STAM2 Antibody
AF9203 200ul
EUR 304
Description: STAM2 Antibody detects endogenous levels of total STAM2.
STAM2 siRNA
20-abx905316
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAM2 Antibody
AF7658 200ul
EUR 376
Description: STAM2 Antibody detects endogenous levels of STAM2.
STAM2 Antibody
ABF9203 100 ug
EUR 438
STAM2 antibody
70R-50658 100 ul
EUR 287
Description: Purified Polyclonal STAM2 antibody
STAM2 antibody
70R-36811 100 ug
EUR 327
Description: Rabbit Polyclonal STAM2 antibody
STAM2 Antibody
44419-100ul 100ul
EUR 252
STAM2 Antibody
44419-50ul 50ul
EUR 187
STAM2 antibody
70R-20563 50 ul
EUR 435
Description: Rabbit polyclonal STAM2 antibody
STAM2 siRNA
20-abx935373
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAM2 siRNA
20-abx935374
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
STAM2 Antibody
1-CSB-PA004166
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against STAM2. Recognizes STAM2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000
STAM2 Antibody
1-CSB-PA022793ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STAM2. Recognizes STAM2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200
STAM2 Antibody
1-CSB-PA022793GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STAM2. Recognizes STAM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
anti-STAM2
YF-PA16838 50 ul
EUR 363
Description: Mouse polyclonal to STAM2
anti-STAM2
YF-PA16839 100 ug
EUR 403
Description: Rabbit polyclonal to STAM2
anti-STAM2
YF-PA25523 50 ul
EUR 334
Description: Mouse polyclonal to STAM2
STAM2 Blocking Peptide
AF9203-BP 1mg
EUR 195
STAM2 Conjugated Antibody
C44419 100ul
EUR 397
STAM2 Blocking Peptide
AF7658-BP 1mg
EUR 195
STAM2 cloning plasmid
CSB-CL022793HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1578
  • Sequence: atgcctttgttcaccgccaaccccttcgagcaagacgtggaaaaagccacgaatgagtacaacactacagaagattggagtcttattatggacatatgtgacaaagttggaagtactcctaatggagcgaaagattgcctaaaagccataatgaaaagggtaaatcataaggttc
  • Show more
Description: A cloning plasmid for the STAM2 gene.
STAM2 Polyclonal Antibody
ES3506-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STAM2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
STAM2 Polyclonal Antibody
ES3506-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STAM2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, IF, WB, ELISA
anti- STAM2 antibody
FNab08284 100µg
EUR 548.75
  • Immunogen: signal transducing adaptor molecule(SH3 domain and ITAM motif) 2
  • Uniprot ID: O75886
  • Gene ID: 10254
  • Research Area: Epigenetics, Signal Transduction
Description: Antibody raised against STAM2
STAM2 Polyclonal Antibody
ABP52507-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192
  • Applications tips:
Description: A polyclonal antibody for detection of STAM2 from Human, Mouse. This STAM2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192
STAM2 Polyclonal Antibody
ABP52507-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192
  • Applications tips:
Description: A polyclonal antibody for detection of STAM2 from Human, Mouse. This STAM2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192
STAM2 Polyclonal Antibody
ABP52507-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192
  • Applications tips:
Description: A polyclonal antibody for detection of STAM2 from Human, Mouse. This STAM2 antibody is for WB, IHC-P, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the non-phosphorylation site of Y192
STAM2 Blocking Peptide
20-abx162048
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
STAM2 (pT192) Antibody
20-abx009762
  • EUR 314.00
  • EUR 467.00
  • EUR 203.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
STAM2 Rabbit pAb
A7058-100ul 100 ul
EUR 308
STAM2 Rabbit pAb
A7058-200ul 200 ul
EUR 459
STAM2 Rabbit pAb
A7058-20ul 20 ul
EUR 183
STAM2 Rabbit pAb
A7058-50ul 50 ul
EUR 223
STAM2 antibody (Tyr192)
70R-35162 100 ug
EUR 327
Description: Purified Rabbit polyclonal STAM2 antibody (Tyr192)
Anti-STAM2 antibody
PAab08284 100 ug
EUR 386
Anti-STAM2 antibody
STJ95800 200 µl
EUR 197
Description: Rabbit polyclonal to STAM2.
Anti-STAM2 antibody
STJ70906 100 µg
EUR 359
Anti-STAM2 antibody
STJ29138 100 µl
EUR 277
Description: The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation.
Anti-STAM2 (1A10)
YF-MA11265 100 ug
EUR 363
Description: Mouse monoclonal to STAM2
Polyclonal STAM2 Antibody (Center)
APR03900G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STAM2 (Center). This antibody is tested and proven to work in the following applications:
Mouse STAM2 shRNA Plasmid
20-abx974699
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Rat STAM2 shRNA Plasmid
20-abx989646
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
Phospho-STAM2 (Tyr371) Antibody
AF7158 200ul
EUR 376
Description: Phospho-STAM2 (Tyr371) Antibody detects endogenous levels of STAM2 only when phosphorylated at Tyr371.
