MAb – Gentaur

BIRC5

206

BIRC5 Antibody
32306-100ul	SAB	100ul	EUR 252.00

BIRC5 antibody
10R-3454	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody
10R-3455	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody
10R-3456	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 Antibody
1-CSB-PA002706GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Birc5 Antibody
1-CSB-PA002706HA01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC5 Antibody
1-CSB-PA07249A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:500

BIRC5 Antibody
1-CSB-PA080180	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

BIRC5 Antibody
1-CSB-PA968757	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC5 Antibody
DF6452	Affbiotech	200ul	EUR 304.00
Description: BIRC5 Antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody
1-CSB-PA159155	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

BIRC5 Protein
20-abx261430	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	0 1 2
Shipped within 5-10 working days.

BIRC5 Antibody
BF0652	Affbiotech	200ul	EUR 376.00
Description: BIRC5 antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody
1-CSB-PA009320	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

BIRC5 Antibody
1-CSB-PA009326	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

BIRC5 siRNA
20-abx900639	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BIRC5 siRNA
20-abx909118	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BIRC5 siRNA
20-abx909119	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BIRC5 Antibody
ABD6452	Lifescience Market	100 ug	EUR 438.00

anti-BIRC5
YF-PA27168	Abfrontier	100 ul	EUR 403.00
Description: Rabbit polyclonal to BIRC5

BIRC5 Blocking Peptide
DF6452-BP	Affbiotech	1mg	EUR 195.00

Survivin (BIRC5) Antibody
abx010443-100ul	Abbexa	100 ul	EUR 411.00
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx214437	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx214741	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx111181	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx125300	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	0 1 2
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx038170-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx133868	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	0 1 2
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx109262	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx011576	Abbexa	EUR 439.00 EUR 133.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx011577-100ug	Abbexa	100 ug	EUR 411.00
Shipped within 5-10 working days.

SURVIVIN (BIRC5) Antibody
abx238402-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

BIRC5 Conjugated Antibody
C32306	SAB	100ul	EUR 397.00

BIRC5 Blocking Peptide
BF0652-BP	Affbiotech	1mg	EUR 195.00

Survivin (BIRC5) Antibody
abx412141-01mg	Abbexa	0.1 mg	EUR 704.00
Shipped within 1 week.

Survivin (BIRC5) Antibody
abx412488-01mg	Abbexa	0.1 mg	EUR 509.00
Shipped within 1 week.

Survivin (BIRC5) Antibody
20-abx329628	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx326671	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx326820	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

BIRC5 (pT117) Antibody
abx333427-100ul	Abbexa	100 ul	EUR 467.00
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx430862-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

BIRC5 cloning plasmid
CSB-CL002706HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 429 Sequence: atgggtgccccgacgttgccccctgcctggcagccctttctcaaggaccaccgcatctctacattcaagaactggcccttcttggagggctgcgcctgcaccccggagcggatggccgaggctggcttcatccactgccccactgagaacgagccagacttggcccagtgtttctt Show more
Description: A cloning plasmid for the BIRC5 gene.

Birc5 Polyclonal Antibody
A56487	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Survivin (BIRC5) Antibody
20-abx001305	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

anti-BIRC5 (1H5)
LF-MA30666	Abfrontier	100 ul	EUR 527.00
Description: Mouse Monoclonal to BIRC5

Anti-BIRC5 antibody
STJ26172	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-BIRC5 Antibody
STJ503164	St John's Laboratory	100 µg	EUR 476.00

Human Survivin (BIRC5) Antibody
21115-05011	AssayPro	150 ug	EUR 217.00

Birc5 Antibody, HRP conjugated
1-CSB-PA002706HB01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Birc5 Antibody, FITC conjugated
1-CSB-PA002706HC01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Birc5 Antibody, Biotin conjugated
1-CSB-PA002706HD01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

BIRC5 Antibody, HRP conjugated
1-CSB-PA07249B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC5 Antibody, FITC conjugated
1-CSB-PA07249C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC5 Antibody, Biotin conjugated
1-CSB-PA07249D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-BIRC5 (Thr117) Antibody
CSB-PA644556-	Cusabio		EUR 335.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-BIRC5 (Thr117) Antibody
CSB-PA644556-100ul	Cusabio	100ul	EUR 362.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Polyclonal BIRC5 / Survivin Antibody
APR03084G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIRC5 / Survivin . This antibody is tested and proven to work in the following applications:

