HLADRF34PE-50T 50 test
EUR 323.00


HLADRF3PE1-50T 50 test
EUR 350.30


HLADRF8PE1-50T 50 test
EUR 350.30

IC IgG1/IgG1/ CD45

ICIGG1FPE45PP1-50T 50 test
EUR 479.00


8F138PE-50T 50 test
EUR 350.30


8F14PE1-50T 50 test
EUR 350.30


8F156PE-50T 50 test
EUR 350.30


3F11656PE-50T 50 test
EUR 350.30


3F11656PE45PC319A3-50T 50 test
EUR 850.80


3F11656PE45PP1-50T 50 test
EUR 479.00


3F119PE1-50T 50 test
EUR 350.30


3F119PE145PP1-50T 50 test
EUR 479.00


3F14PE1-50T 50 test
EUR 350.30


3F14PE145PC3-50T 50 test
EUR 564.80


3F14PE45PP1-50T 50 test
EUR 479.00


3F18PE1-50T 50 test
EUR 350.30


3F18PE145PC34A2-50T 50 test
EUR 707.80


3F18PE145PP1-50T 50 test
EUR 521.90


3F18PE145PP14A3-50T 50 test
EUR 609.00


4F18PE1-50T 50 test
EUR 350.30


4F18PE13PC2-50T 50 test
EUR 550.50


4F45RAPE2-50T 50 test
EUR 521.90


4F8PE13PP1-50T 50 test
EUR 521.90


45F114PE-50T 50 test
EUR 350.30


45RAF245ROPE3PP14A1-50T 50 test
EUR 609.00


45RAF245ROPE3PP18A3-50T 50 test
EUR 609.00


45RAF24PE1-50T 50 test
EUR 364.60


45RAF262LPE3PP14A1-50T 50 test
EUR 609.00


45RAF262LPE3PP18A3-50T 50 test
EUR 609.00

CD103/ CD22/ CD20

103F22PE20PP2-50T 50 test
EUR 700.00

CD157/ CD45/ CD64 (HPN)

