Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
DLR-SUMF1-Hu-96T 96T
EUR 673
  • Should the Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sulfatase Modifying Factor 1 (SUMF1) in samples from tissue homogenates or other biological fluids.
Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
RD-SUMF1-Hu-48Tests 48 Tests
EUR 521
Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
RD-SUMF1-Hu-96Tests 96 Tests
EUR 723
Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
RDR-SUMF1-Hu-48Tests 48 Tests
EUR 544
Human Sulfatase Modifying Factor 1 (SUMF1) ELISA Kit
RDR-SUMF1-Hu-96Tests 96 Tests
EUR 756
SUMF1 siRNA
20-abx935660
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
SUMF1 siRNA
20-abx935661
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
anti- SUMF1 antibody
FNab08387 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: sulfatase modifying factor 1
  • Uniprot ID: Q8NBK3
  • Gene ID: 285362
  • Research Area: Metabolism
Description: Antibody raised against SUMF1
SUMF1 Rabbit pAb
A14304-100ul 100 ul
EUR 308
SUMF1 Rabbit pAb
A14304-200ul 200 ul
EUR 459
SUMF1 Rabbit pAb
A14304-20ul 20 ul
EUR 183
SUMF1 Rabbit pAb
A14304-50ul 50 ul
EUR 223
SUMF1 Rabbit pAb
A14463-100ul 100 ul
EUR 308
SUMF1 Rabbit pAb
A14463-200ul 200 ul
EUR 459
SUMF1 Rabbit pAb
A14463-20ul 20 ul
EUR 183
SUMF1 Rabbit pAb
A14463-50ul 50 ul
EUR 223
SUMF1 Polyclonal Antibody
28595-100ul 100ul
EUR 252
SUMF1 Polyclonal Antibody
28595-50ul 50ul
EUR 187
SUMF1 Polyclonal Antibody
28494-100ul 100ul
EUR 252
SUMF1 Polyclonal Antibody
28494-50ul 50ul
EUR 187
SUMF1 cloning plasmid
CSB-CL822751HU-10ug 10ug
EUR 425
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1125
  • Sequence: ATGGCTGCGCCCGCACTAGGGCTGGTGTGTGGACGTTGCCCTGAGCTGGGTCTCGTCCTCTTGCTGCTGCTGCTCTCGCTGCTGTGTGGAGCGGCAGGGAGCCAGGAGGCCGGGACCGGTGCGGGCGCGGGGTCCCTTGCGGGTTCTTGCGGCTGCGGCACGCCCCAGCGGCCTG
  • Show more
Description: A cloning plasmid for the SUMF1 gene.
Anti-SUMF1 antibody
PAab08387 100 ug
EUR 386
Anti-SUMF1 antibody
STJ72015 100 µg
EUR 359
Anti-SUMF1 antibody
STJ116516 100 µl
EUR 277
Description: This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants.
Anti-SUMF1 antibody
STJ116673 100 µl
EUR 277
Description: This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants.
SUMF1 Polyclonal Conjugated Antibody
C28494 100ul
EUR 397
SUMF1 Polyclonal Conjugated Antibody
C28595 100ul
EUR 397
Mouse SUMF1 shRNA Plasmid
20-abx975123
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SUMF1 ELISA KIT|Human
EF003357 96 Tests
EUR 689
SUMF1 protein (His tag)
80R-2043 50 ug
EUR 349
Description: Recombinant human SUMF1 protein (His tag)
Human SUMF1 shRNA Plasmid
20-abx967090
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.