Anti-Survivin/BIRC5 Antibody
A00379	BosterBio	100ug/vial	EUR 334.00

Survivin (BIRC5) Antibody (Biotin)
20-abx105174	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (FITC)
20-abx106591	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (HRP)
20-abx108008	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Human BIRC5 ELISA Kit
ELA-E2045h	Lifescience Market	96 Tests	EUR 824.00

Canine BIRC5 ELISA KIT
ELI-06567d	Lifescience Market	96 Tests	EUR 928.00

Mouse Birc5 ELISA KIT
ELI-06568m	Lifescience Market	96 Tests	EUR 865.00

Bovine BIRC5 ELISA KIT
ELI-06569b	Lifescience Market	96 Tests	EUR 928.00

Human BIRC5 ELISA KIT
ELI-06570h	Lifescience Market	96 Tests	EUR 824.00

Rat BIRC5 shRNA Plasmid
20-abx986146	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Phospho-BIRC5 (T34) Antibody
1-CSB-PA009313	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T34). Recognizes Phospho-BIRC5 (T34) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Phospho-BIRC5 (T117) Antibody
1-CSB-PA009314	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T117). Recognizes Phospho-BIRC5 (T117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Mouse BIRC5 shRNA Plasmid
20-abx969184	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human BIRC5 shRNA Plasmid
20-abx950233	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Anti-survivin/BIRC5 Antibody
PA1474	BosterBio	100ug/vial	EUR 294.00

BIRC5 Recombinant Protein (Human)
RP003064	ABM	100 ug	Ask for price

Anti-survivin/BIRC5 Antibody
RP1026	BosterBio	100ug/vial	EUR 334.00

Anti-Survivin/BIRC5 Antibody
RP1052	BosterBio	100ug/vial	EUR 294.00

BIRC5 Recombinant Protein (Rat)
RP192209	ABM	100 ug	Ask for price

BIRC5 Recombinant Protein (Mouse)
RP119597	ABM	100 ug	Ask for price

BIRC5 Recombinant Protein (Mouse)
RP119600	ABM	100 ug	Ask for price

Anti-Survivin / BIRC5 antibody
STJ70580	St John's Laboratory	100 µg	EUR 359.00

Anti-BIRC5 Antibody (Biotin)
STJ503165	St John's Laboratory	100 µg	EUR 586.00

Anti-BIRC5 Antibody (FITC)
STJ503166	St John's Laboratory	100 µg	EUR 586.00

Human Survivin (BIRC5) ELISA Kit
abx050206-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-10 working days.

Mouse Survivin (BIRC5) ELISA Kit
abx255062-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Human Survivin (BIRC5) ELISA Kit
abx253587-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Cow Survivin (BIRC5) ELISA Kit
abx519228-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Dog Survivin (BIRC5) ELISA Kit
abx519229-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Pig Survivin (BIRC5) ELISA Kit
abx519232-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Rat Survivin (BIRC5) ELISA Kit
abx519233-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Birc5 Polyclonal Antibody, HRP Conjugated
A56488	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Birc5 Polyclonal Antibody, FITC Conjugated
A56489	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

CCT6A

207

CCT6A Antibody
35092-100ul	SAB	100ul	EUR 252.00

CCT6A Antibody
35092-50ul	SAB	50ul	EUR 187.00

CCT6A Antibody
1-CSB-PA004865EA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CCT6A Antibody
1-CSB-PA004865ESR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

CCT6A Antibody
1-CSB-PA004865GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCT6A Antibody
1-CSB-PA004250	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

CCT6A Antibody
CSB-PA796607-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Antibody
CSB-PA796607-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Antibody
DF4562	Affbiotech	200ul	EUR 304.00
Description: CCT6A Antibody detects endogenous levels of total CCT6A.

CCT6A siRNA
20-abx910907	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

CCT6A siRNA
20-abx910908	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

CCT6A Antibody
ABD4562	Lifescience Market	100 ug	EUR 438.00

Anti-CCT6A Antibody
A09373	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal CCT6A Antibody. Validated in IHC, WB and tested in Human.

