STAM2 antibody
70R-20563	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal STAM2 antibody

STAM2 Antibody
44419-100ul	SAB	100ul	EUR 252.00

STAM2 Antibody
44419-50ul	SAB	50ul	EUR 187.00

STAM2 Antibody
1-CSB-PA004166	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAM2. Recognizes STAM2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

STAM2 antibody
70R-36811	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit Polyclonal STAM2 antibody

STAM2 antibody
70R-50658	Fitzgerald	100 ul	EUR 287.00
Description: Purified Polyclonal STAM2 antibody

STAM2 Antibody
1-CSB-PA022793ESR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAM2. Recognizes STAM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

STAM2 Antibody
1-CSB-PA022793GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAM2. Recognizes STAM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

STAM2 siRNA
20-abx905316	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

STAM2 siRNA
20-abx935373	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

STAM2 siRNA
20-abx935374	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

STAM2 Antibody
AF7658	Affbiotech	200ul	EUR 376.00
Description: STAM2 Antibody detects endogenous levels of STAM2.

STAM2 Antibody
AF9203	Affbiotech	200ul	EUR 304.00
Description: STAM2 Antibody detects endogenous levels of total STAM2.

STAM2 Antibody
ABF9203	Lifescience Market	100 ug	EUR 438.00

anti-STAM2
YF-PA16838	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to STAM2

anti-STAM2
YF-PA16839	Abfrontier	100 ug	EUR 403.00
Description: Rabbit polyclonal to STAM2

anti-STAM2
YF-PA25523	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to STAM2

STAM2 antibody (Tyr192)
70R-35162	Fitzgerald	100 ug	EUR 327.00
Description: Purified Rabbit polyclonal STAM2 antibody (Tyr192)

STAM2 (pT192) Antibody
20-abx009762	Abbexa	EUR 314.00 EUR 467.00 EUR 203.00	0 1 2
Shipped within 5-10 working days.

STAM2 Blocking Peptide
20-abx162048	Abbexa	EUR 272.00 EUR 411.00	0 1
Shipped within 5-10 working days.

STAM2 Conjugated Antibody
C44419	SAB	100ul	EUR 397.00

STAM2 cloning plasmid
CSB-CL022793HU-10ug	Cusabio	10ug	EUR 376.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1578 Sequence: atgcctttgttcaccgccaaccccttcgagcaagacgtggaaaaagccacgaatgagtacaacactacagaagattggagtcttattatggacatatgtgacaaagttggaagtactcctaatggagcgaaagattgcctaaaagccataatgaaaagggtaaatcataaggttc Show more
Description: A cloning plasmid for the STAM2 gene.

STAM2 Blocking Peptide
AF7658-BP	Affbiotech	1mg	EUR 195.00

STAM2 Blocking Peptide
AF9203-BP	Affbiotech	1mg	EUR 195.00

STAM2 Polyclonal Antibody
ABP52507-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192 Applications tips:
Description: A polyclonal antibody for detection of STAM2 from Human, Mouse. This STAM2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192

STAM2 Polyclonal Antibody
ABP52507-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192 Applications tips:
Description: A polyclonal antibody for detection of STAM2 from Human, Mouse. This STAM2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192

STAM2 Polyclonal Antibody
ABP52507-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192 Applications tips:
Description: A polyclonal antibody for detection of STAM2 from Human, Mouse. This STAM2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192

STAM2 Rabbit pAb
A7058-100ul	Abclonal	100 ul	EUR 308.00

STAM2 Rabbit pAb
A7058-200ul	Abclonal	200 ul	EUR 459.00

STAM2 Rabbit pAb
A7058-20ul	Abclonal	20 ul	EUR 183.00

STAM2 Rabbit pAb
A7058-50ul	Abclonal	50 ul	EUR 223.00

anti- STAM2 antibody
FNab08284	FN Test	100µg	EUR 548.75
Immunogen: signal transducing adaptor molecule(SH3 domain and ITAM motif) 2 Uniprot ID: O75886 Gene ID: 10254 Research Area: Epigenetics, Signal Transduction
Description: Antibody raised against STAM2

STAM2 Polyclonal Antibody
ES3506-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against STAM2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

STAM2 Polyclonal Antibody
ES3506-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against STAM2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA

Anti-STAM2 antibody
PAab08284	Lifescience Market	100 ug	EUR 386.00

Anti-STAM2 antibody
STJ29138	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation.

Anti-STAM2 antibody
STJ95800	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to STAM2.

Anti-STAM2 antibody
STJ70906	St John's Laboratory	100 µg	EUR 359.00

Anti-STAM2 (1A10)
YF-MA11265	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to STAM2

STAM2 (Phospho-Tyr371) Antibody
13021-100ul	SAB	100ul	EUR 252.00

STAM2 (Phospho-Tyr371) Antibody
13021-50ul	SAB	50ul	EUR 187.00

Phospho-STAM2 (Y192) Antibody
1-CSB-PA070192	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-STAM2 (Y192). Recognizes Phospho-STAM2 (Y192) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

Polyclonal STAM2 Antibody (Center)
APR03900G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAM2 (Center). This antibody is tested and proven to work in the following applications:

STAM2 (pY192) Blocking Peptide
20-abx063533	Abbexa	EUR 314.00 EUR 509.00	0 1
Shipped within 5-10 working days.

