Stoml2

STOML2 antibody
70R-10371 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal STOML2 antibody
STOML2 antibody
70R-20609 50 ul
EUR 435.00
Description: Rabbit polyclonal STOML2 antibody
STOML2 Antibody
39917-100ul 100ul
EUR 390.00
STOML2 Antibody
1-CSB-PA892131ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
STOML2 Antibody
DF12010 200ul
EUR 304.00
Description: STOML2 antibody detects endogenous levels of STOML2.
STOML2 Antibody
1-CSB-PA022864GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against STOML2. Recognizes STOML2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
STOML2 siRNA
20-abx905340
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
STOML2 siRNA
20-abx935507
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
STOML2 siRNA
20-abx935508
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
pOTB7-STOML2
PVT19033 2 ug
EUR 231.00
anti-STOML2
YF-PA18713 50 ug
EUR 363.00
Description: Mouse polyclonal to STOML2
anti-STOML2
YF-PA18714 100 ul
EUR 403.00
Description: Rabbit polyclonal to STOML2
anti-STOML2
YF-PA18715 100 ug
EUR 403.00
Description: Rabbit polyclonal to STOML2
STOML2 Polyclonal Antibody
27419-100ul 100ul
EUR 252.00
STOML2 Polyclonal Antibody
27419-50ul 50ul
EUR 187.00
STOML2 Rabbit pAb
A10398-100ul 100 ul
EUR 308.00
STOML2 Rabbit pAb
A10398-200ul 200 ul
EUR 459.00
STOML2 Rabbit pAb
A10398-20ul 20 ul
EUR 183.00
STOML2 Rabbit pAb
A10398-50ul 50 ul
EUR 223.00
STOML2 Blocking Peptide
33R-9858 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STOML2 antibody, catalog no. 70R-10371
STOML2 cloning plasmid
CSB-CL892131HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.
STOML2 cloning plasmid
CSB-CL892131HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1071
  • Sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcc
  • Show more
Description: A cloning plasmid for the STOML2 gene.
STOML2 Blocking Peptide
DF12010-BP 1mg
EUR 195.00
STOML2 Rabbit pAb
A4688-100ul 100 ul
EUR 308.00
STOML2 Rabbit pAb
A4688-200ul 200 ul
EUR 459.00
STOML2 Rabbit pAb
A4688-20ul 20 ul Ask for price
STOML2 Rabbit pAb
A4688-50ul 50 ul Ask for price
anti- STOML2 antibody
FNab08346 100µg
EUR 548.75
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2
anti- STOML2 antibody
FNab08347 100µg
EUR 548.75
  • Recommended dilution: WB: 1:2000-1:10000
  • IP: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: stomatin(EPB72)-like 2
  • Uniprot ID: Q9UJZ1
  • Gene ID: 30968
  • Research Area: cancer
Description: Antibody raised against STOML2
Anti-STOML2 antibody
PAab08346 100 ug
EUR 386.00
pENTR223-STOML2 vector
PVT12019 2 ug
EUR 308.00
pOTB7-stoml2 Plasmid
PVTB00105 2 ug
EUR 356.00
pOTB7-STOML2 Plasmid
PVTB00250S 2 ug
EUR 356.00
Anti-STOML2 antibody
STJ25737 100 µl
EUR 277.00
Anti-STOML2 antibody
STJ112434 100 µl
EUR 277.00
Polyclonal STOML2 Antibody (Center)
APR04539G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STOML2 (Center). This antibody is tested and proven to work in the following applications:
STOML2 ELISA KIT|Human
EF003324 96 Tests
EUR 689.00
Rat STOML2 shRNA Plasmid
20-abx988911
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Mouse STOML2 shRNA Plasmid
20-abx975687
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
STOML2 Polyclonal Conjugated Antibody
C27419 100ul
EUR 397.00
Human STOML2 shRNA Plasmid
20-abx959362
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
STOML2 Recombinant Protein (Rat)
RP231512 100 ug Ask for price
pCMV-SPORT6-Stoml2-m
PVT18858 2 ug
EUR 231.00
STOML2 Recombinant Protein (Human)
RP030469 100 ug Ask for price
STOML2 Recombinant Protein (Human)
RP030472 100 ug Ask for price
STOML2 Recombinant Protein (Mouse)
RP176132 100 ug Ask for price
Stomatin Like 2 (STOML2) Antibody
20-abx003539
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
20-abx126669
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
abx036120-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