CCT6A Blocking Peptide
DF4562-BP	Affbiotech	1mg	EUR 195.00

CCT6A Conjugated Antibody
C35092	SAB	100ul	EUR 397.00

CCT6A-Specific Antibody
abx231401-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

CCT6A cloning plasmid
CSB-CL004865HU-10ug	Cusabio	10ug	EUR 376.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1596 Sequence: ATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTGGCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCCAAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAG Show more
Description: A cloning plasmid for the CCT6A gene.

CCT6A Rabbit pAb
A3589-100ul	Abclonal	100 ul	EUR 308.00

CCT6A Rabbit pAb
A3589-200ul	Abclonal	200 ul	EUR 459.00

CCT6A Rabbit pAb
A3589-20ul	Abclonal	20 ul	EUR 183.00

CCT6A Rabbit pAb
A3589-50ul	Abclonal	50 ul	EUR 223.00

Anti-CCT6A antibody
STJ29904	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, several pseudogenes of this gene have been located.

CCT6A Antibody, HRP conjugated
1-CSB-PA004865EB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCT6A Antibody, FITC conjugated
1-CSB-PA004865EC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCT6A Antibody, Biotin conjugated
1-CSB-PA004865ED01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCT6A ELISA KIT\|Human
EF008482	Lifescience Market	96 Tests	EUR 689.00

Mouse CCT6A shRNA Plasmid
20-abx969540	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human CCT6A shRNA Plasmid
20-abx950637	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

anti- CCT6A-Specific antibody
FNab01401	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 Immunogen: chaperonin containing TCP1, subunit 6A(zeta 1) Uniprot ID: P40227 Research Area: Metabolism
Description: Antibody raised against CCT6A-Specific

Anti-CCT6A-Specific antibody
PAab01401	Lifescience Market	100 ug	EUR 355.00

CCT6A Recombinant Protein (Human)
RP037876	ABM	100 ug	Ask for price

CCT6A Recombinant Protein (Rat)
RP193820	ABM	100 ug	Ask for price

CCT6A Recombinant Protein (Mouse)
RP122315	ABM	100 ug	Ask for price

Cct6a ORF Vector (Rat) (pORF)
ORF064608	ABM	1.0 ug DNA	EUR 506.00

CCT6A ORF Vector (Human) (pORF)
ORF012626	ABM	1.0 ug DNA	EUR 354.00

Cct6a ORF Vector (Mouse) (pORF)
ORF040773	ABM	1.0 ug DNA	EUR 506.00

CCT6A ELISA Kit (Human) (OKCA00835)
OKCA00835	Aviva Systems Biology	96 Wells	EUR 833.00
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. Known to play a role, in vitro, in the folding of actin and tubulin. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

Cct6a sgRNA CRISPR Lentivector set (Mouse)
K4782901	ABM	3 x 1.0 ug	EUR 339.00

CCT6A sgRNA CRISPR Lentivector set (Human)
K0397301	ABM	3 x 1.0 ug	EUR 339.00

Cct6a sgRNA CRISPR Lentivector set (Rat)
K7472001	ABM	3 x 1.0 ug	EUR 339.00

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
20-abx111566	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
abx330610-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
20-abx328411	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4782902	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4782903	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4782904	ABM	1.0 ug DNA	EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 1)
K0397302	ABM	1.0 ug DNA	EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 2)
K0397303	ABM	1.0 ug DNA	EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 3)
K0397304	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7472002	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7472003	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7472004	ABM	1.0 ug DNA	EUR 154.00

CCT6A Protein Vector (Mouse) (pPB-C-His)
PV163090	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Mouse) (pPB-N-His)
PV163091	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Mouse) (pPM-C-HA)
PV163092	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Mouse) (pPM-C-His)
PV163093	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Rat) (pPB-C-His)
PV258430	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Rat) (pPB-N-His)
PV258431	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Rat) (pPM-C-HA)
PV258432	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Rat) (pPM-C-His)
PV258433	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Human) (pPB-C-His)
PV050501	ABM	500 ng	EUR 481.00

