BIRC5 Antibody

32306-100ul 100ul
EUR 252.00

BIRC5 antibody

10R-3454 100 ul
EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody

10R-3455 100 ul
EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody

10R-3456 100 ul
EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Birc5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:500

BIRC5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

BIRC5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC5 Antibody

DF6452 200ul
EUR 304.00
Description: BIRC5 Antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

BIRC5 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

BIRC5 Antibody

BF0652 200ul
EUR 376.00
Description: BIRC5 antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

BIRC5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BIRC5 Antibody

ABD6452 100 ug
EUR 438.00


YF-PA27168 100 ul
EUR 403.00
Description: Rabbit polyclonal to BIRC5

BIRC5 Blocking Peptide

DF6452-BP 1mg
EUR 195.00

Survivin (BIRC5) Antibody

abx010443-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

abx038170-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 439.00
  • EUR 133.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

abx011577-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.


abx238402-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

BIRC5 Conjugated Antibody

C32306 100ul
EUR 397.00

BIRC5 Blocking Peptide

BF0652-BP 1mg
EUR 195.00

Survivin (BIRC5) Antibody

abx412141-01mg 0.1 mg
EUR 704.00
  • Shipped within 1 week.

Survivin (BIRC5) Antibody

abx412488-01mg 0.1 mg
EUR 509.00
  • Shipped within 1 week.

Survivin (BIRC5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BIRC5 (pT117) Antibody

abx333427-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

abx430862-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

BIRC5 cloning plasmid

CSB-CL002706HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atgggtgccccgacgttgccccctgcctggcagccctttctcaaggaccaccgcatctctacattcaagaactggcccttcttggagggctgcgcctgcaccccggagcggatggccgaggctggcttcatccactgccccactgagaacgagccagacttggcccagtgtttctt
  • Show more
Description: A cloning plasmid for the BIRC5 gene.

Birc5 Polyclonal Antibody

A56487 100 µg
EUR 570.55
Description: fast delivery possible

Survivin (BIRC5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

anti-BIRC5 (1H5)

LF-MA30666 100 ul
EUR 527.00
Description: Mouse Monoclonal to BIRC5

Anti-BIRC5 antibody

STJ26172 100 µl
EUR 277.00
Description: This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-BIRC5 Antibody

STJ503164 100 µg
EUR 476.00

Human Survivin (BIRC5) Antibody

21115-05011 150 ug
EUR 217.00

Birc5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Birc5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Birc5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

BIRC5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-BIRC5 (Thr117) Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-BIRC5 (Thr117) Antibody

CSB-PA644556-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Polyclonal BIRC5 / Survivin Antibody

APR03084G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIRC5 / Survivin . This antibody is tested and proven to work in the following applications:

Anti-Survivin/BIRC5 Antibody

A00379 100ug/vial
EUR 334.00

Survivin (BIRC5) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.


ELA-E2045h 96 Tests
EUR 824.00


ELI-06567d 96 Tests
EUR 928.00

Mouse Birc5 ELISA KIT

ELI-06568m 96 Tests
EUR 865.00


ELI-06569b 96 Tests
EUR 928.00


ELI-06570h 96 Tests
EUR 824.00

Rat BIRC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Phospho-BIRC5 (T34) Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T34). Recognizes Phospho-BIRC5 (T34) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Phospho-BIRC5 (T117) Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T117). Recognizes Phospho-BIRC5 (T117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Mouse BIRC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human BIRC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Anti-survivin/BIRC5 Antibody

PA1474 100ug/vial
EUR 294.00

BIRC5 Recombinant Protein (Human)

RP003064 100 ug Ask for price

Anti-survivin/BIRC5 Antibody

RP1026 100ug/vial
EUR 334.00

Anti-Survivin/BIRC5 Antibody

RP1052 100ug/vial
EUR 294.00

BIRC5 Recombinant Protein (Rat)

RP192209 100 ug Ask for price

BIRC5 Recombinant Protein (Mouse)

RP119597 100 ug Ask for price

BIRC5 Recombinant Protein (Mouse)

RP119600 100 ug Ask for price

Anti-Survivin / BIRC5 antibody

STJ70580 100 µg
EUR 359.00

Anti-BIRC5 Antibody (Biotin)

STJ503165 100 µg
EUR 586.00

Anti-BIRC5 Antibody (FITC)

STJ503166 100 µg
EUR 586.00

Human Survivin (BIRC5) ELISA Kit

abx050206-96tests 96 tests
EUR 668.00
  • Shipped within 5-10 working days.