157PE45PP264A-50T 50 test
EUR 953.50


15F117PE-50T 50 test
EUR 362.00


15F34PE-50T 50 test
EUR 436.10


16F256PE-50T 50 test
EUR 350.30


1KF3LPE2-50T 50 test
EUR 672.05


5F19PE1-50T 50 test
EUR 350.30


5F20PE2-50T 50 test
EUR 350.30


MPOF22PE-50T 50 test
EUR 436.10


KAPPAF219PE1-50T 50 test
EUR 350.30


EUR 414.00


EUR 784.50


KF319PE4-50T 50 test
EUR 466.00


LAMBDAF19PE1-50T 50 test
EUR 350.30


LF219PE4-50T 50 test
EUR 466.00


LF2KPE3-50T 50 test
EUR 615.50

StepCount Kit1

STPKIT1-50T 50 test
EUR 854.70

StepCount Kit2

STPKIT2-50T 50 test
EUR 999.00

StepCount Kit4

STPKIT4-50T 50 test
EUR 713.00


TDTF-50T 100 test
EUR 1220.00


TRAPPC2 antibody
70R-20965 50 ul
EUR 435.00
Description: Rabbit polyclonal TRAPPC2 antibody
TRAPPC2 Antibody
45223-100ul 100ul
EUR 252.00
TRAPPC2 Antibody
45223-50ul 50ul
EUR 187.00
TRAPPC2 Antibody
DF8137 200ul
EUR 304.00
Description: TRAPPC2 Antibody detects endogenous levels of total TRAPPC2.
TRAPPC2 antibody
70R-8937 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal TRAPPC2 antibody
TRAPPC2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAPPC2. Recognizes TRAPPC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TRAPPC2 Antibody
ABD8137 100 ug
EUR 438.00
TRAPPC2 Rabbit pAb
A10465-100ul 100 ul
EUR 308.00
TRAPPC2 Rabbit pAb
A10465-200ul 200 ul
EUR 459.00
TRAPPC2 Rabbit pAb
A10465-20ul 20 ul
EUR 183.00
TRAPPC2 Rabbit pAb
A10465-50ul 50 ul
EUR 223.00
TRAPPC2 Blocking Peptide
33R-8115 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAPPC2 antibody, catalog no. 70R-8937
TRAPPC2 Blocking Peptide
DF8137-BP 1mg
EUR 195.00
TRAPPC2 Conjugated Antibody
C45223 100ul
EUR 397.00
TRAPPC2 Rabbit pAb
A4107-100ul 100 ul
EUR 308.00
TRAPPC2 Rabbit pAb
A4107-200ul 200 ul
EUR 459.00
TRAPPC2 Rabbit pAb
A4107-20ul 20 ul Ask for price
TRAPPC2 Rabbit pAb
A4107-50ul 50 ul Ask for price
anti- TRAPPC2 antibody
FNab08945 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:5000
  • IP: 1:200-1:2000
  • Immunogen: trafficking protein particle complex 2
  • Uniprot ID: P0DI81
  • Gene ID: 6399
  • Research Area: Signal Transduction
Description: Antibody raised against TRAPPC2
Anti-TRAPPC2 antibody
PAab08945 100 ug
EUR 386.00
Anti-TRAPPC2 antibody
STJ25959 100 µl
EUR 277.00
Description: The protein encoded by this gene is thought to be part of a large multi-subunit complex involved in the targeting and fusion of endoplasmic reticulum-to-Golgi transport vesicles with their acceptor compartment. In addition, the encoded protein can bind c-myc promoter-binding protein 1 and block its transcriptional repression capability. Mutations in this gene are a cause of spondyloepiphyseal dysplasia tarda (SEDT). A processed pseudogene of this gene is located on chromosome 19, and other pseudogenes are found on chromosomes 8 and Y. Alternatively spliced transcript variants have been found for this gene.
Anti-TRAPPC2 antibody
STJ112494 100 µl
EUR 277.00
Description: The protein encoded by this gene is thought to be part of a large multi-subunit complex involved in the targeting and fusion of endoplasmic reticulum-to-Golgi transport vesicles with their acceptor compartment. In addition, the encoded protein can bind c-myc promoter-binding protein 1 and block its transcriptional repression capability. Mutations in this gene are a cause of spondyloepiphyseal dysplasia tarda (SEDT). A processed pseudogene of this gene is located on chromosome 19, and other pseudogenes are found on chromosomes 8 and Y. Alternatively spliced transcript variants have been found for this gene.
Anti-TRAPPC2 (2E10)
YF-MA15386 100 ug
EUR 363.00
Description: Mouse monoclonal to TRAPPC2
TRAPPC2 protein (His tag)
80R-2573 20 ug
EUR 322.00
Description: Purified recombinant TRAPPC2 protein
Mouse Trappc2 ELISA KIT
ELI-23063m 96 Tests
EUR 865.00
ELI-28452b 96 Tests
EUR 928.00
ELI-28866h 96 Tests
EUR 824.00
EF003798 96 Tests
EUR 689.00
ELI-51133d 96 Tests
EUR 928.00
