Category: Epitope

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
DLR-SUMO2-Hu-96T	DL Develop	96T	EUR 673.00
Should the Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RD-SUMO2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521.00

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RD-SUMO2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723.00

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RDR-SUMO2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544.00

Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RDR-SUMO2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756.00

SUMO2
E541-030	EnoGene	100ug	EUR 343.00

SUMO2/3 (SUMO2/3) Antibody
20-abx008699	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody
abx026675-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody
abx026675-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody
abx026676-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody
abx026676-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody
abx026683-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody
abx026683-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

SUMO2/3 (SUMO2/3) Antibody
abx238390-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

SUMO2/3 (SUMO2/3) Antibody
abx238391-100ug	Abbexa	100 ug	EUR 551.00
Shipped within 5-12 working days.

Sumo2/ Rat Sumo2 ELISA Kit
ELI-52173r	Lifescience Market	96 Tests	EUR 886.00

SUMO2 protein
30R-1289	Fitzgerald	100 ug	EUR 268.00
Description: Purified recombinant Human SUMO2 protein

SUMO2 protein
30R-2786	Fitzgerald	100 ug	EUR 336.00
Description: Purified recombinant Human SUMO2 protein

SUMO2 antibody
70R-20650	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal SUMO2 antibody

SUMO2 Antibody
32722-100ul	SAB	100ul	EUR 252.00

SUMO2 antibody
38405-100ul	SAB	100ul	EUR 252.00

SUMO2 antibody
10R-1181	Fitzgerald	100 ul	EUR 316.00
Description: Mouse monoclonal SUMO2 antibody

SUMO2 Antibody
1-CSB-PA05009A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

SUMO2 Antibody
CSB-PA099258-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

SUMO2 Antibody
CSB-PA099258-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

SUMO2 Antibody
DF7024	Affbiotech	200ul	EUR 304.00
Description: SUMO2 Antibody detects endogenous levels of total SUMO2.

SUMO2 Antibody
1-CSB-PA022949GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SUMO2 siRNA
20-abx905375	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SUMO2 siRNA
20-abx935666	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SUMO2 siRNA
20-abx935667	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

SUMO2 Antibody
ABD7024	Lifescience Market	100 ug	EUR 438.00

pENTR223-SUMO2
PVT12374	Lifescience Market	2 ug	EUR 391.00

Human SUMO2/3 (SUMO2/3) ELISA Kit
abx259859-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

SUMO2/3 Antibody
25117-100ul	SAB	100ul	EUR 390.00

SUMO2/3 antibody
70R-30820	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal SUMO2/3 antibody

SUMO2/3 antibody
70R-30839	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal SUMO2/3 antibody

Human SUMO2 Antibody
32621-05111	AssayPro	150 ug	EUR 261.00

SUMO2, human recombinant
4942-100	Biovision		EUR 251.00

SUMO2, human recombinant
4942-1000	Biovision		EUR 1518.00

SUMO2 Blocking Peptide
DF7024-BP	Affbiotech	1mg	EUR 195.00

SUMO2/3 antibody
70R-50404	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal SUMO2/3 antibody

Xenopus SUMO2 Antibody
abx027062-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Xenopus SUMO2 Antibody
abx027062-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Human SUMO2 Protein
abx060006-100ug	Abbexa	100 ug	EUR 328.00
Shipped within 5-10 working days.

SUMO2-biotin Protein
E28003	EpiGentek	50 µg	EUR 338.55
Description: reagents widely cited

SUMO2 Conjugated Antibody
C32722	SAB	100ul	EUR 397.00

SUMO2 cloning plasmid
CSB-CL022949HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 288 Sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacgatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcag Show more
Description: A cloning plasmid for the SUMO2 gene.

SUMO2 cloning plasmid
CSB-CL022949HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 288 Sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacaatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcag Show more
Description: A cloning plasmid for the SUMO2 gene.