STAM2 (pY192) Blocking Peptide
20-abx063533
  • EUR 314.00
  • EUR 509.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.
Human STAM2 shRNA Plasmid
20-abx956941
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
STAM2 (Phospho-Tyr371) Antibody
13021-100ul 100ul
EUR 252
STAM2 (Phospho-Tyr371) Antibody
13021-50ul 50ul
EUR 187
Phospho-STAM2 (Y192) Antibody
1-CSB-PA070192
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-STAM2 (Y192). Recognizes Phospho-STAM2 (Y192) from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000
STAM2 Recombinant Protein (Human)
RP030298 100 ug Ask for price
STAM2 Recombinant Protein (Rat)
RP231314 100 ug Ask for price
STAM2 Recombinant Protein (Mouse)
RP175883 100 ug Ask for price
Polyclonal Goat Anti-STAM2 Antibody
APG00317G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-STAM2 . This antibody is tested and proven to work in the following applications:
STAM2 (Phospho-Tyr371) Conjugated Antibody
C13021 100ul
EUR 397
Phospho-STAM2 (Tyr371) Blocking Peptide
AF7158-BP 1mg
EUR 195
STAM2 (phospho Tyr192) Polyclonal Antibody
ES7923-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against STAM2 (phospho Tyr192) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
STAM2 (phospho Tyr192) Polyclonal Antibody
ES7923-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against STAM2 (phospho Tyr192) from Human/Mouse. This antibody is tested and validated for WB, ELISA, IHC, WB, ELISA
STAM2 (phospho Tyr192) Polyclonal Antibody
ABP56924-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human STAM2 around the phosphorylation site of Y192
  • Applications tips:
Description: A polyclonal antibody for detection of STAM2 phospho Tyr192) from Human, Mouse. This STAM2 phospho Tyr192) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the phosphorylation site of Y192
STAM2 (phospho Tyr192) Polyclonal Antibody
ABP56924-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human STAM2 around the phosphorylation site of Y192
  • Applications tips:
Description: A polyclonal antibody for detection of STAM2 phospho Tyr192) from Human, Mouse. This STAM2 phospho Tyr192) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the phosphorylation site of Y192
STAM2 (phospho Tyr192) Polyclonal Antibody
ABP56924-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from human STAM2 around the phosphorylation site of Y192
  • Applications tips:
Description: A polyclonal antibody for detection of STAM2 phospho Tyr192) from Human, Mouse. This STAM2 phospho Tyr192) antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human STAM2 around the phosphorylation site of Y192
STAM2 (Phospho-Tyr192) Polyclonal Antibody
12250-100ul 100ul
EUR 252
STAM2 (Phospho-Tyr192) Polyclonal Antibody
12250-50ul 50ul
EUR 187
Stam2 ORF Vector (Mouse) (pORF)
ORF058629 1.0 ug DNA
EUR 506
STAM2 ORF Vector (Human) (pORF)
ORF010100 1.0 ug DNA
EUR 95
Stam2 ORF Vector (Rat) (pORF)
ORF077106 1.0 ug DNA
EUR 506
Anti-Phospho-STAM2 (Y192) antibody
STJ90559 200 µl
EUR 197
Description: Rabbit polyclonal to Phospho-STAM2 (Y192).
STAM2 ELISA Kit (Rat) (OKEI00921)
OKEI00921 96 Wells
EUR 767
Description: Description of target: Involved in intracellular signal transduction mediated by cytokines and growth factors. Upon IL-2 and GM-CSL stimulation, it plays a role in signaling leading to DNA synthesis and MYC induction. May also play a role in T-cell development. Involved in down-regulation of receptor tyrosine kinase via multivesicular body (MVBs) when complexed with HGS (ESCRT-0 complex). The ESCRT-0 complex binds ubiquitin and acts as sorting machinery that recognizes ubiquitinated receptors and transfers them to further sequential lysosomal sorting/trafficking processes.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL
STAM2 sgRNA CRISPR Lentivector set (Human)
K2298901 3 x 1.0 ug
EUR 339
Stam2 sgRNA CRISPR Lentivector set (Rat)
K6417601 3 x 1.0 ug
EUR 339
Stam2 sgRNA CRISPR Lentivector set (Mouse)
K3527201 3 x 1.0 ug
EUR 339
Monoclonal STAM2 Antibody (monoclonal) (M01), Clone: 1A10
AMM04142G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human STAM2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1A10. This antibody is applicable in WB, IP, E
Signal Transducing Adaptor Molecule 2 (Stam2) Antibody
20-abx115562
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx131129
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx131130
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx131131
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx145673-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx133339
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx005342
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx027760-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx027760-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx326181
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx321832
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
20-abx218779
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx432003-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Signal Transducing Adaptor Molecule 2 (STAM2) Antibody
abx238284-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
STAM2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2298902 1.0 ug DNA
EUR 154