abx031486-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
abx031486-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Stomatin Like 2 (STOML2) Antibody
abx238346-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Stomatin Like 2 (STOML2) Antibody
abx238347-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Stomatin Like 2 (STOML2) Antibody
20-abx321350
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Stoml2 ORF Vector (Rat) (pORF)
ORF077172 1.0 ug DNA
EUR 506.00
STOML2 ORF Vector (Human) (pORF)
ORF010157 1.0 ug DNA
EUR 95.00
STOML2 ORF Vector (Human) (pORF)
ORF010158 1.0 ug DNA
EUR 95.00
Stoml2 ORF Vector (Mouse) (pORF)
ORF058712 1.0 ug DNA
EUR 506.00
Stoml2 sgRNA CRISPR Lentivector set (Rat)
K7189501 3 x 1.0 ug
EUR 339.00
Stoml2 sgRNA CRISPR Lentivector set (Mouse)
K4605401 3 x 1.0 ug
EUR 339.00
STOML2 sgRNA CRISPR Lentivector set (Human)
K2305701 3 x 1.0 ug
EUR 339.00
Human Stomatin Like 2 (STOML2) ELISA Kit
abx383537-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7189502 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7189503 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7189504 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4605402 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4605403 1.0 ug DNA
EUR 154.00
Stoml2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4605404 1.0 ug DNA
EUR 154.00
STOML2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2305702 1.0 ug DNA
EUR 154.00
STOML2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2305703 1.0 ug DNA
EUR 154.00
STOML2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2305704 1.0 ug DNA
EUR 154.00
STOML2 Protein Vector (Rat) (pPB-C-His)
PV308686 500 ng
EUR 603.00
STOML2 Protein Vector (Rat) (pPB-N-His)
PV308687 500 ng
EUR 603.00
STOML2 Protein Vector (Rat) (pPM-C-HA)
PV308688 500 ng
EUR 603.00
STOML2 Protein Vector (Rat) (pPM-C-His)
PV308689 500 ng
EUR 603.00
STOML2 Protein Vector (Human) (pPB-C-His)
PV040625 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPB-N-His)
PV040626 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPM-C-HA)
PV040627 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPM-C-His)
PV040628 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPB-C-His)
PV040629 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPB-N-His)
PV040630 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPM-C-HA)
PV040631 500 ng
EUR 329.00
STOML2 Protein Vector (Human) (pPM-C-His)
PV040632 500 ng
EUR 329.00
STOML2 Protein Vector (Mouse) (pPB-C-His)
PV234846 500 ng
EUR 603.00
STOML2 Protein Vector (Mouse) (pPB-N-His)
PV234847 500 ng
EUR 603.00

Sucrase

Sucrase Isomaltase (SI) Antibody
20-abx174654
  • EUR 857.00
  • EUR 439.00
  • 0
  • 1
  • Please enquire.
Sucrase (Plant) Assay Kit
abx298803-100Assays 100 Assays
EUR 425.00
  • Shipped within 5-10 working days.
Recombinant Sucrase Isomaltase (SI)
4-RPD186Hu01
  • EUR 530.08
  • EUR 245.00
  • EUR 1712.80
  • EUR 637.60
  • EUR 1175.20
  • EUR 418.00
  • EUR 4132.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P14410
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Sucrase Isomaltase expressed in: E.coli
Human Sucrase Isomaltase (SI) Protein
20-abx069183
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.
Sucrase Isomaltase (SI) Antibody (FITC)
20-abx273608
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.
Sucrase Isomaltase (SI) Antibody (Biotin)
20-abx272320
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.
Recombinant human Sucrase-isomaltase, intestinal
P2291 100ug Ask for price
  • Uniprot ID: P14410
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Sucrase-isomaltase, intestinal
Human Sucrase Isomaltase (SI) ELISA Kit
abx572795-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.
Human Sucrase Isomaltase (SI) ELISA Kit
20-abx153187
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.
Chicken Sucrase Isomaltase (SI) ELISA Kit
abx357201-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.