CCT6A Protein Vector (Human) (pPB-N-His)
PV050502	ABM	500 ng	EUR 481.00

CCT6A Protein Vector (Human) (pPM-C-HA)
PV050503	ABM	500 ng	EUR 481.00

CCT6A Protein Vector (Human) (pPM-C-His)
PV050504	ABM	500 ng	EUR 481.00

Cct6a 3'UTR GFP Stable Cell Line
TU153440	ABM	1.0 ml	Ask for price

Cct6a 3'UTR Luciferase Stable Cell Line
TU103440	ABM	1.0 ml	Ask for price

Cct6a 3'UTR Luciferase Stable Cell Line
TU201926	ABM	1.0 ml	Ask for price

Cct6a 3'UTR GFP Stable Cell Line
TU251926	ABM	1.0 ml	Ask for price

CCT6A 3'UTR GFP Stable Cell Line
TU053839	ABM	1.0 ml	EUR 1394.00

CCT6A 3'UTR Luciferase Stable Cell Line
TU003839	ABM	1.0 ml	EUR 1394.00

Human T-complex protein 1 subunit zeta (CCT6A)
1-CSB-EP004865HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 61.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit zeta(CCT6A) expressed in E.coli

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx005625	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx014943	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
abx146199-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx320500	Abbexa	EUR 300.00 EUR 244.00	0 1
Shipped within 5-10 working days.

CCT6A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702555	ABM	1.0 ug DNA	EUR 450.00

CCT6A Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702559	ABM	1.0 ug DNA	EUR 450.00

CCT6A Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702560	ABM	1.0 ug DNA	EUR 450.00

CCT6A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV637585	ABM	1.0 ug DNA	EUR 682.00

CCT6A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV637589	ABM	1.0 ug DNA	EUR 682.00

CCT6A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV637590	ABM	1.0 ug DNA	EUR 682.00

Bovine T- complex protein 1 subunit zeta, CCT6A ELISA KIT
ELI-18866b	Lifescience Market	96 Tests	EUR 928.00

Human T- complex protein 1 subunit zeta, CCT6A ELISA KIT
ELI-18867h	Lifescience Market	96 Tests	EUR 824.00

Mouse T- complex protein 1 subunit zeta, Cct6a ELISA KIT
ELI-46486m	Lifescience Market	96 Tests	EUR 865.00

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit
CSB-EL004865HU-24T	Cusabio	1 plate of 24 wells	EUR 165.00
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta (CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit
1-CSB-EL004865HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	0 1 2
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta(CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human T-Complex Protein 1 Subunit Zeta (CCT6A) ELISA Kit
abx352113-96tests	Abbexa	96 tests	EUR 786.00
Shipped within 5-12 working days.

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4782905	ABM	3 x 1.0 ug	EUR 376.00

CCT6A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0397305	ABM	3 x 1.0 ug	EUR 376.00

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7472005	ABM	3 x 1.0 ug	EUR 376.00

SPRN

204

SPRN siRNA
20-abx905259	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SPRN Antibody
37026-100ul	SAB	100ul	EUR 252.00

SPRN siRNA
20-abx935042	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SPRN siRNA
20-abx935043	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SPRN Antibody
1-CSB-PA058370	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPRN. Recognizes SPRN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

SPRN Conjugated Antibody
C37026	SAB	100ul	EUR 397.00

Mouse SPRN shRNA Plasmid
20-abx980756	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human SPRN shRNA Plasmid
20-abx968376	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat SPRN shRNA Plasmid
20-abx991045	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

SPRN Recombinant Protein (Human)
RP099903	ABM	100 ug	Ask for price

SPRN Recombinant Protein (Rat)
RP230915	ABM	100 ug	Ask for price

SPRN Recombinant Protein (Mouse)
RP175235	ABM	100 ug	Ask for price

Polyclonal SPRN Antibody (C-term)
APR11291G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPRN (C-term). This antibody is tested and proven to work in the following applications:

SPRN ORF Vector (Human) (pORF)
ORF033302	ABM	1.0 ug DNA	EUR 405.00

Sprn ORF Vector (Mouse) (pORF)
ORF058413	ABM	1.0 ug DNA	EUR 506.00

Sprn ORF Vector (Rat) (pORF)
ORF076973	ABM	1.0 ug DNA	EUR 506.00

SPRN ELISA Kit (Mouse) (OKCA01773)
OKCA01773	Aviva Systems Biology	96 Wells	EUR 846.00
Description: Description of target: Prion-like protein that has PrP(C)-like neuroprotective activity. May act as a modulator for the biological actions of normal and abnormal PrP.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.039 ng/mL