Mouse Survivin (BIRC5) ELISA Kit

abx255062-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Human Survivin (BIRC5) ELISA Kit

abx253587-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Cow Survivin (BIRC5) ELISA Kit

abx519228-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Dog Survivin (BIRC5) ELISA Kit

abx519229-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Pig Survivin (BIRC5) ELISA Kit

abx519232-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Rat Survivin (BIRC5) ELISA Kit

abx519233-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Birc5 Polyclonal Antibody, HRP Conjugated

A56488 100 µg
EUR 570.55
Description: reagents widely cited

Birc5 Polyclonal Antibody, FITC Conjugated

A56489 100 µg
EUR 570.55
Description: Ask the seller for details



  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CCT6A antibody

70R-21474 50 ul
EUR 435.00
Description: Rabbit polyclonal CCT6A antibody

CCT6A Antibody

ABD4562 100 ug
EUR 438.00

CCT6A Antibody

35092-100ul 100ul
EUR 252.00

CCT6A Antibody

35092-50ul 50ul
EUR 187.00

CCT6A Antibody

DF4562 200ul
EUR 304.00
Description: CCT6A Antibody detects endogenous levels of total CCT6A.

CCT6A Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CCT6A Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

CCT6A Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCT6A Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

CCT6A Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Antibody

CSB-PA796607-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Conjugated Antibody

C35092 100ul
EUR 397.00

CCT6A cloning plasmid

CSB-CL004865HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1596
  • Show more
Description: A cloning plasmid for the CCT6A gene.

CCT6A-Specific Antibody

abx231401-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Anti-CCT6A Antibody

A09373 100ul
EUR 397.00
Description: Rabbit Polyclonal CCT6A Antibody. Validated in IHC, WB and tested in Human.

CCT6A Rabbit pAb

A3589-100ul 100 ul
EUR 308.00

CCT6A Rabbit pAb

A3589-200ul 200 ul
EUR 459.00

CCT6A Rabbit pAb

A3589-20ul 20 ul
EUR 183.00

CCT6A Rabbit pAb

A3589-50ul 50 ul
EUR 223.00

CCT6A Blocking Peptide

DF4562-BP 1mg
EUR 195.00

Anti-CCT6A antibody

STJ29904 100 µl
EUR 277.00
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, several pseudogenes of this gene have been located.


EF008482 96 Tests
EUR 689.00

anti- CCT6A-Specific antibody

FNab01401 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: chaperonin containing TCP1, subunit 6A(zeta 1)
  • Uniprot ID: P40227
  • Research Area: Metabolism
Description: Antibody raised against CCT6A-Specific

Human CCT6A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse CCT6A shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

CCT6A Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCT6A Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCT6A Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CCT6A-Specific antibody

PAab01401 100 ug
EUR 355.00

CCT6A Recombinant Protein (Human)

RP037876 100 ug Ask for price

CCT6A Recombinant Protein (Rat)

RP193820 100 ug Ask for price

CCT6A Recombinant Protein (Mouse)

RP122315 100 ug Ask for price

Cct6a ORF Vector (Mouse) (pORF)

ORF040773 1.0 ug DNA
EUR 506.00

CCT6A ORF Vector (Human) (pORF)

ORF012626 1.0 ug DNA
EUR 354.00

Cct6a ORF Vector (Rat) (pORF)

ORF064608 1.0 ug DNA
EUR 506.00

CCT6A ELISA Kit (Human) (OKCA00835)

OKCA00835 96 Wells
EUR 833.00
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. Known to play a role, in vitro, in the folding of actin and tubulin. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

CCT6A sgRNA CRISPR Lentivector set (Human)

K0397301 3 x 1.0 ug
EUR 339.00

Cct6a sgRNA CRISPR Lentivector set (Mouse)

