SLC25A6

SLC25A6 Antibody
34388-100ul	SAB	100ul	EUR 252

SLC25A6 Antibody
34388-50ul	SAB	50ul	EUR 187

SLC25A6 Antibody
1-CSB-PA000883	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

SLC25A6 Antibody
DF3742	Affbiotech	200ul	EUR 304
Description: SLC25A6 Antibody detects endogenous levels of total SLC25A6.

SLC25A6 Antibody
CSB-PA238544-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

SLC25A6 Antibody
CSB-PA238544-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

SLC25A6 antibody
70R-6466	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SLC25A6 antibody

SLC25A6 antibody
70R-33998	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal SLC25A6 antibody

SLC25A6 Antibody
1-CSB-PA021520GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SLC25A6 Antibody
1-CSB-PA021520LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:1000-1:2000

SLC25A6 siRNA
20-abx933768	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SLC25A6 Antibody
ABD3742	Lifescience Market	100 ug	EUR 438

anti-SLC25A6
YF-PA10214	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to SLC25A6

anti-SLC25A6
YF-PA23214	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to SLC25A6

Anti-SLC25A6 Antibody
A09457	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal SLC25A6 Antibody. Validated in WB and tested in Human.

SLC25A6 Blocking Peptide
33R-5346	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SLC25A6 antibody, catalog no. 70R-6466

SLC25A6 Blocking Peptide
DF3742-BP	Affbiotech	1mg	EUR 195

SLC25A6-Specific Antibody
abx237947-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

SLC25A6 Conjugated Antibody
C34388	SAB	100ul	EUR 397

SLC25A6 cloning plasmid
CSB-CL021520HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 897 Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt Show more
Description: A cloning plasmid for the SLC25A6 gene.

SLC25A6 cloning plasmid
CSB-CL021520HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 897 Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt Show more
Description: A cloning plasmid for the SLC25A6 gene.

SLC25A6 cloning plasmid
CSB-CL021520HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 897 Sequence: atgacggaacaggccatctccttcgccaaagacttcttggccggaggcatcgccgccgccatctccaagacggccgtggctccgatcgagcgggtcaagctgctgctgcaggtccagcacgccagcaagcagatcgccgccgacaagcagtacaagggcatcgtggactgcattgt Show more
Description: A cloning plasmid for the SLC25A6 gene.

SLC25A6 Rabbit pAb
A3585-100ul	Abclonal	100 ul	EUR 308

SLC25A6 Rabbit pAb
A3585-200ul	Abclonal	200 ul	EUR 459

SLC25A6 Rabbit pAb
A3585-20ul	Abclonal	20 ul	EUR 183

SLC25A6 Rabbit pAb
A3585-50ul	Abclonal	50 ul	EUR 223

SLC25A6 Rabbit pAb
A15029-100ul	Abclonal	100 ul	EUR 308

SLC25A6 Rabbit pAb
A15029-200ul	Abclonal	200 ul	EUR 459

SLC25A6 Rabbit pAb
A15029-20ul	Abclonal	20 ul	EUR 183

SLC25A6 Rabbit pAb
A15029-50ul	Abclonal	50 ul	EUR 223

anti- SLC25A6 antibody
FNab07946	FN Test	100µg	EUR 548.75
Immunogen: solute carrier family 25(mitochondrial carrier adenine nucleotide translocator), member 6 Uniprot ID: P12236 Gene ID: 293 Research Area: Metabolism
Description: Antibody raised against SLC25A6

Anti-SLC25A6 antibody
PAab07946	Lifescience Market	100 ug	EUR 386

pDONR223-SLC25A6 Plasmid
PVTB01143-1	Lifescience Market	2 ug	EUR 356

Anti-SLC25A6 antibody
STJ25572	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.

Anti-SLC25A6 antibody
STJ117223	St John's Laboratory	100 µl	EUR 277
Description: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.

