In den Nachrichten

OTOA

OTOA siRNA

20-abx927444
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

OTOA cloning plasmid

CSB-CL017271HU-10ug 10ug
EUR 1214.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3420
  • Sequence: ATGTCTCAGGAACCTACGACATACTCCCTTTTCCTATTCCTTTTTCTGAGCCATGGAGTGTCGAGTTATACAGTGCCAAATTCCAGGCAGGATTTGCATCCATTGTTGCAAAACATGGCGGAAGAAATAATAGATGGAAGCTATCTGAATGCACTGCTGGATCTCATACAGTTTC
  • Show more
Description: A cloning plasmid for the OTOA gene.

Otoancorin (OTOA) Antibody

abx026120-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Otoancorin (OTOA) Antibody

abx026120-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Mouse OTOA shRNA Plasmid

20-abx982809
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human OTOA shRNA Plasmid

20-abx965458
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Polyclonal OTOA Antibody (N-term)

APR14234G 0.1ml
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OTOA (N-term). This antibody is tested and proven to work in the following applications:

Mouse Otoancorin, Otoa ELISA KIT

ELI-37019m 96 Tests
EUR 865.00

Human Otoancorin, OTOA ELISA KIT

ELI-37638h 96 Tests
EUR 824.00

OTOA ORF Vector (Human) (pORF)

ORF013986 1.0 ug DNA
EUR 354.00

Otoa ORF Vector (Mouse) (pORF)

ORF053199 1.0 ug DNA
EUR 506.00

Human Otoancorin(OTOA)ELISA Kit

QY-E04722 96T
EUR 394.00

OTOA sgRNA CRISPR Lentivector set (Human)

K1576301 3 x 1.0 ug
EUR 339.00

Otoa sgRNA CRISPR Lentivector set (Mouse)

K3588401 3 x 1.0 ug
EUR 339.00

OTOA sgRNA CRISPR Lentivector (Human) (Target 1)

K1576302 1.0 ug DNA
EUR 154.00

OTOA sgRNA CRISPR Lentivector (Human) (Target 2)

K1576303 1.0 ug DNA
EUR 154.00

OTOA sgRNA CRISPR Lentivector (Human) (Target 3)

K1576304 1.0 ug DNA
EUR 154.00

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3588402 1.0 ug DNA
EUR 154.00

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3588403 1.0 ug DNA
EUR 154.00

Otoa sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3588404 1.0 ug DNA
EUR 154.00

OTOA Protein Vector (Human) (pPB-C-His)

PV055941 500 ng
EUR 481.00

OTOA Protein Vector (Human) (pPB-N-His)

PV055942 500 ng
EUR 481.00

OTOA Protein Vector (Human) (pPM-C-HA)

PV055943 500 ng
EUR 481.00

OTOA Protein Vector (Human) (pPM-C-His)

PV055944 500 ng
EUR 481.00

OTOA Protein Vector (Mouse) (pPB-C-His)

PV212794 500 ng
EUR 1065.00

OTOA Protein Vector (Mouse) (pPB-N-His)

PV212795 500 ng
EUR 1065.00

OTOA Protein Vector (Mouse) (pPM-C-HA)

PV212796 500 ng
EUR 1065.00

OTOA Protein Vector (Mouse) (pPM-C-His)

PV212797 500 ng
EUR 1065.00

Otoa 3'UTR GFP Stable Cell Line

TU165764 1.0 ml Ask for price

OTOA 3'UTR Luciferase Stable Cell Line

TU017194 1.0 ml
EUR 1394.00

Otoa 3'UTR Luciferase Stable Cell Line

TU115764 1.0 ml Ask for price

OTOA 3'UTR GFP Stable Cell Line

TU067194 1.0 ml
EUR 1394.00

Otoa 3'UTR GFP Stable Cell Line

TU265684 1.0 ml Ask for price

Otoa 3'UTR Luciferase Stable Cell Line

TU215684 1.0 ml Ask for price

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1576305 3 x 1.0 ug
EUR 376.00

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3588405 3 x 1.0 ug
EUR 376.00

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1576306 1.0 ug DNA
EUR 167.00

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1576307 1.0 ug DNA
EUR 167.00

OTOA sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1576308 1.0 ug DNA
EUR 167.00

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3588406 1.0 ug DNA
EUR 167.00

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3588407 1.0 ug DNA
EUR 167.00

Otoa sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3588408 1.0 ug DNA
EUR 167.00