Rat TRAPPC2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse TRAPPC2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human TRAPPC2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
ELI-40086c 96 Tests
EUR 928.00
TRAPPC2 Recombinant Protein (Rat)
RP234548 100 ug Ask for price
TRAPPC2 Recombinant Protein (Human)
RP102842 100 ug Ask for price
TRAPPC2 Recombinant Protein (Mouse)
RP180908 100 ug Ask for price
Polyclonal TRAPPC2 Antibody (N-term)
AMM08327G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAPPC2 (N-term). This antibody is tested and proven to work in the following applications:
Polyclonal TRAPPC2 antibody - middle region
AMM08328G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAPPC2 - middle region. This antibody is tested and proven to work in the following applications:
Trappc2 ORF Vector (Rat) (pORF)
ORF078184 1.0 ug DNA
EUR 506.00
TRAPPC2 ORF Vector (Human) (pORF)
ORF034282 1.0 ug DNA
EUR 405.00
Trappc2 ORF Vector (Mouse) (pORF)
ORF060304 1.0 ug DNA
EUR 506.00
Trappc2 sgRNA CRISPR Lentivector set (Rat)
K7508001 3 x 1.0 ug
EUR 339.00
TRAPPC2 sgRNA CRISPR Lentivector set (Human)
K2440601 3 x 1.0 ug
EUR 339.00
Trappc2 sgRNA CRISPR Lentivector set (Mouse)
K4073201 3 x 1.0 ug
EUR 339.00
Monoclonal TRAPPC2 Antibody (monoclonal) (M01), Clone: 2E11
AMM08326G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human TRAPPC2 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2E11. This antibody is applicable in WB, E
Trafficking Protein Particle Complex 2 (TRAPPC2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex 2 (TRAPPC2) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Trappc2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7508002 1.0 ug DNA
EUR 154.00
Trappc2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7508003 1.0 ug DNA
EUR 154.00
Trappc2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7508004 1.0 ug DNA
EUR 154.00
TRAPPC2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2440602 1.0 ug DNA
EUR 154.00
TRAPPC2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2440603 1.0 ug DNA
EUR 154.00
TRAPPC2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2440604 1.0 ug DNA
EUR 154.00
Trappc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4073202 1.0 ug DNA
EUR 154.00
Trappc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4073203 1.0 ug DNA
EUR 154.00
Trappc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4073204 1.0 ug DNA
EUR 154.00
TRAPPC2 Protein Vector (Human) (pPB-C-His)
PV137126 500 ng
EUR 552.00
TRAPPC2 Protein Vector (Human) (pPB-N-His)
PV137127 500 ng
EUR 552.00
TRAPPC2 Protein Vector (Human) (pPM-C-HA)
PV137128 500 ng
EUR 552.00
TRAPPC2 Protein Vector (Human) (pPM-C-His)
PV137129 500 ng
EUR 552.00
TRAPPC2 Protein Vector (Rat) (pPB-C-His)
PV312734 500 ng
EUR 603.00
TRAPPC2 Protein Vector (Rat) (pPB-N-His)
PV312735 500 ng
EUR 603.00
TRAPPC2 Protein Vector (Rat) (pPM-C-HA)
PV312736 500 ng
EUR 603.00
TRAPPC2 Protein Vector (Rat) (pPM-C-His)
PV312737 500 ng
EUR 603.00
TRAPPC2 Protein Vector (Mouse) (pPB-C-His)
PV241214 500 ng
EUR 603.00
TRAPPC2 Protein Vector (Mouse) (pPB-N-His)
PV241215 500 ng
EUR 603.00
TRAPPC2 Protein Vector (Mouse) (pPM-C-HA)
PV241216 500 ng
EUR 603.00
TRAPPC2 Protein Vector (Mouse) (pPM-C-His)
PV241217 500 ng
EUR 603.00
Recombinant Trafficking Protein Particle Complex 2 (TRAPPC2)
  • EUR 401.06
  • EUR 210.00
  • EUR 1228.96
  • EUR 476.32
  • EUR 852.64
  • EUR 331.00
  • EUR 2922.40
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P0DI81
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 20.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Trafficking Protein Particle Complex 2 expressed in: E.coli
Recombinant Human TRAPPC2 Protein, His, E.coli-100ug
QP13803-100ug 100ug
EUR 1261.00
Recombinant Human TRAPPC2 Protein, His, E.coli-10ug
QP13803-10ug 10ug
EUR 201.00
Recombinant Human TRAPPC2 Protein, His, E.coli-2ug
QP13803-2ug 2ug
EUR 155.00