K4782901 3 x 1.0 ug
EUR 339.00

Cct6a sgRNA CRISPR Lentivector set (Rat)

K7472001 3 x 1.0 ug
EUR 339.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 1)

K0397302 1.0 ug DNA
EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 2)

K0397303 1.0 ug DNA
EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 3)

K0397304 1.0 ug DNA
EUR 154.00

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

abx330610-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4782902 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4782903 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4782904 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 1)

K7472002 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 2)

K7472003 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 3)

K7472004 1.0 ug DNA
EUR 154.00

CCT6A Protein Vector (Human) (pPB-C-His)

PV050501 500 ng
EUR 481.00

CCT6A Protein Vector (Human) (pPB-N-His)

PV050502 500 ng
EUR 481.00

CCT6A Protein Vector (Human) (pPM-C-HA)

PV050503 500 ng
EUR 481.00

CCT6A Protein Vector (Human) (pPM-C-His)

PV050504 500 ng
EUR 481.00

CCT6A Protein Vector (Rat) (pPB-C-His)

PV258430 500 ng
EUR 603.00

CCT6A Protein Vector (Rat) (pPB-N-His)

PV258431 500 ng
EUR 603.00

CCT6A Protein Vector (Rat) (pPM-C-HA)

PV258432 500 ng
EUR 603.00

CCT6A Protein Vector (Rat) (pPM-C-His)

PV258433 500 ng
EUR 603.00

CCT6A Protein Vector (Mouse) (pPB-C-His)

PV163090 500 ng
EUR 603.00

CCT6A Protein Vector (Mouse) (pPB-N-His)

PV163091 500 ng
EUR 603.00

CCT6A Protein Vector (Mouse) (pPM-C-HA)

PV163092 500 ng
EUR 603.00

CCT6A Protein Vector (Mouse) (pPM-C-His)

PV163093 500 ng
EUR 603.00

Cct6a 3'UTR Luciferase Stable Cell Line

TU201926 1.0 ml Ask for price

Cct6a 3'UTR GFP Stable Cell Line

TU153440 1.0 ml Ask for price

CCT6A 3'UTR Luciferase Stable Cell Line

TU003839 1.0 ml
EUR 1394.00

Cct6a 3'UTR Luciferase Stable Cell Line

TU103440 1.0 ml Ask for price

CCT6A 3'UTR GFP Stable Cell Line

TU053839 1.0 ml
EUR 1394.00

Cct6a 3'UTR GFP Stable Cell Line

TU251926 1.0 ml Ask for price

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody

abx146199-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody

  • EUR 300.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Human T-complex protein 1 subunit zeta (CCT6A)

  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 61.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit zeta(CCT6A) expressed in E.coli

CCT6A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV637585 1.0 ug DNA
EUR 682.00

CCT6A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV637589 1.0 ug DNA
EUR 682.00

CCT6A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV637590 1.0 ug DNA
EUR 682.00

CCT6A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702555 1.0 ug DNA
EUR 450.00

CCT6A Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702559 1.0 ug DNA
EUR 450.00

CCT6A Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702560 1.0 ug DNA
EUR 450.00

Bovine T- complex protein 1 subunit zeta, CCT6A ELISA KIT

ELI-18866b 96 Tests
EUR 928.00

Human T- complex protein 1 subunit zeta, CCT6A ELISA KIT

ELI-18867h 96 Tests
EUR 824.00

Mouse T- complex protein 1 subunit zeta, Cct6a ELISA KIT

ELI-46486m 96 Tests
EUR 865.00

CCT6A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0397305 3 x 1.0 ug
EUR 376.00

Human T-Complex Protein 1 Subunit Zeta (CCT6A) ELISA Kit

abx352113-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4782905 3 x 1.0 ug
EUR 376.00

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit

CSB-EL004865HU-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta (CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta(CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7472005 3 x 1.0 ug
EUR 376.00