Human Sucrase Isomaltase (SI) CLIA Kit
20-abx494128
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2
  • Please enquire.
Rat Sucrase Isomaltase (SI) ELISA Kit
abx392028-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
Human Sucrase Isomaltase (SI) ELISA Kit
DLR-SI-Hu-48T 48T
EUR 517.00
  • Should the Human Sucrase Isomaltase (SI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sucrase Isomaltase (SI) in samples from tissue homogenates or other biological fluids.
Human Sucrase Isomaltase (SI) ELISA Kit
DLR-SI-Hu-96T 96T
EUR 673.00
  • Should the Human Sucrase Isomaltase (SI) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Sucrase Isomaltase (SI) in samples from tissue homogenates or other biological fluids.
Sucrase Isomaltase (SI) Polyclonal Antibody (Human)
4-PAD186Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: sucrase isomaltase (Asn1717~Ser1827)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sucrase Isomaltase (SI)
Human Sucrase Isomaltase (SI) ELISA Kit
RD-SI-Hu-48Tests 48 Tests
EUR 521.00
Human Sucrase Isomaltase (SI) ELISA Kit
RD-SI-Hu-96Tests 96 Tests
EUR 723.00
Human Sucrase Isomaltase (SI) ELISA Kit
RDR-SI-Hu-48Tests 48 Tests
EUR 544.00
Human Sucrase Isomaltase (SI) ELISA Kit
RDR-SI-Hu-96Tests 96 Tests
EUR 756.00
Human Sucrase Isomaltase(SI)ELISA Kit
QY-E00272 96T
EUR 361.00
Human Sucrase Isomaltase (SI) ELISA Kit
SED186Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sucrase Isomaltase (SI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sucrase Isomaltase (SI) in Tissue homogenates and other biological fluids.
Human Sucrase Isomaltase (SI) ELISA Kit
SED186Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.30
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sucrase Isomaltase (SI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sucrase Isomaltase (SI) in Tissue homogenates and other biological fluids.
Human Sucrase Isomaltase (SI) ELISA Kit
SED186Hu-1x96wellstestplate 1x96-wells test plate
EUR 639.00
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sucrase Isomaltase (SI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sucrase Isomaltase (SI) in Tissue homogenates and other biological fluids.
Human Sucrase Isomaltase (SI) ELISA Kit
SED186Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Sucrase Isomaltase (SI) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Sucrase Isomaltase (SI) in Tissue homogenates and other biological fluids.
Human Sucrase Isomaltase (SI) ELISA Kit
4-SED186Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 0
  • 1
  • 2
  • Known also as Sucrase Isomaltase elisa. Alternative names of the recognized antigen: Oligosaccharide Alpha-1, 6-Glucosidase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Sucrase Isomaltase (SI) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.
SUCRASE-ISOMALTASE ELISA Kit (Human) (OKCD00898)
OKCD00898 96 Wells
EUR 831.00
Description: Description of target: Plays an important role in the final stage of carbohydrate digestion. Isomaltase activity is specific for both alpha-1,4- and alpha-1,6-oligosaccharides.1 Publication <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.7"Structural basis for substrate selectivity in human maltase-glucoamylase and sucrase-isomaltase N-terminal domains."_x005F_x005F_x000D_Sim L., Willemsma C., Mohan S., Naim H.Y., Pinto B.M., Rose D.R._x005F_x005F_x000D_J. Biol. Chem. 285:17763-17770(2010) [PubMed] [Europe PMC] [Abstract]Cited for: X-RAY CRYSTALLOGRAPHY (2.15 ANGSTROMS) OF 62-931 ALONE AND IN COMPLEX WITH INHIBITOR, GLYCOSYLATION AT ASN-99; ASN-455; ASN-855 AND ASN-904, FUNCTION, ACTIVE SITE, SUBSTRATE-BINDING SITES, DISULFIDE BONDS. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.107 ng/mL
ELISA kit for Human SI (Sucrase Isomaltase)
E-EL-H2493 1 plate of 96 wells
EUR 534.00
  • Gentaur's SI ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human SI. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human SI (Sucrase Isomaltase) in samples from Serum, Plasma, Cell supernatant
Rabbit Sucrase- isomaltase, intestinal, SI ELISA KIT
ELI-18541Ra 96 Tests
EUR 928.00
ELISA kit for Human SI (Sucrase Isomaltase)
ELK4074 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Sucrase Isomaltase (SI). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Sucrase Is
  • Show more
Description: A sandwich ELISA kit for detection of Sucrase Isomaltase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.