TRAPPC4 antibody
70R-20967 50 ul
EUR 435.00
Description: Rabbit polyclonal TRAPPC4 antibody
TRAPPC4 Antibody
42979-100ul 100ul
EUR 252.00
TRAPPC4 antibody
70R-5260 50 ug
EUR 467.00
Description: Rabbit polyclonal TRAPPC4 antibody raised against the middle region of TRAPPC4
TRAPPC4 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TRAPPC4. Recognizes TRAPPC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
PVT11466 2 ug
EUR 273.00
YF-PA19029 50 ul
EUR 363.00
Description: Mouse polyclonal to TRAPPC4
TRAPPC4 Blocking Peptide
33R-2512 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TRAPPC4 antibody, catalog no. 70R-5260
TRAPPC4 cloning plasmid
CSB-CL897085HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 660
  • Sequence: atggcgatttttagtgtgtatgtggtgaacaaagctggcggcttgatttaccagttggacagctacgcgccacgggctgaggctgagaaaactttcagttatccgctggatctgctgctcaagctacacgatgagcgtgtgttggttgctttcggccagcgggacggcatccgagt
  • Show more
Description: A cloning plasmid for the TRAPPC4 gene.
TRAPPC4 Conjugated Antibody
C42979 100ul
EUR 397.00
anti- TRAPPC4 antibody
FNab08948 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: trafficking protein particle complex 4
  • Uniprot ID: Q9Y296
  • Gene ID: 51399
  • Research Area: Neuroscience
Description: Antibody raised against TRAPPC4
Anti-TRAPPC4 antibody
PAab08948 100 ug
EUR 386.00
Anti-TRAPPC4 (2D10)
YF-MA11509 100 ug
EUR 363.00
Description: Mouse monoclonal to TRAPPC4
Anti-TRAPPC4 (2D5)
YF-MA18497 100 ug
EUR 363.00
Description: Mouse monoclonal to TRAPPC4
TRAPPC4 protein (His tag)
80R-2572 20 ug
EUR 322.00
Description: Purified recombinant TRAPPC4 protein
EF003801 96 Tests
EUR 689.00
Rat TRAPPC4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse TRAPPC4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human TRAPPC4 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse Trappc4 ELISA KIT
ELI-39922m 96 Tests
EUR 865.00
ELI-40154b 96 Tests
EUR 928.00
ELI-36676h 96 Tests
EUR 824.00
TRAPPC4 Recombinant Protein (Rat)
RP234557 100 ug Ask for price
TRAPPC4 Recombinant Protein (Human)
RP032809 100 ug Ask for price
TRAPPC4 Recombinant Protein (Mouse)
RP180917 100 ug Ask for price
Polyclonal TRAPPC4 Antibody (N-term)
AMM08314G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TRAPPC4 (N-term). This antibody is tested and proven to work in the following applications:
Trappc4 ORF Vector (Rat) (pORF)
ORF078187 1.0 ug DNA
EUR 506.00
TRAPPC4 ORF Vector (Human) (pORF)
ORF010937 1.0 ug DNA
EUR 95.00
Trappc4 ORF Vector (Mouse) (pORF)
ORF060307 1.0 ug DNA
EUR 506.00
Trappc4 sgRNA CRISPR Lentivector set (Mouse)
K5004501 3 x 1.0 ug
EUR 339.00
Trappc4 sgRNA CRISPR Lentivector set (Rat)
K7335901 3 x 1.0 ug
EUR 339.00
TRAPPC4 sgRNA CRISPR Lentivector set (Human)
K2441601 3 x 1.0 ug
EUR 339.00
Monoclonal TRAPPC4 Antibody (monoclonal) (M01), Clone: 2D10
AMM08313G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human TRAPPC4 (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 2D10. This antibody is applicable in WB and IF, E
Trafficking Protein Particle Complex 4 (TRAPPC4) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K5004502 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K5004503 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K5004504 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7335902 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7335903 1.0 ug DNA
EUR 154.00
Trappc4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7335904 1.0 ug DNA
EUR 154.00
TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 1)
K2441602 1.0 ug DNA
EUR 154.00
TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 2)
K2441603 1.0 ug DNA
EUR 154.00
TRAPPC4 sgRNA CRISPR Lentivector (Human) (Target 3)
K2441604 1.0 ug DNA
EUR 154.00
TRAPPC4 Protein Vector (Rat) (pPB-C-His)
PV312746 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Rat) (pPB-N-His)
PV312747 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Rat) (pPM-C-HA)
PV312748 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Rat) (pPM-C-His)
PV312749 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Mouse) (pPB-C-His)
PV241226 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Mouse) (pPB-N-His)
PV241227 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Mouse) (pPM-C-HA)
PV241228 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Mouse) (pPM-C-His)
PV241229 500 ng
EUR 603.00
TRAPPC4 Protein Vector (Human) (pPB-C-His)
PV043745 500 ng
EUR 329.00
TRAPPC4 Protein Vector (Human) (pPB-N-His)
PV043746 500 ng
EUR 329.00
TRAPPC4 Protein Vector (Human) (pPM-C-HA)
PV043747 500 ng
EUR 329.00
TRAPPC4 Protein Vector (Human) (pPM-C-His)
PV043748 500 ng
EUR 329.00
Recombinant Human TRAPPC4 Protein, His, E.coli-100ug
QP13806-100ug 100ug
EUR 1261.00
Recombinant Human TRAPPC4 Protein, His, E.coli-10ug
QP13806-10ug 10ug
EUR 201.00
Recombinant Human TRAPPC4 Protein, His, E.coli-2ug
QP13806-2ug 2ug
EUR 155.00
Trappc4 3'UTR Luciferase Stable Cell Line
TU121042 1.0 ml Ask for price
Trappc4 3'UTR GFP Stable Cell Line
TU171042 1.0 ml Ask for price
Trappc4 3'UTR Luciferase Stable Cell Line
TU222394 1.0 ml Ask for price
TRAPPC4 3'UTR GFP Stable Cell Line
TU076300 1.0 ml
EUR 1394.00
TRAPPC4 3'UTR Luciferase Stable Cell Line
TU026300 1.0 ml
EUR 1394.00
Trappc4 3'UTR GFP Stable Cell Line
TU272394 1.0 ml Ask for price
Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx028156-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx028156-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) Antibody
abx238948-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
TRAPPC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV693211 1.0 ug DNA
EUR 514.00
TRAPPC4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV693215 1.0 ug DNA
EUR 514.00
TRAPPC4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV693216 1.0 ug DNA
EUR 514.00
TRAPPC4 Trafficking Protein Particle Complex 4 Human Recombinant Protein
PROTQ9Y296 Regular: 10ug
EUR 317.00
Description: TRAPPC4 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 242 amino acids (1-219) and having a molecular mass of 26.7kDa. ;TRAPPC4 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
Human Trafficking Protein Particle Complex Subunit 4 (TRAPPC4) ELISA Kit
abx383909-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Trappc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K5004505 3 x 1.0 ug
EUR 376.00