SUMF1 Recombinant Protein (Human)
RP043855 100 ug Ask for price
SUMF1 Recombinant Protein (Rat)
RP231719 100 ug Ask for price
SUMF1 Recombinant Protein (Mouse)
RP176441 100 ug Ask for price
Polyclonal Goat Anti-SUMF1 Antibody
APR16405G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-SUMF1 . This antibody is tested and proven to work in the following applications:
Sumf1 ORF Vector (Mouse) (pORF)
ORF058815 1.0 ug DNA
EUR 506
Sumf1 ORF Vector (Rat) (pORF)
ORF077241 1.0 ug DNA
EUR 506
SUMF1 ORF Vector (Human) (pORF)
ORF014619 1.0 ug DNA
EUR 354
SUMF1 ELISA Kit (Human) (OKCD00356)
OKCD00356 96 Wells
EUR 831
Description: Description of target: Using molecular oxygen and an unidentified reducing agent, oxidizes a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also called C(alpha)-formylglycine. Known substrates include GALNS, ARSA, STS and ARSE.2 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.2"The multiple sulfatase deficiency gene encodes an essential and limiting factor for the activity of sulfatases."_x005F_x005F_x000D_Cosma M.P., Pepe S., Annunziata I., Newbold R.F., Grompe M., Parenti G., Ballabio A._x005F_x005F_x000D_Cell 113:445-456(2003) [PubMed] [Europe PMC] [Abstract]Cited for: NUCLEOTIDE SEQUENCE [MRNA] (ISOFORM 1), VARIANTS MSD PRO-155; TYR-218; ARG-336; CYS-345; PRO-348; GLN-349 AND TRP-349, FUNCTION.Ref.11"Molecular characterization of the human Calpha-formylglycine-generating enzyme."_x005F_x005F_x000D_Preusser-Kunze A., Mariappan M., Schmidt B., Gande S.L., Mutenda K., Wenzel D., von Figura K., Dierks T._x005F_x005F_x000D_J. Biol. Chem. 280:14900-14910(2005) [PubMed] [Europe PMC] [Abstract]Cited for: PROTEIN SEQUENCE OF N-TERMINUS, FUNCTION, IDENTIFICATION BY MASS SPECTROMETRY, CALCIUM-BINDING, GLYCOSYLATION AT ASN-141, SUBCELLULAR LOCATION, DISULFIDE BONDS. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.064 ng/mL
SUMF1 ELISA Kit (Human) (OKDD00549)
OKDD00549 96 Wells
EUR 975
Description: Description of target: This gene encodes an enzyme that catalyzes the hydrolysis of sulfate esters by oxidizing a cysteine residue in the substrate sulfatase to an active site 3-oxoalanine residue, which is also known as C-alpha-formylglycine. Mutations in this gene cause multiple sulfatase deficiency, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL
Polyclonal SUMF1 antibody - C-terminal region
AMM08062G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMF1 - C-terminal region. This antibody is tested and proven to work in the following applications:
Sulfatase Modifying Factor 1 (SUMF1) Antibody
abx145717-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.
Sulfatase Modifying Factor 1 (SUMF1) Antibody
20-abx103071
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.
Sulfatase Modifying Factor 1 (SUMF1) Antibody
20-abx174657
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.
Sulfatase Modifying Factor 1 (SUMF1) Antibody
abx432038-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.
Sulfatase Modifying Factor 1 (SUMF1) Antibody
abx238387-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.
SUMF1 sgRNA CRISPR Lentivector set (Human)
K2313601 3 x 1.0 ug
EUR 339
Sumf1 sgRNA CRISPR Lentivector set (Mouse)
K4007201 3 x 1.0 ug
EUR 339
Sumf1 sgRNA CRISPR Lentivector set (Rat)
K6725601 3 x 1.0 ug
EUR 339
Recombinant Sulfatase Modifying Factor 1 (SUMF1)
4-RPC879Hu01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8NBK3
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.0kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Sulfatase Modifying Factor 1 expressed in: E.coli
Human Sulfatase Modifying Factor 1 (SUMF1) Protein
20-abx069186
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
SUMF1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2313602 1.0 ug DNA
EUR 154
SUMF1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2313603 1.0 ug DNA
EUR 154
SUMF1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2313604 1.0 ug DNA
EUR 154
Sumf1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4007202 1.0 ug DNA
EUR 154
Sumf1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4007203 1.0 ug DNA
EUR 154
Sumf1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4007204 1.0 ug DNA
EUR 154
Sumf1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6725602 1.0 ug DNA
EUR 154
Sumf1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6725603 1.0 ug DNA
EUR 154
Sumf1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6725604 1.0 ug DNA
EUR 154
SUMF1 Protein Vector (Human) (pPB-C-His)
PV058473 500 ng
EUR 481
SUMF1 Protein Vector (Human) (pPB-N-His)
PV058474 500 ng
EUR 481
SUMF1 Protein Vector (Human) (pPM-C-HA)
PV058475 500 ng
EUR 481
SUMF1 Protein Vector (Human) (pPM-C-His)
PV058476 500 ng
EUR 481
Recombinant Human SUMF1 Protein, His, E.coli-10ug
QP13647-10ug 10ug
EUR 201
Recombinant Human SUMF1 Protein, His, E.coli-1mg
QP13647-1mg 1mg
EUR 5251
Recombinant Human SUMF1 Protein, His, E.coli-2ug
QP13647-2ug 2ug
EUR 155
SUMF1 Protein Vector (Rat) (pPB-C-His)
PV308962 500 ng
EUR 603
SUMF1 Protein Vector (Rat) (pPB-N-His)
PV308963 500 ng
EUR 603
SUMF1 Protein Vector (Rat) (pPM-C-HA)
PV308964 500 ng
EUR 603
SUMF1 Protein Vector (Rat) (pPM-C-His)
PV308965 500 ng
EUR 603
SUMF1 Protein Vector (Mouse) (pPB-C-His)
PV235258 500 ng
EUR 603
SUMF1 Protein Vector (Mouse) (pPB-N-His)
PV235259 500 ng
EUR 603
SUMF1 Protein Vector (Mouse) (pPM-C-HA)
PV235260 500 ng
EUR 603
SUMF1 Protein Vector (Mouse) (pPM-C-His)
PV235261 500 ng
EUR 603