Human Sucrase- isomaltase, intestinal, SI ELISA KIT
ELI-29280h 96 Tests
EUR 824.00
Porcine Sucrase- isomaltase, intestinal, SI ELISA KIT
ELI-40899p 96 Tests
EUR 928.00
Sucrase Isomaltase (SI) Polyclonal Antibody (Human), APC
4-PAD186Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: sucrase isomaltase (Asn1717~Ser1827)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sucrase Isomaltase (SI). This antibody is labeled with APC.
Sucrase Isomaltase (SI) Polyclonal Antibody (Human), Biotinylated
4-PAD186Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: sucrase isomaltase (Asn1717~Ser1827)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sucrase Isomaltase (SI). This antibody is labeled with Biotin.
Sucrase Isomaltase (SI) Polyclonal Antibody (Human), Cy3
4-PAD186Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: sucrase isomaltase (Asn1717~Ser1827)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sucrase Isomaltase (SI). This antibody is labeled with Cy3.
Sucrase Isomaltase (SI) Polyclonal Antibody (Human), FITC
4-PAD186Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: sucrase isomaltase (Asn1717~Ser1827)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sucrase Isomaltase (SI). This antibody is labeled with FITC.
Sucrase Isomaltase (SI) Polyclonal Antibody (Human), HRP
4-PAD186Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: sucrase isomaltase (Asn1717~Ser1827)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sucrase Isomaltase (SI). This antibody is labeled with HRP.
Sucrase Isomaltase (SI) Polyclonal Antibody (Human), PE
4-PAD186Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: sucrase isomaltase (Asn1717~Ser1827)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sucrase Isomaltase (SI). This antibody is labeled with PE.
ELISA kit for Human Sucrase-isomaltase, intestinal (SI)
KTE60665-48T 48T
EUR 332.00
  • Congenital sucrase-isomaltase deficiency is an example of a disease in which mutation results in transport-incompetent molecules. sucrase-isomaltase is not transported to the brush border membrane but accumulates as a mannose-rich precursor in the en
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sucrase-isomaltase, intestinal (SI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Sucrase-isomaltase, intestinal (SI)
KTE60665-5platesof96wells 5 plates of 96 wells
EUR 2115.00
  • Congenital sucrase-isomaltase deficiency is an example of a disease in which mutation results in transport-incompetent molecules. sucrase-isomaltase is not transported to the brush border membrane but accumulates as a mannose-rich precursor in the en
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sucrase-isomaltase, intestinal (SI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
ELISA kit for Human Sucrase-isomaltase, intestinal (SI)
KTE60665-96T 96T
EUR 539.00
  • Congenital sucrase-isomaltase deficiency is an example of a disease in which mutation results in transport-incompetent molecules. sucrase-isomaltase is not transported to the brush border membrane but accumulates as a mannose-rich precursor in the en
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Sucrase-isomaltase, intestinal (SI) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
Sucrase Isomaltase (SI) Polyclonal Antibody (Human), APC-Cy7
4-PAD186Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: sucrase isomaltase (Asn1717~Ser1827)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Sucrase Isomaltase (SI). This antibody is labeled with APC-Cy7.
Recombinant Vibrio Cholerae Sucrase Protein (aa 1-546)
VAng-Cr2557-inquire inquire Ask for price
Description: Vibrio Cholerae probable sucrose-6-phosphate hydrolase, partial (Sucrase), recombinant protein.