Shadow of Prion Protein (SPRN) Antibody
abx032300-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Shadow of Prion Protein (SPRN) Antibody
abx032300-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Shadow Of Prion Protein (SPRN) Antibody
20-abx339404	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

SPRN sgRNA CRISPR Lentivector set (Human)
K2279301	ABM	3 x 1.0 ug	EUR 339.00

Sprn sgRNA CRISPR Lentivector set (Mouse)
K4379901	ABM	3 x 1.0 ug	EUR 339.00

Sprn sgRNA CRISPR Lentivector set (Rat)
K6250201	ABM	3 x 1.0 ug	EUR 339.00

SPRN sgRNA CRISPR Lentivector (Human) (Target 1)
K2279302	ABM	1.0 ug DNA	EUR 154.00

SPRN sgRNA CRISPR Lentivector (Human) (Target 2)
K2279303	ABM	1.0 ug DNA	EUR 154.00

SPRN sgRNA CRISPR Lentivector (Human) (Target 3)
K2279304	ABM	1.0 ug DNA	EUR 154.00

Sprn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4379902	ABM	1.0 ug DNA	EUR 154.00

Sprn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4379903	ABM	1.0 ug DNA	EUR 154.00

Sprn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4379904	ABM	1.0 ug DNA	EUR 154.00

Sprn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6250202	ABM	1.0 ug DNA	EUR 154.00

Sprn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6250203	ABM	1.0 ug DNA	EUR 154.00

Sprn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6250204	ABM	1.0 ug DNA	EUR 154.00

