot ID: P51151 Gene ID: 9367 Research Area: Signal Transduction
Description: Antibody raised against RAB9A

RAB9A Polyclonal Antibody
ES10135-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB9A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB9A Polyclonal Antibody
ES10135-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB9A from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-RAB9A antibody
PAab07048	Lifescience Market	100 ug	EUR 355.00

Anti-RAB9A antibody
STJ117832	St John's Laboratory	100 µl	EUR 277.00

Anti-Rab9a antibody
STJ140136	St John's Laboratory	150 µg	EUR 231.00
Description: Goat polyclonal antibody to Rab9a. Rab9a belongs to the small GTPase superfamily, Rab family. This protein may be involved in endosome-to-Golgi transport.

Anti-RAB9A antibody
STJ191293	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB9A

Canine RAB9A ELISA KIT
ELI-22151d	Lifescience Market	96 Tests	EUR 928.00

RAB9A ELISA KIT|Human
EF002262	Lifescience Market	96 Tests	EUR 689.00

Mouse RAB9A shRNA Plasmid
20-abx974738	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat RAB9A shRNA Plasmid
20-abx986976	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human RAB9A shRNA Plasmid
20-abx956202	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

anti- RAB9A-Specific antibody
FNab07049	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: RAB9A, member RAS oncogene family Research Area: Signal Transduction
Description: Antibody raised against RAB9A-Specific

Anti-Rab9/RAB9A Antibody
PA2281	BosterBio	100ug/vial	EUR 294.00

Anti-RAB9A-Specific antibody
PAab07049	Lifescience Market	100 ug	EUR 355.00

Anti-Rab9/RAB9A Antibody
PB9884	BosterBio	100ug/vial	EUR 294.00

RAB9A Recombinant Protein (Human)
RP025555	ABM	100 ug	Ask for price

RAB9A Recombinant Protein (Rat)
RP223400	ABM	100 ug	Ask for price

Rab9a ORF Vector (Rat) (pORF)
ORF074468	ABM	1.0 ug DNA	EUR 506.00

RAB9A ORF Vector (Human) (pORF)
ORF008519	ABM	1.0 ug DNA	EUR 95.00

Rab9a sgRNA CRISPR Lentivector set (Rat)
K6942801	ABM	3 x 1.0 ug	EUR 339.00

RAB9A sgRNA CRISPR Lentivector set (Human)
K1770501	ABM	3 x 1.0 ug	EUR 339.00

Ras-Related Protein Rab-9A (RAB9A) Antibody
20-abx218138	Abbexa	EUR 425.00 EUR 342.00	0 1
Shipped within 5-10 working days.

Monoclonal RAB9A Antibody (monoclonal) (M02), Clone: 4F8
AMM07498G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human RAB9A (monoclonal) (M02). The antibodies are raised in mouse and are from clone 4F8. This antibody is applicable in WB, E

Rab9a sgRNA CRISPR Lentivector (Rat) (Target 1)
K6942802	ABM	1.0 ug DNA	EUR 154.00

Rab9a sgRNA CRISPR Lentivector (Rat) (Target 2)
K6942803	ABM	1.0 ug DNA	EUR 154.00

Rab9a sgRNA CRISPR Lentivector (Rat) (Target 3)
K6942804	ABM	1.0 ug DNA	EUR 154.00

RAB9A sgRNA CRISPR Lentivector (Human) (Target 1)
K1770502	ABM	1.0 ug DNA	EUR 154.00

RAB9A sgRNA CRISPR Lentivector (Human) (Target 2)
K1770503	ABM	1.0 ug DNA	EUR 154.00

RAB9A sgRNA CRISPR Lentivector (Human) (Target 3)
K1770504	ABM	1.0 ug DNA	EUR 154.00

RAB9A Protein Vector (Rat) (pPB-C-His)
PV297870	ABM	500 ng	EUR 603.00

RAB9A Protein Vector (Rat) (pPB-N-His)
PV297871	ABM	500 ng	EUR 603.00

RAB9A Protein Vector (Rat) (pPM-C-HA)
PV297872	ABM	500 ng	EUR 603.00

RAB9A Protein Vector (Rat) (pPM-C-His)
PV297873	ABM	500 ng	EUR 603.00

RAB9A Protein Vector (Human) (pPB-C-His)
PV034073	ABM	500 ng	EUR 329.00

RAB9A Protein Vector (Human) (pPB-N-His)
PV034074	ABM	500 ng	EUR 329.00

RAB9A Protein Vector (Human) (pPM-C-HA)
PV034075	ABM	500 ng	EUR 329.00

RAB9A Protein Vector (Human) (pPM-C-His)
PV034076	ABM	500 ng	EUR 329.00

Rab9a 3'UTR Luciferase Stable Cell Line
TU217226	ABM	1.0 ml	Ask for price

Rab9a 3'UTR GFP Stable Cell Line
TU267226	ABM	1.0 ml	Ask for price

RAB9A 3'UTR GFP Stable Cell Line
TU069350	ABM	1.0 ml	EUR 1394.00

RAB9A 3'UTR Luciferase Stable Cell Line
TU019350	ABM	1.0 ml	EUR 1394.00

Monoclonal RAB9A Antibody (monoclonal) (M01), Clone: 1.0E+12
AMM07497G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human RAB9A (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1.0E+12. This antibody is applicable in WB and IF, E

RAB9A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV689695	ABM	1.0 ug DNA	EUR 514.00

RAB9A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV689699	ABM	1.0 ug DNA	EUR 514.00

RAB9A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV689700	ABM	1.0 ug DNA	EUR 514.00

Mouse Ras- related protein Rab- 9A, Rab9a ELISA KIT
ELI-22152m	Lifescience Market	96 Tests	EUR 865.00

Human Ras- related protein Rab- 9A, RAB9A ELISA KIT
ELI-36023h	Lifescience Market	96 Tests	EUR 824.00

Rab9a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6942805	ABM	3 x 1.0 ug	EUR 376.00

RAB9A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1770505	ABM	3 x 1.0 ug	EUR 376.00

RAB9A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV689696	ABM	1.0 ug DNA	EUR 514.00

RAB9A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV689697	ABM	1.0 ug DNA	EUR 572.00