SUMO2 Rabbit pAb
A2486-100ul	Abclonal	100 ul	EUR 308.00

SUMO2 Rabbit pAb
A2486-200ul	Abclonal	200 ul	EUR 459.00

SUMO2 Rabbit pAb
A2486-20ul	Abclonal	20 ul	EUR 183.00

SUMO2 Rabbit pAb
A2486-50ul	Abclonal	50 ul	EUR 223.00

SUMO2 Rabbit pAb
A2571-100ul	Abclonal	100 ul	EUR 308.00

SUMO2 Rabbit pAb
A2571-200ul	Abclonal	200 ul	EUR 459.00

SUMO2 Rabbit pAb
A2571-20ul	Abclonal	20 ul	EUR 183.00

SUMO2 Rabbit pAb
A2571-50ul	Abclonal	50 ul	EUR 223.00

SUMO2 Rabbit pAb
A1523-100ul	Abclonal	100 ul	EUR 308.00

SUMO2 Rabbit pAb
A1523-200ul	Abclonal	200 ul	EUR 459.00

SUMO2 Rabbit pAb
A1523-20ul	Abclonal	20 ul	EUR 183.00

SUMO2 Rabbit pAb
A1523-50ul	Abclonal	50 ul	EUR 223.00

SUMO2 Polyclonal Antibody
ABP60553-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90

SUMO2 Polyclonal Antibody
ABP60553-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90

SUMO2 Polyclonal Antibody
ABP60553-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90 Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90

SUMO2 Polyclonal Antibody
ES9018-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against SUMO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

SUMO2 Polyclonal Antibody
ES9018-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against SUMO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

p3*Flag- SUMO2
PVT10172	Lifescience Market	2 ug	EUR 301.00

pWPXLd-SUMO2 Plasmid
PVTB00794-4a	Lifescience Market	2 ug	EUR 356.00

Anti-SUMO2 antibody
STJ25749	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Anti-SUMO2 antibody
STJ28142	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Anti-SUMO2 antibody
STJ116151	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Anti-SUMO2 antibody
STJ190176	St John's Laboratory	200 µl	EUR 197.00
Description: Unconjugated Rabbit polyclonal to SUMO2

SUMO2/SUMO3/SUMO4 Antibody
36877-100ul	SAB	100ul	EUR 252.00

Sumo2/3/4 Antibody
45466-100ul	SAB	100ul	EUR 252.00

Sumo2/3/4 Antibody
45466-50ul	SAB	50ul	EUR 187.00

Cleaved-SUMO2 (G93) Antibody
1-CSB-PA000062	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Cleaved-SUMO2 (G93). Recognizes Cleaved-SUMO2 (G93) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

Human Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Hu-96T	DL Develop	96T	EUR 494.00
Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Mouse Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Mu-48T	DL Develop	48T	EUR 527.00
Should the Mouse Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 2 (THBS2) in samples from plasma, tissue homogenates or other biological fluids.

Mouse Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Mu-96T	DL Develop	96T	EUR 688.00
Should the Mouse Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 2 (THBS2) in samples from plasma, tissue homogenates or other biological fluids.

Rat Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Ra-48T	DL Develop	48T	EUR 549.00
Should the Rat Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Rat Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Ra-96T	DL Develop	96T	EUR 718.00
Should the Rat Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.

Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 390.00

Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 536.00

Mouse Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Mouse Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774.00

Rat Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583.00

Rat Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811.00

Human Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 374.00

Human Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 513.00

Mouse Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533.00

Mouse Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740.00

Rat Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Rat Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775.00

THBS2 antibody
70R-13958	Fitzgerald	100 ug	EUR 349.00
Description: Affinity purified Rabbit polyclonal THBS2 antibody

THBS2 Antibody
40245-100ul	SAB	100ul	EUR 252.00

THBS2 Antibody
1-CSB-PA914519	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THBS2. Recognizes THBS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

THBS2 Antibody
1-CSB-PA890812	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against THBS2. Recognizes THBS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000

THBS2 Antibody
1-CSB-PA285619	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THBS2. Recognizes THBS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Thbs2 Antibody
1-CSB-PA023488HA01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs2. Recognizes Thbs2 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA

THBS2 siRNA
20-abx936678	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

THBS2 siRNA
20-abx936679	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

THBS2 antibody
PAab09828	Lifescience Market	100 ug	EUR 386.00

THBS2 Conjugated Antibody
C40245	SAB	100ul	EUR 397.00

Rat THBS2 Protein
20-abx651005	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	0 1 2 3 4
Shipped within 5-7 working days.