SPRN Protein Vector (Human) (pPB-C-His)
PV133206	ABM	500 ng	EUR 552.00

SPRN Protein Vector (Human) (pPB-N-His)
PV133207	ABM	500 ng	EUR 552.00

SPRN Protein Vector (Human) (pPM-C-HA)
PV133208	ABM	500 ng	EUR 552.00

SPRN Protein Vector (Human) (pPM-C-His)
PV133209	ABM	500 ng	EUR 552.00

SPRN Protein Vector (Rat) (pPB-C-His)
PV307890	ABM	500 ng	EUR 603.00

SPRN Protein Vector (Rat) (pPB-N-His)
PV307891	ABM	500 ng	EUR 603.00

SPRN Protein Vector (Rat) (pPM-C-HA)
PV307892	ABM	500 ng	EUR 603.00

SPRN Protein Vector (Rat) (pPM-C-His)
PV307893	ABM	500 ng	EUR 603.00

SPRN Protein Vector (Mouse) (pPB-C-His)
PV233650	ABM	500 ng	EUR 603.00

SPRN Protein Vector (Mouse) (pPB-N-His)
PV233651	ABM	500 ng	EUR 603.00

SPRN Protein Vector (Mouse) (pPM-C-HA)
PV233652	ABM	500 ng	EUR 603.00

SPRN Protein Vector (Mouse) (pPM-C-His)
PV233653	ABM	500 ng	EUR 603.00

Sprn 3'UTR GFP Stable Cell Line
TU169634	ABM	1.0 ml	Ask for price

Sprn 3'UTR Luciferase Stable Cell Line
TU119634	ABM	1.0 ml	Ask for price

SPRN 3'UTR GFP Stable Cell Line
TU074528	ABM	1.0 ml	EUR 2333.00

SPRN 3'UTR Luciferase Stable Cell Line
TU024528	ABM	1.0 ml	EUR 2333.00

Sprn 3'UTR Luciferase Stable Cell Line
TU221122	ABM	1.0 ml	Ask for price

Sprn 3'UTR GFP Stable Cell Line
TU271122	ABM	1.0 ml	Ask for price

Mouse Shadow of prion protein(SPRN) ELISA kit
E03S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Shadow of prion protein(SPRN) ELISA kit
E03S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Shadow of prion protein(SPRN) ELISA kit
E03S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Shadow of prion protein(SPRN) ELISA kit
E02S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Shadow of prion protein(SPRN) ELISA kit
E02S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Shadow of prion protein(SPRN) ELISA kit
E02S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Shadow of prion protein(SPRN) ELISA kit
E04S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Shadow of prion protein(SPRN) ELISA kit
E04S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Shadow of prion protein(SPRN) ELISA kit
E04S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Shadow of prion protein(SPRN) ELISA kit
E01S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Shadow of prion protein(SPRN) ELISA kit
E01S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Shadow of prion protein(SPRN) ELISA kit
E01S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Shadow of prion protein(SPRN) ELISA kit
E06S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Shadow of prion protein(SPRN) ELISA kit
E06S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Shadow of prion protein(SPRN) ELISA kit
E06S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Shadow of prion protein(SPRN) ELISA kit
E08S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Shadow of prion protein(SPRN) ELISA kit
E08S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Shadow of prion protein(SPRN) ELISA kit
E08S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Shadow of prion protein(SPRN) ELISA kit
E07S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Shadow of prion protein(SPRN) ELISA kit
E07S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Shadow of prion protein(SPRN) ELISA kit
E07S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Shadow of prion protein(SPRN) ELISA kit
E09S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Shadow of prion protein(SPRN) ELISA kit
E09S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Shadow of prion protein(SPRN) ELISA kit
E09S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Shadow of prion protein, SPRN ELISA KIT
ELI-52893b	Lifescience Market	96 Tests	EUR 928.00

Human Shadow of prion protein, SPRN ELISA KIT
ELI-52894h	Lifescience Market	96 Tests	EUR 824.00

Chicken Shadow of prion protein, SPRN ELISA KIT
ELI-29640c	Lifescience Market	96 Tests	EUR 928.00

Mouse Shadow of prion protein, Sprn ELISA KIT
ELI-39480m	Lifescience Market	96 Tests	EUR 865.00

SPRN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV641419	ABM	1.0 ug DNA	EUR 514.00

SPRN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV641423	ABM	1.0 ug DNA	EUR 514.00

SPRN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV641424	ABM	1.0 ug DNA	EUR 514.00

Guinea pig Shadow of prion protein(SPRN) ELISA kit
E05S0399-192T	B-Gene	192 tests	EUR 1270.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Shadow of prion protein(SPRN) ELISA kit
E05S0399-48	B-Gene	1 plate of 48 wells	EUR 520.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Shadow of prion protein(SPRN) ELISA kit
E05S0399-96	B-Gene	1 plate of 96 wells	EUR 685.00
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Rat Shadow of prion protein (SPRN)
KTE100127-48T	Abbkine	48T	EUR 332.00
SPRN expression in human, rat, and mouse brain. The deduced human protein contains 151 amino acids. The mammalian proteins share 81 to 95% sequence identity. Alignment of all fish and mammalian Sho proteins showed that all have an N-terminal peptide Show more
Description: Quantitative sandwich ELISA for measuring Rat Shadow of prion protein (SPRN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

TFPT

205

TFPT antibody
70R-20790	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal TFPT antibody

TFPT antibody
38938-100ul	SAB	100ul	EUR 252.00

TFPT Antibody
1-CSB-PA023439GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TFPT. Recognizes TFPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TFPT siRNA
20-abx905540	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TFPT siRNA
20-abx936600	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TFPT siRNA
20-abx936601	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

pOTB7-TFPT
PVT19038	Lifescience Market	2 ug	EUR 231.00

TFPT Conjugated Antibody
C38938	SAB	100ul	EUR 397.00

TFPT cloning plasmid
CSB-CL023439HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 762 Sequence: atggaattggagcagagagaagggaccatggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccggga Show more
Description: A cloning plasmid for the TFPT gene.

TFPT cloning plasmid
CSB-CL023439HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 735 Sequence: atggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccgggagcgagatgaagaggaagaggcagcccg Show more
Description: A cloning plasmid for the TFPT gene.