SPRN Antibody
37026-100ul 100ul
EUR 252.00
SPRN Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SPRN. Recognizes SPRN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SPRN Conjugated Antibody
C37026 100ul
EUR 397.00
Rat SPRN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human SPRN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse SPRN shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
SPRN Recombinant Protein (Rat)
RP230915 100 ug Ask for price
SPRN Recombinant Protein (Human)
RP099903 100 ug Ask for price
SPRN Recombinant Protein (Mouse)
RP175235 100 ug Ask for price
Polyclonal SPRN Antibody (C-term)
APR11291G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SPRN (C-term). This antibody is tested and proven to work in the following applications:
Sprn ORF Vector (Rat) (pORF)
ORF076973 1.0 ug DNA
EUR 506.00
SPRN ORF Vector (Human) (pORF)
ORF033302 1.0 ug DNA
EUR 405.00
Sprn ORF Vector (Mouse) (pORF)
ORF058413 1.0 ug DNA
EUR 506.00
SPRN ELISA Kit (Mouse) (OKCA01773)
OKCA01773 96 Wells
EUR 846.00
Description: Description of target: Prion-like protein that has PrP(C)-like neuroprotective activity. May act as a modulator for the biological actions of normal and abnormal PrP.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.039 ng/mL
Shadow of Prion Protein (SPRN) Antibody
abx032300-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Shadow of Prion Protein (SPRN) Antibody
abx032300-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Shadow Of Prion Protein (SPRN) Antibody
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Sprn sgRNA CRISPR Lentivector set (Rat)
K6250201 3 x 1.0 ug
EUR 339.00
Sprn sgRNA CRISPR Lentivector set (Mouse)
K4379901 3 x 1.0 ug
EUR 339.00
SPRN sgRNA CRISPR Lentivector set (Human)
K2279301 3 x 1.0 ug
EUR 339.00
Sprn sgRNA CRISPR Lentivector (Rat) (Target 1)
K6250202 1.0 ug DNA
EUR 154.00
Sprn sgRNA CRISPR Lentivector (Rat) (Target 2)
K6250203 1.0 ug DNA
EUR 154.00
Sprn sgRNA CRISPR Lentivector (Rat) (Target 3)
K6250204 1.0 ug DNA
EUR 154.00
Sprn sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4379902 1.0 ug DNA
EUR 154.00
Sprn sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4379903 1.0 ug DNA
EUR 154.00
Sprn sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4379904 1.0 ug DNA
EUR 154.00
SPRN sgRNA CRISPR Lentivector (Human) (Target 1)
K2279302 1.0 ug DNA
EUR 154.00
SPRN sgRNA CRISPR Lentivector (Human) (Target 2)
K2279303 1.0 ug DNA
EUR 154.00
SPRN sgRNA CRISPR Lentivector (Human) (Target 3)
K2279304 1.0 ug DNA
EUR 154.00
SPRN Protein Vector (Human) (pPB-C-His)
PV133206 500 ng
EUR 552.00
SPRN Protein Vector (Human) (pPB-N-His)
PV133207 500 ng
EUR 552.00
SPRN Protein Vector (Human) (pPM-C-HA)
PV133208 500 ng
EUR 552.00
SPRN Protein Vector (Human) (pPM-C-His)
PV133209 500 ng
EUR 552.00
SPRN Protein Vector (Rat) (pPB-C-His)
PV307890 500 ng
EUR 603.00
SPRN Protein Vector (Rat) (pPB-N-His)
PV307891 500 ng
EUR 603.00
SPRN Protein Vector (Rat) (pPM-C-HA)
PV307892 500 ng
EUR 603.00
SPRN Protein Vector (Rat) (pPM-C-His)
PV307893 500 ng
EUR 603.00
SPRN Protein Vector (Mouse) (pPB-C-His)
PV233650 500 ng
EUR 603.00
SPRN Protein Vector (Mouse) (pPB-N-His)
PV233651 500 ng
EUR 603.00
SPRN Protein Vector (Mouse) (pPM-C-HA)
PV233652 500 ng
EUR 603.00
SPRN Protein Vector (Mouse) (pPM-C-His)
PV233653 500 ng
EUR 603.00
Sprn 3'UTR Luciferase Stable Cell Line
TU119634 1.0 ml Ask for price
Sprn 3'UTR GFP Stable Cell Line
TU169634 1.0 ml Ask for price
Sprn 3'UTR Luciferase Stable Cell Line
TU221122 1.0 ml Ask for price
SPRN 3'UTR GFP Stable Cell Line
TU074528 1.0 ml
EUR 2333.00
Sprn 3'UTR GFP Stable Cell Line
TU271122 1.0 ml Ask for price
SPRN 3'UTR Luciferase Stable Cell Line
TU024528 1.0 ml
EUR 2333.00
Rabbit Shadow of prion protein(SPRN) ELISA kit