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
ST6GALNAC3 antibody
70R-7175 50 ug
EUR 467.00
Description: Rabbit polyclonal ST6GALNAC3 antibody raised against the C terminal of ST6GALNAC3
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
ST6GALNAC3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC3. Recognizes ST6GALNAC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
ST6GALNAC3 Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ST6GALNAC3 Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ST6GALNAC3 Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ST6GALNAC3 Polyclonal Antibody
A66514 100 µg
EUR 570.55
Description: kits suitable for this type of research
ST6GALNAC3 Blocking Peptide
33R-3882 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ST6GALNAC3 antibody, catalog no. 70R-7175
ST6GALNAC3 cloning plasmid
CSB-CL836724HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 918
  • Sequence: atggcctgcatcctgaagagaaagtctgtgattgctgtgagcttcatagcagcgttccttttcctgctggttgtgcgtcttgtaaatgaagtgaatttcccattgctactaaactgctttggacaacctggtacaaagtggataccattctcctacacatacaggcggccccttcg
  • Show more
Description: A cloning plasmid for the ST6GALNAC3 gene.
Rat ST6GALNAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
ELI-13612h 96 Tests
EUR 824.00
Mouse St6galnac3 ELISA KIT
ELI-19862m 96 Tests
EUR 865.00
Human ST6GALNAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse ST6GALNAC3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
ST6GALNAC3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC3. Recognizes ST6GALNAC3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
ST6GALNAC3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC3. Recognizes ST6GALNAC3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
ST6GALNAC3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ST6GALNAC3. Recognizes ST6GALNAC3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ST6GALNAC3 Recombinant Protein (Human)
RP030247 100 ug Ask for price
ST6GALNAC3 Recombinant Protein (Rat)
RP231266 100 ug Ask for price
ST6GALNAC3 Recombinant Protein (Mouse)
RP175796 100 ug Ask for price
ST6GALNAC3 Polyclonal Antibody, HRP Conjugated
A66515 100 µg
EUR 570.55
Description: fast delivery possible
ST6GALNAC3 Polyclonal Antibody, FITC Conjugated
A66516 100 µg
EUR 570.55
Description: reagents widely cited
ST6GALNAC3 Polyclonal Antibody, Biotin Conjugated
A66517 100 µg
EUR 570.55
Description: Ask the seller for details
St6galnac3 ORF Vector (Mouse) (pORF)
ORF058600 1.0 ug DNA
EUR 506.00
ST6GALNAC3 ORF Vector (Human) (pORF)
ORF010083 1.0 ug DNA
EUR 95.00
St6galnac3 ORF Vector (Rat) (pORF)
ORF077090 1.0 ug DNA
EUR 506.00
ST6GALNAC3 sgRNA CRISPR Lentivector set (Human)
K2295301 3 x 1.0 ug
EUR 339.00
St6galnac3 sgRNA CRISPR Lentivector set (Mouse)
K3420601 3 x 1.0 ug
EUR 339.00
St6galnac3 sgRNA CRISPR Lentivector set (Rat)
K6862101 3 x 1.0 ug
EUR 339.00
ST6GALNAC3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2295302 1.0 ug DNA
EUR 154.00
ST6GALNAC3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2295303 1.0 ug DNA
EUR 154.00
ST6GALNAC3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2295304 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3420602 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3420603 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3420604 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6862102 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6862103 1.0 ug DNA
EUR 154.00
St6galnac3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6862104 1.0 ug DNA
EUR 154.00
ST6GALNAC3 Protein Vector (Human) (pPB-C-His)
PV040329 500 ng
EUR 329.00
ST6GALNAC3 Protein Vector (Human) (pPB-N-His)
PV040330 500 ng
EUR 329.00
ST6GALNAC3 Protein Vector (Human) (pPM-C-HA)
PV040331 500 ng
EUR 329.00
ST6GALNAC3 Protein Vector (Human) (pPM-C-His)
PV040332 500 ng
EUR 329.00
ST6GALNAC3 Protein Vector (Rat) (pPB-C-His)
PV308358 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Rat) (pPB-N-His)
PV308359 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Rat) (pPM-C-HA)
PV308360 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Rat) (pPM-C-His)
PV308361 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Mouse) (pPB-C-His)
PV234398 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Mouse) (pPB-N-His)
PV234399 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Mouse) (pPM-C-HA)
PV234400 500 ng
EUR 603.00
ST6GALNAC3 Protein Vector (Mouse) (pPM-C-His)
PV234401 500 ng
EUR 603.00
St6galnac3 3'UTR GFP Stable Cell Line
TU169779 1.0 ml Ask for price
St6galnac3 3'UTR Luciferase Stable Cell Line
TU119779 1.0 ml Ask for price
ST6GALNAC3 3'UTR GFP Stable Cell Line
TU074713 1.0 ml
EUR 4617.00