Si ELISA Kit| Rat Sucrase-isomaltase, intestinal ELISA Kit
EF019388 96 Tests
EUR 689.00

Tacrine

Tacrine hydrochloride
B6527-5.1 10 mM (in 1mL DMSO)
EUR 108.00
bis(7)-Tacrine
C4594-10 10 mg
EUR 219.00
Description: IC50: 0.40 nMbis(7)-Tacrine is an AChE inhibitor. Acetylcholinesterase ( AChE), the primary cholinesterase in the body, is an enzyme catalyzing the breakdown of acetylcholine and of some other choline esters that function as neurotransmitters.
bis(7)-Tacrine
C4594-100 100 mg
EUR 1297.00
Description: IC50: 0.40 nMbis(7)-Tacrine is an AChE inhibitor. Acetylcholinesterase ( AChE), the primary cholinesterase in the body, is an enzyme catalyzing the breakdown of acetylcholine and of some other choline esters that function as neurotransmitters.
bis(7)-Tacrine
C4594-5 5 mg
EUR 138.00
Description: IC50: 0.40 nMbis(7)-Tacrine is an AChE inhibitor. Acetylcholinesterase ( AChE), the primary cholinesterase in the body, is an enzyme catalyzing the breakdown of acetylcholine and of some other choline esters that function as neurotransmitters.
bis(7)-Tacrine
C4594-50 50 mg
EUR 763.00
Description: IC50: 0.40 nMbis(7)-Tacrine is an AChE inhibitor. Acetylcholinesterase ( AChE), the primary cholinesterase in the body, is an enzyme catalyzing the breakdown of acetylcholine and of some other choline esters that function as neurotransmitters.
Tacrine hydrochloride hydrate
HY-B2244 100mg
EUR 119.00

Src Kinase

Src I1 (Src kinase inhibitor)
SIH-478-5MG 5 mg
EUR 132.00
  • SrcI1 is a potent and competitive dual site Src kinase inhibitor. It has been shown as a potent inhibitor of the Src and Lck kinase, as well as, VEGFR2 and c-fms. SrcI1 is cell permeable and can induce apoptosis.
Description: The substance Src I1 is a src kinase inhibitor. It is synthetically produced and has a purity of ?98%. The pure substance is off-white solid which is soluble in DMSO (5 mg/ml).
SRC Kinase Substrate
5-01957 4 x 1mg Ask for price
SRC Kinase Substrate, amide
5-01958 4 x 1mg Ask for price
PP1 (Src kinase inhibitor)
SIH-469-25MG 25 mg
EUR 619.00
  • PP1 is a potent and selective Src family protein tyrosine kinase inhibitor. This has a range of effects and implications. Structural studies have revealed that PP1 binds to the ATP-binding site in tyrosine kinases and Ser/Thr kinases. PP1 displays >
  • Show more
Description: The substance PP1 is a src kinase inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is tan solid which is soluble in DMSO (25 mg/ml), slightly soluble in 100% ethanol.
PP1 (Src kinase inhibitor)
SIH-469-5MG 5 mg
EUR 205.00
  • PP1 is a potent and selective Src family protein tyrosine kinase inhibitor. This has a range of effects and implications. Structural studies have revealed that PP1 binds to the ATP-binding site in tyrosine kinases and Ser/Thr kinases. PP1 displays >
  • Show more
Description: The substance PP1 is a src kinase inhibitor. It is synthetically produced and has a purity of >98%. The pure substance is tan solid which is soluble in DMSO (25 mg/ml), slightly soluble in 100% ethanol.
PP2 (Src kinase inhibitor)
SIH-470-25MG 25 mg
EUR 737.00
  • PP2 is a selective inhibitor of Src-family tyrosine kinases. PP2 has been shown to inhibit Lck, FynT, and phosphorylation of focal adhesion kinase (FAK) and potently inhibits Hck, Lck (p56) and Fyn (p59). PP2 displays > 10000-fold selectivity over ZA
  • Show more
Description: The substance PP2 is a src kinase inhibitor. It is synthetically produced and has a purity of ?98%. The pure substance is off-white solid which is soluble in DMSO (25 mg/ml).
PP2 (Src kinase inhibitor)
SIH-470-5MG 5 mg
EUR 233.00
  • PP2 is a selective inhibitor of Src-family tyrosine kinases. PP2 has been shown to inhibit Lck, FynT, and phosphorylation of focal adhesion kinase (FAK) and potently inhibits Hck, Lck (p56) and Fyn (p59). PP2 displays > 10000-fold selectivity over ZA
  • Show more
Description: The substance PP2 is a src kinase inhibitor. It is synthetically produced and has a purity of ?98%. The pure substance is off-white solid which is soluble in DMSO (25 mg/ml).
