SLC25A6 Antibody
34388-100ul 100ul
EUR 252
SLC25A6 Antibody
34388-50ul 50ul
EUR 187
SLC25A6 Antibody
1-CSB-PA000883
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000
SLC25A6 Antibody
DF3742 200ul
EUR 304
Description: SLC25A6 Antibody detects endogenous levels of total SLC25A6.
SLC25A6 Antibody
CSB-PA238544-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SLC25A6 Antibody
CSB-PA238544-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
SLC25A6 antibody
70R-6466 50 ug
EUR 467
Description: Rabbit polyclonal SLC25A6 antibody
SLC25A6 antibody
70R-33998 100 ug
EUR 327
Description: Rabbit polyclonal SLC25A6 antibody
SLC25A6 Antibody
1-CSB-PA021520GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
SLC25A6 Antibody
1-CSB-PA021520LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:1000-1:2000
SLC25A6 siRNA
20-abx933768
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SLC25A6 Antibody
ABD3742 100 ug
EUR 438
anti-SLC25A6
YF-PA10214 100 ug
EUR 403
Description: Rabbit polyclonal to SLC25A6
anti-SLC25A6
YF-PA23214 50 ul
EUR 334
Description: Mouse polyclonal to SLC25A6
Anti-SLC25A6 Antibody
A09457 100ul
EUR 397
Description: Rabbit Polyclonal SLC25A6 Antibody. Validated in WB and tested in Human.
SLC25A6 Blocking Peptide
33R-5346 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC25A6 antibody, catalog no. 70R-6466
SLC25A6 Blocking Peptide
DF3742-BP 1mg
EUR 195
SLC25A6-Specific Antibody
abx237947-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SLC25A6 Conjugated Antibody
C34388 100ul
EUR 397
SLC25A6 cloning plasmid
CSB-CL021520HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt
  • Show more
Description: A cloning plasmid for the SLC25A6 gene.
SLC25A6 cloning plasmid
CSB-CL021520HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt
  • Show more
Description: A cloning plasmid for the SLC25A6 gene.
SLC25A6 cloning plasmid
CSB-CL021520HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 897
  • Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt
  • Show more
Description: A cloning plasmid for the SLC25A6 gene.
SLC25A6 Rabbit pAb
A3585-100ul 100 ul
EUR 308
SLC25A6 Rabbit pAb
A3585-200ul 200 ul
EUR 459
SLC25A6 Rabbit pAb
A3585-20ul 20 ul
EUR 183
SLC25A6 Rabbit pAb
A3585-50ul 50 ul
EUR 223
SLC25A6 Rabbit pAb
A15029-100ul 100 ul
EUR 308
SLC25A6 Rabbit pAb
A15029-200ul 200 ul
EUR 459
SLC25A6 Rabbit pAb
A15029-20ul 20 ul
EUR 183
SLC25A6 Rabbit pAb
A15029-50ul 50 ul
EUR 223
anti- SLC25A6 antibody
FNab07946 100µg
EUR 548.75
  • Immunogen: solute carrier family 25(mitochondrial carrier
  • adenine nucleotide translocator), member 6
  • Uniprot ID: P12236
  • Gene ID: 293
  • Research Area: Metabolism
Description: Antibody raised against SLC25A6
Anti-SLC25A6 antibody
PAab07946 100 ug
EUR 386
pDONR223-SLC25A6 Plasmid
PVTB01143-1 2 ug
EUR 356
Anti-SLC25A6 antibody
STJ25572 100 µl
EUR 277
Description: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.
Anti-SLC25A6 antibody
STJ117223 100 µl
EUR 277
Description: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.
Anti-SLC25A6 (2A9)
YF-MA11936 100 ug
EUR 363
Description: Mouse monoclonal to SLC25A6
Anti-SLC25A6 (4B9)
YF-MA11937 100 ug
EUR 363
Description: Mouse monoclonal to SLC25A6
Human SLC25A6 ELISA Kit
ELA-E11022h 96 Tests
EUR 824
SLC25A6 ELISA KIT|Human
EF003120 96 Tests
EUR 689
SLC25A6 Antibody, HRP conjugated
1-CSB-PA021520LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SLC25A6 Antibody, FITC conjugated
1-CSB-PA021520LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SLC25A6 Antibody, Biotin conjugated
1-CSB-PA021520LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
Human SLC25A6 shRNA Plasmid
20-abx950205
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
anti- SLC25A6-Specific antibody
FNab07947 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:1000
  • IP: 1:500-1:1000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: solute carrier family 25(mitochondrial carrier
  • adenine nucleotide translocator), member 6
  • Uniprot ID: P12236
  • Research Area: Metabolism
Description: Antibody raised against SLC25A6-Specific
Anti-SLC25A6-Specific antibody
PAab07947 100 ug
EUR 386
pENTR223-SLC25A6-C408T vector
PVT11711 2 ug
EUR 304
SLC25A6 Recombinant Protein (Human)
RP028915 100 ug Ask for price
SLC25A6 Recombinant Protein (Human)
RP028918 100 ug Ask for price
SLC25A6 Recombinant Protein (Human)
RP028921 100 ug Ask for price
SLC25A6 ORF Vector (Human) (pORF)
ORF009639 1.0 ug DNA
EUR 95
SLC25A6 ORF Vector (Human) (pORF)
ORF009640 1.0 ug DNA
EUR 95
SLC25A6 ORF Vector (Human) (pORF)
ORF009641 1.0 ug DNA
EUR 95
SLC25A6 ELISA Kit (Bovine) (OKEH07686)
OKEH07686 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
SLC25A6 ELISA Kit (Pig) (OKEH07687)
OKEH07687 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:
SLC25A6 ELISA Kit (Human) (OKEH02131)
OKEH02131 96 Wells
EUR 662
Description: Description of target: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.045 ng/mL
Polyclonal SLC25A6 antibody - N-terminal region
APR01388G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC25A6 - N-terminal region. This antibody is tested and proven to work in the following applications:
Polyclonal SLC25A6 / ANT3 Antibody (aa121-170)
APR10035G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC25A6 / ANT3 (aa121-170). This antibody is tested and proven to work in the following applications:
ADP/ATP Translocase 3 (SLC25A6) Antibody
abx026644-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
abx026644-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
20-abx115671
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
20-abx123248
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
20-abx014156
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
abx237946-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
ADP/ATP translocase 3 (SLC25A6) Antibody
abx331163-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.
ADP/ATP translocase 3 (SLC25A6) Antibody
20-abx324630
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody
20-abx302433
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A6 sgRNA CRISPR Lentivector set (Human)
K2176901 3 x 1.0 ug
EUR 339
Monoclonal SLC25A6 Antibody (monoclonal) (M01), Clone: 2A9
APR10036G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human SLC25A6 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A9. This antibody is applicable in WB, E
ADP/ATP Translocase 3 (SLC25A6) Antibody (HRP)
20-abx314320
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody (FITC)
20-abx314321
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
ADP/ATP Translocase 3 (SLC25A6) Antibody (Biotin)
20-abx314322
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.
SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2176902 1.0 ug DNA
EUR 154
SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2176903 1.0 ug DNA
EUR 154
SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2176904 1.0 ug DNA
EUR 154
SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038553 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038554 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038555 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPM-C-His)
PV038556 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038557 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038558 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038559 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPM-C-His)
PV038560 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038561 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038562 500 ng
EUR 329
SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038563 500 ng
EUR 329