ST6GALNAC3 3'UTR Luciferase Stable Cell Line
TU024713 1.0 ml
EUR 4617.00
St6galnac3 3'UTR Luciferase Stable Cell Line
TU221248 1.0 ml Ask for price
St6galnac3 3'UTR GFP Stable Cell Line
TU271248 1.0 ml Ask for price
ST6GALNAC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV625297 1.0 ug DNA
EUR 514.00
ST6GALNAC3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV625301 1.0 ug DNA
EUR 514.00
ST6GALNAC3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV625302 1.0 ug DNA
EUR 514.00
Alpha-N-Acetylgalactosaminide Alpha-2,6-Sialyltransferase 3 (ST6GALNAC3) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
ST6GALNAC3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2295305 3 x 1.0 ug
EUR 376.00
St6galnac3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3420605 3 x 1.0 ug
EUR 376.00
St6galnac3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6862105 3 x 1.0 ug
EUR 376.00
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E06A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E06A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E06A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E01A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E01A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E01A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E03A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E03A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E03A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E04A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E04A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E04A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E02A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E02A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E02A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E07A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E07A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E07A1993-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E09A1993-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) ELISA kit
E09A1993-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Alpha N acetylgalactosaminide Alpha 2,6 sialyltransferase 3(ST6GALNAC3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TSTA3 antibody
70R-35685 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody
TSTA3 antibody
70R-21043 50 ul
EUR 435.00
Description: Rabbit polyclonal TSTA3 antibody
TSTA3 antibody
70R-6048 50 ug
EUR 467.00
Description: Rabbit polyclonal TSTA3 antibody raised against the N terminal of TSTA3
TSTA3 Antibody
ABD4085 100 ug
EUR 438.00
TSTA3 Antibody
34703-100ul 100ul
EUR 252.00
TSTA3 Antibody
34703-50ul 50ul
EUR 187.00
TSTA3 antibody
70R-15347 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody
TSTA3 Antibody
DF4085 200ul
EUR 304.00
Description: TSTA3 Antibody detects endogenous levels of total TSTA3.
TSTA3 Antibody
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TSTA3 Antibody
CSB-PA790986-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000
TSTA3 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200
TSTA3 Antibody
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000
TSTA3 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
YF-PA15142 50 ul
EUR 363.00
Description: Mouse polyclonal to TSTA3
YF-PA15143 50 ug
EUR 363.00
Description: Mouse polyclonal to TSTA3
YF-PA15144 100 ug
EUR 403.00
Description: Rabbit polyclonal to TSTA3
YF-PA24908 50 ul
EUR 334.00
Description: Mouse polyclonal to TSTA3
Polyclonal TSTA3 Antibody
APR10597G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSTA3 . This antibody is tested and proven to work in the following applications:
TSTA3 Conjugated Antibody
C34703 100ul
EUR 397.00
anti- TSTA3 antibody
FNab09075 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: tissue specific transplantation antigen P35B
  • Uniprot ID: Q13630
  • Gene ID: 7264
  • Research Area: Metabolism
Description: Antibody raised against TSTA3
Mouse Tsta3 Antibody
abx030949-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Mouse Tsta3 Antibody
abx030949-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
TSTA3 Rabbit pAb
A4169-100ul 100 ul
EUR 308.00
TSTA3 Rabbit pAb
A4169-200ul 200 ul
EUR 459.00
TSTA3 Rabbit pAb
A4169-20ul 20 ul
EUR 183.00
TSTA3 Rabbit pAb
A4169-50ul 50 ul
EUR 223.00
TSTA3 Polyclonal Antibody
A53877 100 µg
EUR 570.55
Description: The best epigenetics products
TSTA3 Blocking Peptide
33R-6023 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TSTA3 antibody, catalog no. 70R-6048
TSTA3 antibody (HRP)
60R-1858 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (HRP)
TSTA3 antibody (FITC)
60R-1859 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (FITC)