E04S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Shadow of prion protein(SPRN) ELISA kit
E04S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rabbit Shadow of prion protein(SPRN) ELISA kit
E04S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Shadow of prion protein(SPRN) ELISA kit
E02S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Shadow of prion protein(SPRN) ELISA kit
E02S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Rat Shadow of prion protein(SPRN) ELISA kit
E02S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Shadow of prion protein(SPRN) ELISA kit
E03S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Shadow of prion protein(SPRN) ELISA kit
E03S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Mouse Shadow of prion protein(SPRN) ELISA kit
E03S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Shadow of prion protein(SPRN) ELISA kit
E01S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Shadow of prion protein(SPRN) ELISA kit
E01S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Human Shadow of prion protein(SPRN) ELISA kit
E01S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Shadow of prion protein(SPRN) ELISA kit
E06S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Shadow of prion protein(SPRN) ELISA kit
E06S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Goat Shadow of prion protein(SPRN) ELISA kit
E06S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Shadow of prion protein(SPRN) ELISA kit
E08S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Shadow of prion protein(SPRN) ELISA kit
E08S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Dog Shadow of prion protein(SPRN) ELISA kit
E08S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Shadow of prion protein(SPRN) ELISA kit
E07S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Shadow of prion protein(SPRN) ELISA kit
E07S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Pig Shadow of prion protein(SPRN) ELISA kit
E07S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Shadow of prion protein(SPRN) ELISA kit
E09S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Shadow of prion protein(SPRN) ELISA kit
E09S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Monkey Shadow of prion protein(SPRN) ELISA kit
E09S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Chicken Shadow of prion protein, SPRN ELISA KIT
ELI-29640c 96 Tests
EUR 928.00
Bovine Shadow of prion protein, SPRN ELISA KIT
ELI-52893b 96 Tests
EUR 928.00
Human Shadow of prion protein, SPRN ELISA KIT
ELI-52894h 96 Tests
EUR 824.00
Mouse Shadow of prion protein, Sprn ELISA KIT
ELI-39480m 96 Tests
EUR 865.00
SPRN Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV641419 1.0 ug DNA
EUR 514.00
SPRN Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV641423 1.0 ug DNA
EUR 514.00
SPRN Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV641424 1.0 ug DNA
EUR 514.00
Guinea pig Shadow of prion protein(SPRN) ELISA kit
E05S0399-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Shadow of prion protein(SPRN) ELISA kit
E05S0399-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
Guinea pig Shadow of prion protein(SPRN) ELISA kit
E05S0399-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Shadow of prion protein(SPRN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
ELISA kit for Rat Shadow of prion protein (SPRN)
KTE100127-48T 48T
EUR 332.00
  • SPRN expression in human, rat, and mouse brain. The deduced human protein contains 151 amino acids. The mammalian proteins share 81 to 95% sequence identity. Alignment of all fish and mammalian Sho proteins showed that all have an N-terminal peptide
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Shadow of prion protein (SPRN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.