Thbs2 Polyclonal Antibody
A57747	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

THBS2 Rabbit pAb
A8561-100ul	Abclonal	100 ul	EUR 308.00

THBS2 Rabbit pAb
A8561-200ul	Abclonal	200 ul	EUR 459.00

THBS2 Rabbit pAb
A8561-20ul	Abclonal	20 ul	EUR 183.00

THBS2 Rabbit pAb
A8561-50ul	Abclonal	50 ul	EUR 223.00

anti- THBS2 antibody
FNab09828	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: THBS2 Uniprot ID: P35442 Gene ID: 7058 Research Area: Cardiovascular, cancer
Description: Antibody raised against THBS2

Recombinant human THBS2
P2400	FN Test	100ug	Ask for price
Uniprot ID: P35442 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human THBS2

anti- THBS2 antibody
LSMab09828	Lifescience Market	100 ug	EUR 386.00

Anti-THBS2 antibody
STJ111296	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration.

Mouse Thrombospondin-2 (Thbs2)
1-CSB-EP023488MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	0 1 2 3 4 5
MW: 28.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-2(Thbs2),partial expressed in E.coli

Mouse Thrombospondin-2 (Thbs2)
1-CSB-YP023488MO	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	0 1 2 3 4 5
MW: 26.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-2(Thbs2),partial expressed in Yeast

Thrombospondin 2 (THBS2) Antibody
20-abx178571	Abbexa	EUR 1233.00 EUR 592.00	0 1
Please enquire.

Thrombospondin 2 (THBS2) Antibody
20-abx178572	Abbexa	EUR 1302.00 EUR 620.00	0 1
Please enquire.

Thrombospondin 2 (THBS2) Antibody
20-abx212795	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Thrombospondin 2 (THBS2) Antibody
20-abx212796	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Thrombospondin 2 (THBS2) Antibody
20-abx101680	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Thrombospondin 2 (THBS2) Antibody
20-abx110654	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Thrombospondin 2 (THBS2) Antibody
20-abx121778	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

Thrombospondin 2 (THBS2) Antibody
20-abx124173	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Thrombospondin 2 (THBS2) Antibody
20-abx128033	Abbexa	EUR 314.00 EUR 133.00 EUR 857.00 EUR 439.00 EUR 272.00	0 1 2 3 4
Shipped within 5-7 working days.

Thrombospondin 2 (THBS2) Antibody
20-abx174768	Abbexa	EUR 857.00 EUR 439.00	0 1
Please enquire.

Thrombospondin 2 (THBS2) Antibody
20-abx174769	Abbexa	EUR 913.00 EUR 467.00	0 1
Please enquire.

Mouse THBS2 shRNA Plasmid
20-abx973101	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Thbs2 Antibody, HRP conjugated
1-CSB-PA023488HB01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs2. Recognizes Thbs2 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Thbs2 Antibody, FITC conjugated
1-CSB-PA023488HC01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs2. Recognizes Thbs2 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Thbs2 Antibody, Biotin conjugated
1-CSB-PA023488HD01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs2. Recognizes Thbs2 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Thrombospondin 2 (THBS2) Antibody
20-abx329745	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Human THBS2 shRNA Plasmid
20-abx954830	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Recombinant Thrombospondin 2 (THBS2)
4-RPD822Hu01	Cloud-Clone	EUR 472.74 EUR 229.00 EUR 1497.76 EUR 565.92 EUR 1031.84 EUR 379.00 EUR 3594.40	0 1 2 3 4 5 6
Uniprot ID: P35442 Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 27.4kDa Isoelectric Point: 6.7
Description: Recombinant Human Thrombospondin 2 expressed in: E.coli

Recombinant Thrombospondin 2 (THBS2)
4-RPD822Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	0 1 2 3 4 5 6
Uniprot ID: Q03350 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 55.3kDa Isoelectric Point: 6.2
Description: Recombinant Mouse Thrombospondin 2 expressed in: E.coli