Rat STAM2 shRNA Plasmid
20-abx989646	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Phospho-STAM2 (Tyr371) Antibody
AF7158	Affbiotech	200ul	EUR 376.00
Description: Phospho-STAM2 (Tyr371) Antibody detects endogenous levels of STAM2 only when phosphorylated at Tyr371.

Mouse STAM2 shRNA Plasmid
20-abx974699	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human STAM2 shRNA Plasmid
20-abx956941	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

STAM2 Recombinant Protein (Rat)
RP231314	ABM	100 ug	Ask for price

STAM2 Recombinant Protein (Human)
RP030298	ABM	100 ug	Ask for price

STAM2 Recombinant Protein (Mouse)
RP175883	ABM	100 ug	Ask for price

STAM2 (Phospho-Tyr192) Polyclonal Antibody
12250-100ul	SAB	100ul	EUR 252.00

STAM2 (Phospho-Tyr192) Polyclonal Antibody
12250-50ul	SAB	50ul	EUR 187.00

Polyclonal Goat Anti-STAM2 Antibody
APG00317G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-STAM2 . This antibody is tested and proven to work in the following applications:

Phospho-STAM2 (Tyr371) Blocking Peptide
AF7158-BP	Affbiotech	1mg	EUR 195.00

STAM2 (Phospho-Tyr371) Conjugated Antibody
C13021	SAB	100ul	EUR 397.00

STAM2 (phospho Tyr192) Polyclonal Antibody
ABP56924-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from human STAM2 around the phosphorylation site of Y192 Applications tips:
Description: A polyclonal antibody for detection of STAM2 phospho Tyr192) from Human, Mouse. This STAM2 phospho Tyr192) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the phosphorylation site of Y192

STAM2 (phospho Tyr192) Polyclonal Antibody
ABP56924-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from human STAM2 around the phosphorylation site of Y192 Applications tips:
Description: A polyclonal antibody for detection of STAM2 phospho Tyr192) from Human, Mouse. This STAM2 phospho Tyr192) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the phosphorylation site of Y192

STAM2 (phospho Tyr192) Polyclonal Antibody
ABP56924-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from human STAM2 around the phosphorylation site of Y192 Applications tips:
Description: A polyclonal antibody for detection of STAM2 phospho Tyr192) from Human, Mouse. This STAM2 phospho Tyr192) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the phosphorylation site of Y192

STAM2 (phospho Tyr192) Polyclonal Antibody
ES7923-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against STAM2 (phospho Tyr192) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

STAM2 (phospho Tyr192) Polyclonal Antibody
ES7923-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against STAM2 (phospho Tyr192) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA

Stam2 ORF Vector (Rat) (pORF)
ORF077106	ABM	1.0 ug DNA	EUR 506.00

STAM2 ORF Vector (Human) (pORF)
ORF010100	ABM	1.0 ug DNA	EUR 95.00

Stam2 ORF Vector (Mouse) (pORF)
ORF058629	ABM	1.0 ug DNA	EUR 506.00

Anti-Phospho-STAM2 (Y192) antibody
STJ90559	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to Phospho-STAM2 (Y192).

STAM2 ELISA Kit (Rat) (OKEI00921)
OKEI00921	Aviva Systems Biology	96 Wells	EUR 767.00
Description: Description of target: Involved in intracellular signal transduction mediated by cytokines and growth factors. Upon IL-2 and GM-CSL stimulation, it plays a role in signaling leading to DNA synthesis and MYC induction. May also play a role in T-cell development. Involved in down-regulation of receptor tyrosine kinase via multivesicular body (MVBs) when complexed with HGS (ESCRT-0 complex). The ESCRT-0 complex binds ubiquitin and acts as sorting machinery that recognizes ubiquitinated receptors and transfers them to further sequential lysosomal sorting/trafficking processes.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Stam2 sgRNA CRISPR Lentivector set (Rat)
K6417601	ABM	3 x 1.0 ug	EUR 339.00

Stam2 sgRNA CRISPR Lentivector set (Mouse)
K3527201	ABM	3 x 1.0 ug	EUR 339.00

STAM2 sgRNA CRISPR Lentivector set (Human)
K2298901	ABM	3 x 1.0 ug	EUR 339.00

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx005342	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx027760-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx027760-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx218779	Abbexa	EUR 425.00 EUR 342.00	0 1
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (Stam2) Antibody
20-abx115562	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx131129	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	0 1 2 3 4
Shipped within 5-7 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx131130	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx131131	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx133339	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx145673-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx238284-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx326181	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx321832	Abbexa	EUR 439.00 EUR 328.00	0 1
Shipped within 5-10 working days.

Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx432003-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

Monoclonal STAM2 Antibody (monoclonal) (M01), Clone: 1A10
AMM04142G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human STAM2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1A10. This antibody is applicable in WB, IP, E

Stam2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6417602	ABM	1.0 ug DNA	EUR 154.00