Anti-SLC25A6 (2A9)
YF-MA11936	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SLC25A6

Anti-SLC25A6 (4B9)
YF-MA11937	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SLC25A6

Human SLC25A6 ELISA Kit
ELA-E11022h	Lifescience Market	96 Tests	EUR 824

SLC25A6 ELISA KIT|Human
EF003120	Lifescience Market	96 Tests	EUR 689

SLC25A6 Antibody, HRP conjugated
1-CSB-PA021520LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SLC25A6 Antibody, FITC conjugated
1-CSB-PA021520LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SLC25A6 Antibody, Biotin conjugated
1-CSB-PA021520LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SLC25A6. Recognizes SLC25A6 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human SLC25A6 shRNA Plasmid
20-abx950205	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

anti- SLC25A6-Specific antibody
FNab07947	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IP: 1:500-1:1000 IHC: 1:20-1:200 IF: 1:10-1:100 Immunogen: solute carrier family 25(mitochondrial carrier adenine nucleotide translocator), member 6 Uniprot ID: P12236 Research Area: Metabolism
Description: Antibody raised against SLC25A6-Specific

Anti-SLC25A6-Specific antibody
PAab07947	Lifescience Market	100 ug	EUR 386

pENTR223-SLC25A6-C408T vector
PVT11711	Lifescience Market	2 ug	EUR 304

SLC25A6 Recombinant Protein (Human)
RP028915	ABM	100 ug	Ask for price

SLC25A6 Recombinant Protein (Human)
RP028918	ABM	100 ug	Ask for price

SLC25A6 Recombinant Protein (Human)
RP028921	ABM	100 ug	Ask for price

SLC25A6 ORF Vector (Human) (pORF)
ORF009639	ABM	1.0 ug DNA	EUR 95

SLC25A6 ORF Vector (Human) (pORF)
ORF009640	ABM	1.0 ug DNA	EUR 95

SLC25A6 ORF Vector (Human) (pORF)
ORF009641	ABM	1.0 ug DNA	EUR 95

SLC25A6 ELISA Kit (Bovine) (OKEH07686)
OKEH07686	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

SLC25A6 ELISA Kit (Pig) (OKEH07687)
OKEH07687	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

SLC25A6 ELISA Kit (Human) (OKEH02131)
OKEH02131	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.045 ng/mL

Polyclonal SLC25A6 antibody - N-terminal region
APR01388G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC25A6 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal SLC25A6 / ANT3 Antibody (aa121-170)
APR10035G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SLC25A6 / ANT3 (aa121-170). This antibody is tested and proven to work in the following applications:

ADP/ATP Translocase 3 (SLC25A6) Antibody
abx026644-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

ADP/ATP Translocase 3 (SLC25A6) Antibody
abx026644-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

ADP/ATP Translocase 3 (SLC25A6) Antibody
20-abx115671	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

ADP/ATP Translocase 3 (SLC25A6) Antibody
20-abx123248	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

ADP/ATP Translocase 3 (SLC25A6) Antibody
20-abx014156	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

ADP/ATP Translocase 3 (SLC25A6) Antibody
abx237946-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

ADP/ATP translocase 3 (SLC25A6) Antibody
abx331163-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

ADP/ATP translocase 3 (SLC25A6) Antibody
20-abx324630	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

ADP/ATP Translocase 3 (SLC25A6) Antibody
20-abx302433	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SLC25A6 sgRNA CRISPR Lentivector set (Human)
K2176901	ABM	3 x 1.0 ug	EUR 339

Monoclonal SLC25A6 Antibody (monoclonal) (M01), Clone: 2A9
APR10036G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human SLC25A6 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A9. This antibody is applicable in WB, E

ADP/ATP Translocase 3 (SLC25A6) Antibody (HRP)
20-abx314320	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ADP/ATP Translocase 3 (SLC25A6) Antibody (FITC)
20-abx314321	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ADP/ATP Translocase 3 (SLC25A6) Antibody (Biotin)
20-abx314322	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 1)
K2176902	ABM	1.0 ug DNA	EUR 154

SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 2)
K2176903	ABM	1.0 ug DNA	EUR 154

SLC25A6 sgRNA CRISPR Lentivector (Human) (Target 3)
K2176904	ABM	1.0 ug DNA	EUR 154

SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038553	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038554	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038555	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPM-C-His)
PV038556	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038557	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038558	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038559	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPM-C-His)
PV038560	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPB-C-His)
PV038561	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPB-N-His)
PV038562	ABM	500 ng	EUR 329

SLC25A6 Protein Vector (Human) (pPM-C-HA)
PV038563	ABM	500 ng	EUR 329