Recombinant Thrombospondin 2 (THBS2)
4-RPD822Ra01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	0 1 2 3 4 5 6
Uniprot ID: Inquire Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 53.3kDa Isoelectric Point: 6.4
Description: Recombinant Rat Thrombospondin 2 expressed in: E.coli

pCMV-SPORT6-THBS2 Plasmid
PVT15929	Lifescience Market	2 ug	EUR 370.00

pCMV-SPORT6-THBS2 Plasmid
PVT17142	Lifescience Market	2 ug	EUR 325.00

Anti-Thrombospondin 2/THBS2 Antibody
A03253-1	BosterBio	100ug/vial	EUR 294.00

Thrombospondin 2 (THBS2) Antibody (Biotin)
20-abx106390	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Thrombospondin 2 (THBS2) Antibody (FITC)
20-abx107802	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Thrombospondin 2 (THBS2) Antibody (HRP)
20-abx109220	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Human Thrombospondin 2 (THBS2) Protein
20-abx166630	Abbexa	EUR 662.00 EUR 272.00 EUR 2026.00 EUR 787.00 EUR 481.00	0 1 2 3 4
Shipped within 5-7 working days.

Thrombospondin 2 (THBS2) Blocking Peptide
20-abx161488	Abbexa	EUR 606.00 EUR 1428.00	0 1
Shipped within 5-10 working days.

Mouse Thrombospondin 2 (THBS2) Protein
20-abx069283	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	0 1 2 3 4
Shipped within 5-12 working days.

Thrombospondin 2 (THBS2) Antibody (FITC)
20-abx271263	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	0 1 2 3 4
Shipped within 5-15 working days.

Thrombospondin 2 (THBS2) Antibody (Biotin)
20-abx271529	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	0 1 2 3 4
Shipped within 5-15 working days.

Thbs2 Polyclonal Antibody, Biotin Conjugated
A57744	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Thbs2 Polyclonal Antibody, FITC Conjugated
A57745	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Thbs2 Polyclonal Antibody, HRP Conjugated
A57746	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Anti-Thrombospondin 2/THBS2 Antibody
PA1417	BosterBio	100ug/vial	EUR 334.00

Thbs2 ORF Vector (Rat) (pORF)
ORF077671	ABM	1.0 ug DNA	EUR 506.00

TIMM9 Antibody
1-CSB-PA897296LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

TIMM9 Antibody
DF12487	Affbiotech	200ul	EUR 304.00
Description: TIMM9 antibody detects endogenous levels of TIMM9.

TIMM9 Antibody
1-CSB-PA023559GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TIMM9 siRNA
20-abx905583	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TIMM9 siRNA
20-abx936816	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

TIMM9 siRNA
20-abx936817	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-TIMM9
YF-PA26003	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to TIMM9

TIMM9 Polyclonal Antibody
30594-100ul	SAB	100ul	EUR 252.00

TIMM9 Polyclonal Antibody
30594-50ul	SAB	50ul	EUR 187.00

TIMM9 cloning plasmid
CSB-CL897296HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 270 Sequence: atggctgcacaaataccagaatctgatcagataaaacagtttaaggaatttctggggacctacaataaacttacagagacctgctttttggactgtgttaaagacttcacaacaagagaagtaaaacctgaagagaccacctgttcagaacattgcttacagaaatatttaaaaat Show more
Description: A cloning plasmid for the TIMM9 gene.

TIMM9 Blocking Peptide
DF12487-BP	Affbiotech	1mg	EUR 195.00

TIMM9 Polyclonal Antibody
A61318	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

TIMM9 Rabbit pAb
A4627-100ul	Abclonal	100 ul	EUR 308.00

TIMM9 Rabbit pAb
A4627-200ul	Abclonal	200 ul	EUR 459.00

TIMM9 Rabbit pAb
A4627-20ul	Abclonal	20 ul	EUR 183.00

TIMM9 Rabbit pAb
A4627-50ul	Abclonal	50 ul	EUR 223.00

anti- TIMM9 antibody
FNab08704	FN Test	100µg	EUR 548.75
Immunogen: translocase of inner mitochondrial membrane 9 homolog(yeast) Uniprot ID: Q9Y5J7 Gene ID: 26520 Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against TIMM9

Anti-TIMM9 antibody
PAab08704	Lifescience Market	100 ug	EUR 386.00

Anti-TIMM9 antibody
STJ26765	St John's Laboratory	100 µl	EUR 277.00

Anti-TIMM9 (1D6)
YF-MA11441	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to TIMM9

TIMM9 Antibody, HRP conjugated
1-CSB-PA897296LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TIMM9 Antibody, FITC conjugated
1-CSB-PA897296LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TIMM9 Antibody, Biotin conjugated
1-CSB-PA897296LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Chicken TIMM9 ELISA KIT
ELI-16252c	Lifescience Market	96 Tests	EUR 928.00