Human Proto-oncogene tyrosine-protein kinase Src (SRC)
1-CSB-EP022650HU
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 64.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proto-oncogene tyrosine-protein kinase Src(SRC) expressed in E.coli
Human Proto-oncogene tyrosine-protein kinase Src (SRC)
1-CSB-EP022650HUe1
  • EUR 727.00
  • EUR 425.00
  • EUR 1943.00
  • EUR 1055.00
  • EUR 1335.00
  • EUR 513.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 59.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Proto-oncogene tyrosine-protein kinase Src(SRC) expressed in E.coli
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx025552-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx025552-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx016001-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx016059-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx213975
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx214066
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx116642
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx125251
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx126647
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx012187-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx012880
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx031114-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx031114-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx033642-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx033642-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx034016-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx034016-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx034619-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx034619-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx238216-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx328962
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx329483
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
abx332044-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx327361
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx327922
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx328211
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) Antibody
20-abx000684
  • EUR 411.00
  • EUR 592.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
Human Proto-oncogene tyrosine-protein kinase Src(SRC) ELISA kit
CSB-EL022650HU-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Proto-oncogene tyrosine-protein kinase Src (SRC) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.
Human Proto-oncogene tyrosine-protein kinase Src(SRC) ELISA kit
1-CSB-EL022650HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Proto-oncogene tyrosine-protein kinase Src(SRC) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase (SRC) ELISA Kit
abx595560-96tests 96 tests
EUR 637.00
  • Shipped within 1-2 weeks.
C-Src Tyrosine Kinase (CSK) Antibody
20-abx111828
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
C-Src Tyrosine Kinase (CSK) Antibody
20-abx130923
  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Recombinant C-Src Tyrosine Kinase (CSK)
4-RPC349Hu01
  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P41240
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human C-Src Tyrosine Kinase expressed in: E.coli
Recombinant RSV SRC Kinase Protein [GST]
VAng-Lsx0457-inquire inquire Ask for price
Description: RSV SRC kinase [GST], recombinant protein from Baculovirus.
Picro-Sirius Red Stain Kit (For Cardiac Muscle)
SRC-1 1 kit(s)
EUR 103.00
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase Phospho-Tyr529 (SRC pY529) Antibody
20-abx012565
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase Phospho-Ser75 (SRC pS75) Antibody
20-abx328963
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase Phospho-Tyr529 (SRC pY529) Antibody
20-abx329914
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase Phospho-Tyr216 (SRC pY216) Antibody
20-abx328212
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase Phospho-Tyr419 (SRC pY419) Antibody
20-abx328470
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC Proto-Oncogene, Non-Receptor Tyrosine Kinase Phospho-Tyr529 (SRC pY529) Antibody
abx333217-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.
Human Src kinase-associated phosphoprotein 1 (SKAP1)
1-CSB-EP769799HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 57.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Src kinase-associated phosphoprotein 1(SKAP1) expressed in E.coli
Src Kinase Associated Phosphoprotein 2 (SKAP2) Antibody
20-abx004928
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Src kinase-associated phosphoprotein 1 Antibody (Biotin)
20-abx105936
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Src kinase-associated phosphoprotein 1 Antibody (FITC)
20-abx107351
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Src kinase-associated phosphoprotein 1 Antibody (HRP)
20-abx108772
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Src Kinase-Associated Phosphoprotein 1 (SKAP1) Antibody
20-abx110226
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Src Kinase Associated Phosphoprotein 1 (SKAP1) Antibody
20-abx115817
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Src Kinase Associated Phosphoprotein 2 (SKAP2) Antibody
20-abx115818
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Src Kinase Associated Phosphoprotein 1 (SKAP1) Antibody
20-abx131560
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Src Kinase Associated Phosphoprotein 1 (SKAP1) Antibody
20-abx131561
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Human C-Src Tyrosine Kinase (CSK) Protein
20-abx168911
  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Src Kinase Associated Phosphoprotein 2 (SKAP2) Antibody
abx029518-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Src Kinase Associated Phosphoprotein 2 (SKAP2) Antibody
abx029518-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Src Kinase Associated Phosphoprotein 1 (SKAP1) Antibody
abx030585-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Src Kinase Associated Phosphoprotein 1 (SKAP1) Antibody
abx030585-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
Src Kinase Associated Phosphoprotein 2 (SKAP2) Antibody
abx237890-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Src Kinase Associated Phosphoprotein 2 (SKAP2) Antibody
20-abx320718
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SRC kinase signaling inhibitor 1 (SRCIN1) Antibody
abx331175-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.