TSTA3 antibody (biotin)
60R-1860 100 ug
EUR 327.00
Description: Rabbit polyclonal TSTA3 antibody (biotin)
TSTA3 Blocking Peptide
DF4085-BP 1mg
EUR 195.00
TSTA3 cloning plasmid
CSB-CL619783HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 966
  • Sequence: atgggtgaaccccagggatccatgcggattctagtgacagggggctctgggctggtaggcaaagccatccagaaggtggtagcagatggagctggacttcctggagaggactgggtgtttgtctcctctaaagacgccgatctcacggatacagcacagacccgcgccctgtttga
  • Show more
Description: A cloning plasmid for the TSTA3 gene.
Anti-TSTA3 antibody
PAab09075 100 ug
EUR 386.00
Anti-TSTA3 antibody
STJ26557 100 µl
EUR 277.00
Description: Tissue specific transplantation antigen P35B is a NADP(H)-binding protein. It catalyze the two-step epimerase and the reductase reactions in GDP-D-mannose metabolism, converting GDP-4-keto-6-D-deoxymannose to GDP-L-fucose. GDP-L-fucose is the substrate of several fucosyltransferases involved in the expression of many glycoconjugates, including blood group ABH antigens and developmental adhesion antigens. Mutations in this gene may cause leukocyte adhesion deficiency, type II.
Anti-TSTA3 (2B9)
YF-MA15950 100 ug
EUR 363.00
Description: Mouse monoclonal to TSTA3
EF003915 96 Tests
EUR 689.00
Human TSTA3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TSTA3 protein (His tag)
80R-1419 100 ug
EUR 305.00
Description: Purified recombinant Human TSTA3 protein
Mouse TSTA3 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TSTA3 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TSTA3 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TSTA3 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TSTA3. Recognizes TSTA3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TSTA3 Recombinant Protein (Human)
RP033253 100 ug Ask for price
TSTA3 Recombinant Protein (Rat)
RP235088 100 ug Ask for price
TSTA3 Recombinant Protein (Mouse)
RP181907 100 ug Ask for price
TSTA3 Polyclonal Antibody, HRP Conjugated
A53878 100 µg
EUR 570.55
Description: kits suitable for this type of research
TSTA3 Polyclonal Antibody, FITC Conjugated
A53879 100 µg
EUR 570.55
Description: fast delivery possible
TSTA3 Polyclonal Antibody, Biotin Conjugated
A53880 100 µg
EUR 570.55
Description: reagents widely cited
Tsta3 ORF Vector (Rat) (pORF)
ORF078364 1.0 ug DNA
EUR 506.00
TSTA3 ORF Vector (Human) (pORF)
ORF011085 1.0 ug DNA
EUR 95.00
Tsta3 ORF Vector (Mouse) (pORF)
ORF060637 1.0 ug DNA
EUR 506.00
TSTA3 ELISA Kit (Human) (OKEH03537)
OKEH03537 96 Wells
EUR 779.00
Description: Description of target: Catalyzes the two-step NADP-dependent conversion of GDP-4-dehydro-6-deoxy-D-mannose to GDP-fucose, involving an epimerase and a reductase reaction.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.172 ng/mL
Polyclonal TSTA3 / FX Antibody (aa221-270)
APR10596G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TSTA3 / FX (aa221-270). This antibody is tested and proven to work in the following applications:
GDP-L-Fucose Synthetase (TSTA3) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
GDP-L-Fucose Synthetase (TSTA3) Antibody
abx145521-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
GDP-L-Fucose Synthetase (TSTA3) Antibody
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
GDP-L-Fucose Synthetase (TSTA3) Antibody
abx239075-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
TSTA3 sgRNA CRISPR Lentivector set (Human)
K2546601 3 x 1.0 ug
EUR 339.00
Tsta3 sgRNA CRISPR Lentivector set (Rat)
K6467201 3 x 1.0 ug
EUR 339.00
Tsta3 sgRNA CRISPR Lentivector set (Mouse)
K4915801 3 x 1.0 ug
EUR 339.00
Monoclonal TSTA3 Antibody (monoclonal) (M01), Clone: 2B9
APR10598G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human TSTA3 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2B9. This antibody is applicable in WB, E
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
GDP-L-Fucose Synthetase (TSTA3) Antibody Pair
abx117457-1pair5x96wellplates 1 pair (5x96 well plates)
EUR 1010.00
  • Shipped within 5-10 working days.
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Tissue Specific Transplantation Antigen P35B (TSTA3) Antibody
abx331219-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.
Human GDP-L-Fucose Synthase (TSTA3) Antibody
31323-05111 150 ug
EUR 261.00
TSTA3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2546602 1.0 ug DNA
EUR 154.00
TSTA3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2546603 1.0 ug DNA
EUR 154.00
TSTA3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2546604 1.0 ug DNA
EUR 154.00
Tsta3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6467202 1.0 ug DNA
EUR 154.00
Tsta3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6467203 1.0 ug DNA
EUR 154.00