TIMM9 ELISA KIT|Human
EF003618	Lifescience Market	96 Tests	EUR 689.00

Rat TIMM9 shRNA Plasmid
20-abx987709	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse TIMM9 shRNA Plasmid
20-abx974018	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TIMM9 Polyclonal Conjugated Antibody
C30594	SAB	100ul	EUR 397.00

Human TIMM9 shRNA Plasmid
20-abx958845	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

TIMM9 Recombinant Protein (Human)
RP031597	ABM	100 ug	Ask for price

TIMM9 Recombinant Protein (Mouse)
RP178799	ABM	100 ug	Ask for price

TIMM9 Recombinant Protein (Mouse)
RP178802	ABM	100 ug	Ask for price

TIMM9 Recombinant Protein (Mouse)
RP178805	ABM	100 ug	Ask for price

TIMM9 Polyclonal Antibody, Biotin Conjugated
A61319	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

TIMM9 Polyclonal Antibody, FITC Conjugated
A61320	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

TIMM9 Polyclonal Antibody, HRP Conjugated
A61321	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

TIMM9 ORF Vector (Human) (pORF)
ORF010533	ABM	1.0 ug DNA	EUR 95.00

Timm9 ORF Vector (Mouse) (pORF)
ORF059601	ABM	1.0 ug DNA	EUR 506.00

Timm9 ORF Vector (Mouse) (pORF)
ORF059602	ABM	1.0 ug DNA	EUR 506.00

Timm9 ORF Vector (Mouse) (pORF)
ORF059603	ABM	1.0 ug DNA	EUR 506.00

TIMM9 ELISA Kit (Human) (OKEH08563)
OKEH08563	Aviva Systems Biology	96 Wells	EUR 896.00
Description: Description of target: TIMM9 belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23.45pg/mL

Timm9 sgRNA CRISPR Lentivector set (Mouse)
K4768701	ABM	3 x 1.0 ug	EUR 339.00

TIMM9 sgRNA CRISPR Lentivector set (Human)
K2374901	ABM	3 x 1.0 ug	EUR 339.00

Monoclonal TIMM9 Antibody (monoclonal) (M01), Clone: 1D6
APR13737G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human TIMM9 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D6. This antibody is applicable in WB and IHC, E

Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4768702	ABM	1.0 ug DNA	EUR 154.00

Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4768703	ABM	1.0 ug DNA	EUR 154.00

Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4768704	ABM	1.0 ug DNA	EUR 154.00

TIMM9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2374902	ABM	1.0 ug DNA	EUR 154.00

TIMM9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2374903	ABM	1.0 ug DNA	EUR 154.00

TIMM9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2374904	ABM	1.0 ug DNA	EUR 154.00

TIMM9 Protein Vector (Human) (pPB-C-His)
PV042129	ABM	500 ng	EUR 329.00

TIMM9 Protein Vector (Human) (pPB-N-His)
PV042130	ABM	500 ng	EUR 329.00

TIMM9 Protein Vector (Human) (pPM-C-HA)
PV042131	ABM	500 ng	EUR 329.00

TIMM9 Protein Vector (Human) (pPM-C-His)
PV042132	ABM	500 ng	EUR 329.00

TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238402	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238403	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238404	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238405	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238406	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238407	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238408	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238409	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238410	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238411	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238412	ABM	500 ng	EUR 603.00

TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238413	ABM	500 ng	EUR 603.00

Timm9 3'UTR Luciferase Stable Cell Line
TU120508	ABM	1.0 ml	Ask for price

Timm9 3'UTR GFP Stable Cell Line
TU170508	ABM	1.0 ml	Ask for price

Timm9 3'UTR Luciferase Stable Cell Line
TU221902	ABM	1.0 ml	Ask for price

TIMM9 3'UTR GFP Stable Cell Line
TU075591	ABM	1.0 ml	EUR 1394.00

Timm9 3'UTR GFP Stable Cell Line
TU271902	ABM	1.0 ml	Ask for price

TIMM9 3'UTR Luciferase Stable Cell Line
TU025591	ABM	1.0 ml	EUR 1394.00

Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
20-abx003480	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
20-abx116212	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
abx238704-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.