In den Nachrichten

STX17

STX17 antibody
70R-20622 50 ul
EUR 435.00
Description: Rabbit polyclonal STX17 antibody
STX17 Antibody
1-CSB-PA022892GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against STX17. Recognizes STX17 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
STX17 siRNA
20-abx905350
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
STX17 siRNA
20-abx935565
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
STX17 siRNA
20-abx935566
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
STX17 cloning plasmid
CSB-CL022892HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 432
  • Sequence: atgtctgaagatgaagaaaaagtgaaattacgccgtcttgaaccagctatccagaaattcattaagatagtaatcccaacagacctggaaaggttaagaaagcaccagataaatattgagaagtatcaaaggtgcagaatctgggacaagttgcatgaagagcatatcaatgcagg
  • Show more
Description: A cloning plasmid for the STX17 gene.
STX17 protein (His tag)
80R-3050 50 ug
EUR 327.00
Description: Purified recombinant STX17 protein (His tag)
Syntaxin-17 (STX17) Antibody
abx027493-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Syntaxin-17 (STX17) Antibody
abx027493-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Syntaxin 17 (STX17) Antibody
20-abx116927
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Rat STX17 shRNA Plasmid
20-abx988010
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse STX17 shRNA Plasmid
20-abx976288
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human STX17 shRNA Plasmid
20-abx960406
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
STX17 Recombinant Protein (Rat)
RP231581 100 ug Ask for price
STX17 Recombinant Protein (Human)
RP030520 100 ug Ask for price
STX17 Recombinant Protein (Mouse)
RP176243 100 ug Ask for price
Polyclonal STX17 Antibody (N-term)
APR14412G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STX17 (N-term). This antibody is tested and proven to work in the following applications:
Stx17 ORF Vector (Rat) (pORF)
ORF077195 1.0 ug DNA
EUR 506.00
STX17 ORF Vector (Human) (pORF)
ORF010174 1.0 ug DNA
EUR 95.00
Stx17 ORF Vector (Mouse) (pORF)
ORF058749 1.0 ug DNA
EUR 506.00
Human Syntaxin 17 (STX17)ELISA Kit
201-12-2584 96 tests
EUR 440.00
  • This Syntaxin 17 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.
Bovine Syntaxin- 17, STX17 ELISA KIT
ELI-29926b 96 Tests
EUR 928.00
Human Syntaxin- 17, STX17 ELISA KIT
ELI-53370h 96 Tests
EUR 824.00
Mouse Syntaxin- 17, Stx17 ELISA KIT
ELI-41623m 96 Tests
EUR 865.00
Stx17 sgRNA CRISPR Lentivector set (Rat)
K7271101 3 x 1.0 ug
EUR 339.00
Stx17 sgRNA CRISPR Lentivector set (Mouse)
K3536201 3 x 1.0 ug
EUR 339.00
STX17 sgRNA CRISPR Lentivector set (Human)
K2309401 3 x 1.0 ug
EUR 339.00
STX17 Syntaxin-17 Human Recombinant Protein
PROTP56962 Regular: 10ug
EUR 317.00
Description: STX17 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 252 amino acids (1-229) and having a molecular mass of 28.6kDa.;STX17 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Syntaxin 17(STX17)ELISA Kit
QY-E01175 96T
EUR 361.00
Stx17 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7271102 1.0 ug DNA
EUR 154.00
Stx17 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7271103 1.0 ug DNA
EUR 154.00
Stx17 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7271104 1.0 ug DNA
EUR 154.00
Stx17 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3536202 1.0 ug DNA
EUR 154.00
Stx17 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3536203 1.0 ug DNA
EUR 154.00
Stx17 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3536204 1.0 ug DNA
EUR 154.00
STX17 sgRNA CRISPR Lentivector (Human) (Target 1)
K2309402 1.0 ug DNA
EUR 154.00
STX17 sgRNA CRISPR Lentivector (Human) (Target 2)
K2309403 1.0 ug DNA
EUR 154.00
STX17 sgRNA CRISPR Lentivector (Human) (Target 3)
K2309404 1.0 ug DNA
EUR 154.00
STX17 Protein Vector (Rat) (pPB-C-His)
PV308778 500 ng
EUR 603.00
STX17 Protein Vector (Rat) (pPB-N-His)
PV308779 500 ng
EUR 603.00
STX17 Protein Vector (Rat) (pPM-C-HA)
PV308780 500 ng
EUR 603.00
STX17 Protein Vector (Rat) (pPM-C-His)
PV308781 500 ng
EUR 603.00
STX17 Protein Vector (Human) (pPB-C-His)
PV040693 500 ng
EUR 329.00
STX17 Protein Vector (Human) (pPB-N-His)
PV040694 500 ng
EUR 329.00
STX17 Protein Vector (Human) (pPM-C-HA)
PV040695 500 ng
EUR 329.00
STX17 Protein Vector (Human) (pPM-C-His)
PV040696 500 ng
EUR 329.00
STX17 Protein Vector (Mouse) (pPB-C-His)
PV234994 500 ng
EUR 603.00
STX17 Protein Vector (Mouse) (pPB-N-His)
PV234995 500 ng
EUR 603.00
STX17 Protein Vector (Mouse) (pPM-C-HA)
PV234996 500 ng
EUR 603.00
STX17 Protein Vector (Mouse) (pPM-C-His)
PV234997 500 ng
EUR 603.00
Recombinant Human STX17 Protein, His, E.coli-10ug
QP13631-10ug 10ug
EUR 201.00
Recombinant Human STX17 Protein, His, E.coli-1mg
QP13631-1mg 1mg
EUR 5251.00
Recombinant Human STX17 Protein, His, E.coli-2ug
QP13631-2ug 2ug
EUR 155.00
Stx17 3'UTR Luciferase Stable Cell Line
TU119891 1.0 ml Ask for price
Stx17 3'UTR GFP Stable Cell Line
TU169891 1.0 ml Ask for price
Stx17 3'UTR Luciferase Stable Cell Line
TU221356 1.0 ml Ask for price
STX17 3'UTR GFP Stable Cell Line
TU074877 1.0 ml
EUR 1521.00
Stx17 3'UTR GFP Stable Cell Line
TU271356 1.0 ml Ask for price
STX17 3'UTR Luciferase Stable Cell Line
TU024877 1.0 ml
EUR 1521.00
STX17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV691837 1.0 ug DNA
EUR 514.00
STX17 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV691841 1.0 ug DNA
EUR 514.00
STX17 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV691842 1.0 ug DNA
EUR 514.00
Stx17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7271105 3 x 1.0 ug
EUR 376.00
Stx17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3536205 3 x 1.0 ug
EUR 376.00
STX17 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2309405 3 x 1.0 ug
EUR 376.00
STX17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV691838 1.0 ug DNA
EUR 514.00
STX17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV691839 1.0 ug DNA
EUR 572.00
STX17 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV691840 1.0 ug DNA
EUR 572.00
Stx17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7271106 1.0 ug DNA
EUR 167.00
Stx17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7271107 1.0 ug DNA
EUR 167.00
Stx17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7271108 1.0 ug DNA
EUR 167.00
Stx17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3536206 1.0 ug DNA
EUR 167.00
Stx17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3536207 1.0 ug DNA
EUR 167.00
Stx17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3536208 1.0 ug DNA
EUR 167.00
STX17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K2309406 1.0 ug DNA
EUR 167.00
STX17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K2309407 1.0 ug DNA
EUR 167.00
STX17 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K2309408 1.0 ug DNA
EUR 167.00