SRC kinase signaling inhibitor 1 (SRCIN1) Antibody
20-abx327632
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Recombinant Src Kinase Associated Phosphoprotein 1 (SKAP1)
4-RPC846Mu01
  • EUR 487.07
  • EUR 233.00
  • EUR 1551.52
  • EUR 583.84
  • EUR 1067.68
  • EUR 389.00
  • EUR 3728.80
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q3UUV5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Src Kinase Associated Phosphoprotein 1 expressed in: E.coli
Recombinant Src Kinase Associated Phosphoprotein 1 (SKAP1)
4-RPC846Ra01
  • EUR 496.03
  • EUR 236.00
  • EUR 1585.12
  • EUR 595.04
  • EUR 1090.08
  • EUR 395.00
  • EUR 3812.80
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q4V7G1
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Src Kinase Associated Phosphoprotein 1 expressed in: E.coli
c-SRC (c-SRC) Antibody
20-abx007517
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
c-SRC (c-SRC) Antibody
20-abx008688
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
Src/ Rat Src ELISA Kit
ELI-18125r 96 Tests
EUR 886.00
c-SRC (c-SRC) Antibody
abx232027-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.
c-SRC (c-SRC) Antibody
abx232028-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.
Biotin-RR-SRC, Insulin Receptor Tyrosine Kinase Substrate
5-00818 4 x 5mg Ask for price
Mouse Src Kinase Associated Phosphoprotein 1 (SKAP1) Protein
20-abx650208
  • EUR 676.00
  • EUR 286.00
  • EUR 2096.00
  • EUR 815.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Rat Src Kinase Associated Phosphoprotein 1 (SKAP1) Protein
20-abx650209
  • EUR 690.00
  • EUR 286.00
  • EUR 2138.00
  • EUR 829.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
C-Src Tyrosine Kinase (CSK) Polyclonal Antibody (Human)
4-PAC349Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: CSK (Leu243~Glu438)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human C-Src Tyrosine Kinase (CSK)
CSK C-Src Tyrosine Kinase Human Recombinant Protein
PROTP41240 Regular: 10ug
EUR 317.00
Description: CSK Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 473 amino acids (1-450) and having a molecular mass of 53.1 kDa.;The CSK is fused to a 23 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.
Src antibody
20R-2005 50 ug
EUR 281.00
Description: Rabbit polyclonal Src antibody
Src antibody
20R-2336 50 ug
EUR 281.00
Description: Rabbit polyclonal Src antibody
SRC antibody
70R-20514 50 ul
EUR 435.00
Description: Rabbit polyclonal SRC antibody
Src antibody
70R-13956 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal Src antibody

Sots

Product not found

Sox2

Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
DLR-SOX2-Ra-96T 96T
EUR 661.00
  • Should the Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Sex Determining Region Y Box Protein 2 (SOX2) in samples from tissue homogenates, cell lysates or other biological fluids.
Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RD-SOX2-Ra-48Tests 48 Tests
EUR 511.00
Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RD-SOX2-Ra-96Tests 96 Tests
EUR 709.00
Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RDR-SOX2-Ra-48Tests 48 Tests
EUR 534.00
Rat Sex Determining Region Y Box Protein 2 (SOX2) ELISA Kit
RDR-SOX2-Ra-96Tests 96 Tests
EUR 742.00
SOX2
GT15098 100 ug.