TFPT antibody
70R-20790 50 ul
EUR 435.00
Description: Rabbit polyclonal TFPT antibody
TFPT antibody
38938-100ul 100ul
EUR 252.00
TFPT Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TFPT. Recognizes TFPT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
PVT19038 2 ug
EUR 231.00
TFPT Conjugated Antibody
C38938 100ul
EUR 397.00
TFPT cloning plasmid
CSB-CL023439HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 762
  • Sequence: atggaattggagcagagagaagggaccatggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccggga
  • Show more
Description: A cloning plasmid for the TFPT gene.
TFPT cloning plasmid
CSB-CL023439HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 735
  • Sequence: atggcagccgtgggctttgaggagttctcagcgccgccaggctcagagttggcgttgcctcccctatttggtggccacatcctggagagcgagctggagacggaagtggagtttgtgtcaggtggtctgggcggctcagggctccgggagcgagatgaagaggaagaggcagcccg
  • Show more
Description: A cloning plasmid for the TFPT gene.
TFPT Rabbit pAb
A6461-100ul 100 ul
EUR 308.00
TFPT Rabbit pAb
A6461-200ul 200 ul
EUR 459.00
TFPT Rabbit pAb
A6461-20ul 20 ul
EUR 183.00
TFPT Rabbit pAb
A6461-50ul 50 ul
EUR 223.00
anti- TFPT antibody
FNab08635 100µg
EUR 548.75
  • Immunogen: TCF3(E2A) fusion partner(in childhood Leukemia)
  • Uniprot ID: P0C1Z6
  • Gene ID: 29844
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against TFPT
Anti-TFPT antibody
PAab08635 100 ug
EUR 386.00
Anti-TFPT antibody
STJ28544 100 µl
EUR 277.00
EF003563 96 Tests
EUR 689.00
Mouse TFPT shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat TFPT shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human TFPT shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TFPT Recombinant Protein (Rat)
RP232910 100 ug Ask for price
TFPT Recombinant Protein (Human)
RP031372 100 ug Ask for price
TFPT Recombinant Protein (Human)
RP031375 100 ug Ask for price
TFPT Recombinant Protein (Mouse)
RP178406 100 ug Ask for price
TCF3 Fusion Partner (TFPT) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
TCF3 Fusion Partner (TFPT) Antibody
abx034315-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
TCF3 Fusion Partner (TFPT) Antibody
abx034315-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
TCF3 Fusion Partner (TFPT) Antibody
abx238635-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Tfpt ORF Vector (Rat) (pORF)
ORF077638 1.0 ug DNA
EUR 506.00
TFPT ORF Vector (Human) (pORF)
ORF010458 1.0 ug DNA
EUR 95.00
TFPT ORF Vector (Human) (pORF)
ORF010459 1.0 ug DNA
EUR 95.00
Tfpt ORF Vector (Mouse) (pORF)
ORF059470 1.0 ug DNA
EUR 506.00
Polyclonal TFPT antibody - C-terminal region
APR01604G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TFPT - C-terminal region. This antibody is tested and proven to work in the following applications:
Tfpt sgRNA CRISPR Lentivector set (Mouse)
K4652201 3 x 1.0 ug
EUR 339.00
Tfpt sgRNA CRISPR Lentivector set (Rat)
K6972001 3 x 1.0 ug
EUR 339.00
TFPT sgRNA CRISPR Lentivector set (Human)
K2363501 3 x 1.0 ug
EUR 339.00
Human TCF3 Fusion Partner (TFPT) ELISA Kit
abx383724-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Human TCF3 fusion partner, TFPT ELISA KIT
ELI-37062h 96 Tests
EUR 824.00
Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4652202 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4652203 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4652204 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Rat) (Target 1)
K6972002 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Rat) (Target 2)
K6972003 1.0 ug DNA
EUR 154.00
Tfpt sgRNA CRISPR Lentivector (Rat) (Target 3)
K6972004 1.0 ug DNA
EUR 154.00
TFPT sgRNA CRISPR Lentivector (Human) (Target 1)
K2363502 1.0 ug DNA
EUR 154.00
TFPT sgRNA CRISPR Lentivector (Human) (Target 2)
K2363503 1.0 ug DNA
EUR 154.00
TFPT sgRNA CRISPR Lentivector (Human) (Target 3)
K2363504 1.0 ug DNA
EUR 154.00
TFPT Protein Vector (Rat) (pPB-C-His)
PV310550 500 ng
EUR 603.00
TFPT Protein Vector (Rat) (pPB-N-His)
PV310551 500 ng
EUR 603.00
TFPT Protein Vector (Rat) (pPM-C-HA)
PV310552 500 ng
EUR 603.00
TFPT Protein Vector (Rat) (pPM-C-His)
PV310553 500 ng
EUR 603.00
TFPT Protein Vector (Human) (pPB-C-His)
PV041829 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPB-N-His)
PV041830 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPM-C-HA)
PV041831 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPM-C-His)
PV041832 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPB-C-His)
PV041833 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPB-N-His)
PV041834 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPM-C-HA)
PV041835 500 ng
EUR 329.00
TFPT Protein Vector (Human) (pPM-C-His)
PV041836 500 ng
EUR 329.00
TFPT Protein Vector (Mouse) (pPB-C-His)
PV237878 500 ng
EUR 603.00
TFPT Protein Vector (Mouse) (pPB-N-His)
PV237879 500 ng
EUR 603.00
TFPT Protein Vector (Mouse) (pPM-C-HA)
PV237880 500 ng
EUR 603.00
TFPT Protein Vector (Mouse) (pPM-C-His)
PV237881 500 ng
EUR 603.00
Tfpt 3'UTR Luciferase Stable Cell Line
TU120405 1.0 ml Ask for price
Tfpt 3'UTR GFP Stable Cell Line
TU170405 1.0 ml Ask for price
Tfpt 3'UTR Luciferase Stable Cell Line
TU221815 1.0 ml Ask for price
TFPT 3'UTR GFP Stable Cell Line
TU075474 1.0 ml
EUR 1394.00
Tfpt 3'UTR GFP Stable Cell Line
TU271815 1.0 ml Ask for price
TFPT 3'UTR Luciferase Stable Cell Line
TU025474 1.0 ml
EUR 1394.00
Bovine TCF3 fusion partner homolog, TFPT ELISA KIT
ELI-18981b 96 Tests
EUR 928.00
TFPT Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV715803 1.0 ug DNA
EUR 316.00
TFPT Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV715807 1.0 ug DNA
EUR 316.00
TFPT Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV715808 1.0 ug DNA
EUR 316.00
Mouse TCF3 fusion partner homolog, Tfpt ELISA KIT
ELI-41794m 96 Tests
EUR 865.00