TFPT Rabbit pAb
A6461-100ul	Abclonal	100 ul	EUR 308.00

TFPT Rabbit pAb
A6461-200ul	Abclonal	200 ul	EUR 459.00

TFPT Rabbit pAb
A6461-20ul	Abclonal	20 ul	EUR 183.00

TFPT Rabbit pAb
A6461-50ul	Abclonal	50 ul	EUR 223.00

anti- TFPT antibody
FNab08635	FN Test	100µg	EUR 548.75
Immunogen: TCF3(E2A) fusion partner(in childhood Leukemia) Uniprot ID: P0C1Z6 Gene ID: 29844 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against TFPT

Anti-TFPT antibody
PAab08635	Lifescience Market	100 ug	EUR 386.00

Anti-TFPT antibody
STJ28544	St John's Laboratory	100 µl	EUR 277.00

TFPT ELISA KIT\|Human
EF003563	Lifescience Market	96 Tests	EUR 689.00

Mouse TFPT shRNA Plasmid
20-abx977029	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat TFPT shRNA Plasmid
20-abx987022	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human TFPT shRNA Plasmid
20-abx959239	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TFPT Recombinant Protein (Rat)
RP232910	ABM	100 ug	Ask for price

TFPT Recombinant Protein (Human)
RP031372	ABM	100 ug	Ask for price

TFPT Recombinant Protein (Human)
RP031375	ABM	100 ug	Ask for price

TFPT Recombinant Protein (Mouse)
RP178406	ABM	100 ug	Ask for price

TCF3 Fusion Partner (TFPT) Antibody
20-abx004953	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

TCF3 Fusion Partner (TFPT) Antibody
abx034315-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

TCF3 Fusion Partner (TFPT) Antibody
abx034315-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

TCF3 Fusion Partner (TFPT) Antibody
abx238635-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Tfpt ORF Vector (Rat) (pORF)
ORF077638	ABM	1.0 ug DNA	EUR 506.00

TFPT ORF Vector (Human) (pORF)
ORF010458	ABM	1.0 ug DNA	EUR 95.00

TFPT ORF Vector (Human) (pORF)
ORF010459	ABM	1.0 ug DNA	EUR 95.00

Tfpt ORF Vector (Mouse) (pORF)
ORF059470	ABM	1.0 ug DNA	EUR 506.00

Polyclonal TFPT antibody - C-terminal region
APR01604G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TFPT - C-terminal region. This antibody is tested and proven to work in the following applications:

Tfpt sgRNA CRISPR Lentivector set (Mouse)
K4652201	ABM	3 x 1.0 ug	EUR 339.00

Tfpt sgRNA CRISPR Lentivector set (Rat)
K6972001	ABM	3 x 1.0 ug	EUR 339.00

TFPT sgRNA CRISPR Lentivector set (Human)
K2363501	ABM	3 x 1.0 ug	EUR 339.00

Human TCF3 Fusion Partner (TFPT) ELISA Kit
abx383724-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Human TCF3 fusion partner, TFPT ELISA KIT
ELI-37062h	Lifescience Market	96 Tests	EUR 824.00

Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4652202	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4652203	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4652204	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Rat) (Target 1)
K6972002	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Rat) (Target 2)
K6972003	ABM	1.0 ug DNA	EUR 154.00

Tfpt sgRNA CRISPR Lentivector (Rat) (Target 3)
K6972004	ABM	1.0 ug DNA	EUR 154.00

TFPT sgRNA CRISPR Lentivector (Human) (Target 1)
K2363502	ABM	1.0 ug DNA	EUR 154.00

TFPT sgRNA CRISPR Lentivector (Human) (Target 2)
K2363503	ABM	1.0 ug DNA	EUR 154.00

TFPT sgRNA CRISPR Lentivector (Human) (Target 3)
K2363504	ABM	1.0 ug DNA	EUR 154.00

TFPT Protein Vector (Rat) (pPB-C-His)
PV310550	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Rat) (pPB-N-His)
PV310551	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Rat) (pPM-C-HA)
PV310552	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Rat) (pPM-C-His)
PV310553	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Human) (pPB-C-His)
PV041829	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPB-N-His)
PV041830	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPM-C-HA)
PV041831	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPM-C-His)
PV041832	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPB-C-His)
PV041833	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPB-N-His)
PV041834	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPM-C-HA)
PV041835	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Human) (pPM-C-His)
PV041836	ABM	500 ng	EUR 329.00

TFPT Protein Vector (Mouse) (pPB-C-His)
PV237878	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Mouse) (pPB-N-His)
PV237879	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Mouse) (pPM-C-HA)
PV237880	ABM	500 ng	EUR 603.00