SFTPA1 Antibody
ABD7204 100 ug
EUR 438.00
SFTPA1 antibody
38598-100ul 100ul
EUR 252.00
SFTPA1 Antibody
43332-100ul 100ul
EUR 252.00
SFTPA1 Antibody
31294-100ul 100ul
EUR 252.00
SFTPA1 Antibody
31294-50ul 50ul
EUR 187.00
SFTPA1 antibody
70R-20214 50 ul
EUR 435.00
Description: Rabbit polyclonal SFTPA1 antibody
SFTPA1 Antibody
DF7204 200ul
EUR 304.00
Description: SFTPA1 Antibody detects endogenous levels of total SFTPA1.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SFTPA1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPA1. Recognizes SFTPA1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:50-1:200
SFTPA1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPA1. Recognizes SFTPA1 from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
SFTPA1 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SFTPA1. Recognizes SFTPA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
SFTPA1 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SFTPA1. Recognizes SFTPA1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC
SFTPA1 Conjugated Antibody
C38598 100ul
EUR 397.00
SFTPA1 Conjugated Antibody
C31294 100ul
EUR 397.00
SFTPA1 Blocking Peptide
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SFTPA1 Rabbit pAb
A3133-100ul 100 ul
EUR 308.00
SFTPA1 Rabbit pAb
A3133-200ul 200 ul
EUR 459.00
SFTPA1 Rabbit pAb
A3133-20ul 20 ul
EUR 183.00
SFTPA1 Rabbit pAb
A3133-50ul 50 ul
EUR 223.00
SFTPA1 Blocking Peptide
DF7204-BP 1mg
EUR 195.00
Anti-SFTPA1 Antibody
PA1347 100ug/vial
EUR 294.00
Anti-SFTPA1 Antibody
PA1458 100ug/vial
EUR 334.00
Anti-SFTPA1 antibody
STJ25508 100 µl
EUR 277.00
Description: This gene encodes a lung surfactant protein that is a member of a subfamily of C-type lectins called collectins. The encoded protein binds specific carbohydrate moieties found on lipids and on the surface of microorganisms. This protein plays an essential role in surfactant homeostasis and in the defense against respiratory pathogens. Mutations in this gene are associated with idiopathic pulmonary fibrosis. Alternate splicing results in multiple transcript variants.
Rat SFTPA1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
ELI-02995d 96 Tests
EUR 928.00
ELI-02997b 96 Tests
EUR 928.00
ELI-02998h 96 Tests
EUR 824.00
Mouse Sftpa1 ELISA KIT
ELI-02999m 96 Tests
EUR 865.00
Human SFTPA1 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Anti-SFTPA1/2 Antibody