GGCX antibody

70R-17470 50 ul
EUR 435.00
Description: Rabbit polyclonal GGCX antibody

GGCX Antibody

36501-100ul 100ul
EUR 252.00

GGCX Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GGCX Antibody

DF12616 200ul
EUR 304.00
Description: GGCX Antibody detects endogenous levels of GGCX.

GGCX Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

GGCX antibody

70R-6289 50 ug
EUR 467.00
Description: Rabbit polyclonal GGCX antibody raised against the middle region of GGCX

GGCX Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GGCX Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


YF-PA23776 50 ul
EUR 334.00
Description: Mouse polyclonal to GGCX

GGCX Blocking Peptide

33R-2973 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GGCX antibody, catalog no. 70R-6289

GGCX Blocking Peptide

DF12616-BP 1mg
EUR 195.00

GGCX Conjugated Antibody

C36501 100ul
EUR 397.00

GGCX cloning plasmid

CSB-CL009388HU-10ug 10ug
EUR 474.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2277
  • Sequence: atggcggtgtctgccgggtccgcgcggacctcgcccagctcagataaagtacagaaagacaaggctgaactgatctcagggcccaggcaggacagccgaatagggaaactcttgggttttgagtggacagatttgtccagttggcggaggctggtgaccctgctgaatcgaccaa
  • Show more
Description: A cloning plasmid for the GGCX gene.

GGCX Rabbit pAb

A1806-100ul 100 ul
EUR 308.00

GGCX Rabbit pAb

A1806-200ul 200 ul
EUR 459.00

GGCX Rabbit pAb

A1806-20ul 20 ul
EUR 183.00

GGCX Rabbit pAb

A1806-50ul 50 ul
EUR 223.00

anti- GGCX antibody

FNab03444 100µg
EUR 505.25
  • Immunogen: gamma-glutamyl carboxylase
  • Uniprot ID: P38435
  • Gene ID: 2677
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GGCX

Anti-GGCX antibody

PAab03444 100 ug
EUR 355.00

Anti-GGCX antibody

STJ111114 100 µl
EUR 277.00
Description: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.

Anti-GGCX Antibody

STJ501151 100 µg
EUR 476.00

Anti-GGCX antibody

STJ71959 100 µg
EUR 359.00


EF009845 96 Tests
EUR 689.00

Mouse GGCX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat GGCX shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GGCX Antibody, HRP conjugated

  • EUR 317.00