TFPT Protein Vector (Mouse) (pPM-C-His)
PV237881	ABM	500 ng	EUR 603.00

Tfpt 3'UTR Luciferase Stable Cell Line
TU120405	ABM	1.0 ml	Ask for price

Tfpt 3'UTR GFP Stable Cell Line
TU170405	ABM	1.0 ml	Ask for price

Tfpt 3'UTR Luciferase Stable Cell Line
TU221815	ABM	1.0 ml	Ask for price

TFPT 3'UTR GFP Stable Cell Line
TU075474	ABM	1.0 ml	EUR 1394.00

Tfpt 3'UTR GFP Stable Cell Line
TU271815	ABM	1.0 ml	Ask for price

TFPT 3'UTR Luciferase Stable Cell Line
TU025474	ABM	1.0 ml	EUR 1394.00

Bovine TCF3 fusion partner homolog, TFPT ELISA KIT
ELI-18981b	Lifescience Market	96 Tests	EUR 928.00

TFPT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715803	ABM	1.0 ug DNA	EUR 316.00

TFPT Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715807	ABM	1.0 ug DNA	EUR 316.00

TFPT Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715808	ABM	1.0 ug DNA	EUR 316.00

Mouse TCF3 fusion partner homolog, Tfpt ELISA KIT
ELI-41794m	Lifescience Market	96 Tests	EUR 865.00

GGCX

199

GGCX antibody
70R-17470	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal GGCX antibody

GGCX Antibody
36501-100ul	SAB	100ul	EUR 252.00

GGCX Antibody
1-CSB-PA962996	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GGCX Antibody
DF12616	Affbiotech	200ul	EUR 304.00
Description: GGCX Antibody detects endogenous levels of GGCX.

GGCX Antibody
1-CSB-PA181894	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20Â°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

GGCX antibody
70R-6289	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal GGCX antibody raised against the middle region of GGCX

GGCX Antibody
1-CSB-PA009388GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20â„ƒ, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GGCX Antibody
1-CSB-PA009388LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GGCX siRNA
20-abx902134	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GGCX siRNA
20-abx917820	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GGCX siRNA
20-abx917821	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-GGCX
YF-PA23776	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to GGCX

GGCX Blocking Peptide
33R-2973	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GGCX antibody, catalog no. 70R-6289

GGCX Blocking Peptide
DF12616-BP	Affbiotech	1mg	EUR 195.00

GGCX Conjugated Antibody
C36501	SAB	100ul	EUR 397.00

GGCX cloning plasmid
CSB-CL009388HU-10ug	Cusabio	10ug	EUR 474.00
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 2277 Sequence: atggcggtgtctgccgggtccgcgcggacctcgcccagctcagataaagtacagaaagacaaggctgaactgatctcagggcccaggcaggacagccgaatagggaaactcttgggttttgagtggacagatttgtccagttggcggaggctggtgaccctgctgaatcgaccaa Show more
Description: A cloning plasmid for the GGCX gene.

GGCX Rabbit pAb
A1806-100ul	Abclonal	100 ul	EUR 308.00

GGCX Rabbit pAb
A1806-200ul	Abclonal	200 ul	EUR 459.00

GGCX Rabbit pAb
A1806-20ul	Abclonal	20 ul	EUR 183.00

GGCX Rabbit pAb
A1806-50ul	Abclonal	50 ul	EUR 223.00

anti- GGCX antibody
FNab03444	FN Test	100µg	EUR 505.25
Immunogen: gamma-glutamyl carboxylase Uniprot ID: P38435 Gene ID: 2677 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GGCX

Anti-GGCX antibody
PAab03444	Lifescience Market	100 ug	EUR 355.00

Anti-GGCX antibody
STJ111114	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.

Anti-GGCX Antibody
STJ501151	St John's Laboratory	100 µg	EUR 476.00

Anti-GGCX antibody
STJ71959	St John's Laboratory	100 µg	EUR 359.00

GGCX ELISA KIT\|Human
EF009845	Lifescience Market	96 Tests	EUR 689.00

Mouse GGCX shRNA Plasmid
20-abx974692	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat GGCX shRNA Plasmid
20-abx986662	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GGCX Antibody, HRP conjugated
1-CSB-PA009388LB01HU