EUR 539.00
SOX2
P25021 50 ul. Blocking Peptide
EUR 174.00
SOX2
MO15040 100 ug
EUR 435.00
SOX2
RA25021 100 ul
EUR 409.00
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUM1791-50 50uL
EUR 395.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), 1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUM1792-50 50uL
EUR 395.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), 1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUB1791-100 100uL
EUR 209.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNUB1791-500 500uL
EUR 458.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791), Concentration: 0.2mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUB1792-100 100uL
EUR 209.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNUB1792-500 500uL
EUR 458.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792), Concentration: 0.2mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC551791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC551791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF555 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC551792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC551792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF555 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC611791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC611791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF660R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC611792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC611792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF660R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC471791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC471791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF647 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC471792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC471792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF647 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC051791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC051791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405M conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC051792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC051792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405M conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC401791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC401791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF640R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC401792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC401792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF640R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC431791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC431791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF543 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC431792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC431792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF543 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC041791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC041791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF405S conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC041792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC041792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF405S conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC701791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC701791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF770 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC701792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC701792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF770 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC801791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC801791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC801792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC801792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCH1791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCH1791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCH1792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCH1792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCP1791-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),PerCP conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCP1792-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),PerCP conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCR1791-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),RPE conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCR1792-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),RPE conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC941791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC941791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF594 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC941792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC941792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF594 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCA1791-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),APC conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCA1792-250 250uL
EUR 383.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),APC conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCB1791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCB1791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Biotin conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCB1792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCB1792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Biotin conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC881791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC881791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF488A conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC881792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF488A conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC881792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF488A conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC681791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF568 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC681791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF568 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC681792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF568 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC681792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF568 conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCAP1791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNCAP1791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCAP1792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNCAP1792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC811791-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1791) Antibody
BNC811791-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1791),CF680R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC811792-100 100uL
EUR 199.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680R conjugate, Concentration: 0.1mg/mL
SOX2 (Transcription Factor) (SOX2/1792) Antibody
BNC811792-500 500uL
EUR 544.00
Description: Primary antibody against SOX2 (Transcription Factor) (SOX2/1792),CF680R conjugate, Concentration: 0.1mg/mL

Srebp

SREBP-1c Antibody
AF4728 200ul
EUR 376.00
Description: SREBP-1c Antibody detects endogenous levels of SREBP-1c.
SREBP-1 Antibody
AF6283 200ul
EUR 304.00
Description: SREBP-1 Antibody detects endogenous levels of total SREBP-1.
SREBP-1 Antibody
AF7799 200ul
EUR 376.00
Description: SREBP-1 Antibody detects endogenous levels of SREBP-1.
SREBP- 1 Antibody
ABF6283 100 ug
EUR 438.00
pGreenFire1-SREBP (plasmid)
TR028PA-1 10 ug
EUR 786.00
  • Category: Lentiviral Technology
pGreenFire1-SREBP (virus)
TR028VA-1 >2 x 10^6 IFUs
EUR 786.00
  • Category: Lentiviral Technology
SREBP-1 Polyclonal Antibody
41458-100ul 100ul
EUR 252.00
SREBP-1 Polyclonal Antibody
41458-50ul 50ul
EUR 187.00
SREBP-1 Polyclonal Antibody
41878-100ul 100ul
EUR 252.00
SREBP-1 Polyclonal Antibody
41878-50ul 50ul
EUR 187.00
SREBP-2 (pS455) Antibody
abx218756-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.
SREBP-1 (pS439) Antibody
abx012086-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.
Human SREBP ELISA Kit
EHR0370 96Tests
EUR 521.00
Bovine SREBP ELISA Kit
EBR0370 96Tests
EUR 521.00
Bovine SREBP ELISA Kit
EBS0008 96Tests
EUR 521.00
Anserini SREBP ELISA Kit
EAS0008 96Tests
EUR 521.00
Chicken SREBP ELISA Kit
ECKR0370 96Tests
EUR 521.00
Canine SREBP ELISA Kit
ECR0370 96Tests
EUR 521.00
Canine SREBP ELISA Kit
ECS0008 96Tests
EUR 521.00
Goat SREBP ELISA Kit
EGTR0370 96Tests
EUR 521.00
Goat SREBP ELISA Kit
EGTS0008 96Tests
EUR 521.00
SREBP-1c Blocking Peptide
AF4728-BP 1mg
EUR 195.00
SREBP-1 Blocking Peptide
AF6283-BP 1mg
EUR 195.00
SREBP-1 Blocking Peptide
AF7799-BP 1mg
EUR 195.00
SREBP-1 Polyclonal Antibody
ABP52497-003ml