HLADRF34PE-50T 50 test
EUR 323.00


HLADRF3PE1-50T 50 test
EUR 350.30


HLADRF8PE1-50T 50 test
EUR 350.30

IC IgG1/IgG1/ CD45

ICIGG1FPE45PP1-50T 50 test
EUR 479.00


8F138PE-50T 50 test
EUR 350.30


8F14PE1-50T 50 test
EUR 350.30


8F156PE-50T 50 test
EUR 350.30


3F11656PE-50T 50 test
EUR 350.30


3F11656PE45PC319A3-50T 50 test
EUR 850.80


3F11656PE45PP1-50T 50 test
EUR 479.00


3F119PE1-50T 50 test
EUR 350.30


3F119PE145PP1-50T 50 test
EUR 479.00


3F14PE1-50T 50 test
EUR 350.30


3F14PE145PC3-50T 50 test
EUR 564.80


3F14PE45PP1-50T 50 test
EUR 479.00


3F18PE1-50T 50 test
EUR 350.30


3F18PE145PC34A2-50T 50 test
EUR 707.80


3F18PE145PP1-50T 50 test
EUR 521.90


3F18PE145PP14A3-50T 50 test
EUR 609.00


4F18PE1-50T 50 test
EUR 350.30


4F18PE13PC2-50T 50 test
EUR 550.50


4F45RAPE2-50T 50 test
EUR 521.90


4F8PE13PP1-50T 50 test
EUR 521.90


45F114PE-50T 50 test
EUR 350.30


45RAF245ROPE3PP14A1-50T 50 test
EUR 609.00


45RAF245ROPE3PP18A3-50T 50 test
EUR 609.00


45RAF24PE1-50T 50 test
EUR 364.60


45RAF262LPE3PP14A1-50T 50 test
EUR 609.00


45RAF262LPE3PP18A3-50T 50 test
EUR 609.00

CD103/ CD22/ CD20

103F22PE20PP2-50T 50 test
EUR 700.00

CD157/ CD45/ CD64 (HPN)

157PE45PP264A-50T 50 test
EUR 953.50


15F117PE-50T 50 test
EUR 362.00


15F34PE-50T 50 test
EUR 436.10


16F256PE-50T 50 test
EUR 350.30


1KF3LPE2-50T 50 test
EUR 672.05


5F19PE1-50T 50 test
EUR 350.30


5F20PE2-50T 50 test
EUR 350.30


MPOF22PE-50T 50 test
EUR 436.10


KAPPAF219PE1-50T 50 test
EUR 350.30


EUR 414.00


EUR 784.50


KF319PE4-50T 50 test
EUR 466.00


LAMBDAF19PE1-50T 50 test
EUR 350.30


LF219PE4-50T 50 test
EUR 466.00


LF2KPE3-50T 50 test
EUR 615.50

StepCount Kit1

STPKIT1-50T 50 test
EUR 854.70

StepCount Kit2

STPKIT2-50T 50 test
EUR 999.00

StepCount Kit4

STPKIT4-50T 50 test
EUR 713.00


TDTF-50T 100 test
EUR 1220.00


Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
DLR-SUMO2-Hu-96T 96T
EUR 673.00
  • Should the Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) in samples from tissue homogenates, cell lysates or other biological fluids.
Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RD-SUMO2-Hu-48Tests 48 Tests
EUR 521.00
Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RD-SUMO2-Hu-96Tests 96 Tests
EUR 723.00
Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RDR-SUMO2-Hu-48Tests 48 Tests
EUR 544.00
Human Small Ubiquitin Related Modifier Protein 2 (SUMO2) ELISA Kit
RDR-SUMO2-Hu-96Tests 96 Tests
EUR 756.00
E541-030 100ug
EUR 343.00
Sumo2/ Rat Sumo2 ELISA Kit
ELI-52173r 96 Tests
EUR 886.00
SUMO2/3 (SUMO2/3) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026675-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026675-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026676-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026676-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026683-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx026683-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SUMO2/3 (SUMO2/3) Antibody
abx238390-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
SUMO2/3 (SUMO2/3) Antibody
abx238391-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SUMO2 antibody
70R-20650 50 ul
EUR 435.00
Description: Rabbit polyclonal SUMO2 antibody
SUMO2 Antibody
ABD7024 100 ug
EUR 438.00
SUMO2 antibody
38405-100ul 100ul
EUR 252.00
SUMO2 antibody
10R-1181 100 ul
EUR 316.00
Description: Mouse monoclonal SUMO2 antibody
SUMO2 protein
30R-1289 100 ug
EUR 268.00
Description: Purified recombinant Human SUMO2 protein
SUMO2 protein
30R-2786 100 ug
EUR 336.00
Description: Purified recombinant Human SUMO2 protein
SUMO2 Antibody
32722-100ul 100ul
EUR 252.00
SUMO2 Antibody
DF7024 200ul
EUR 304.00
Description: SUMO2 Antibody detects endogenous levels of total SUMO2.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SUMO2 Antibody
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SUMO2 Antibody
CSB-PA099258-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100
SUMO2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
SUMO2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against SUMO2. Recognizes SUMO2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
PVT12374 2 ug
EUR 391.00
Human SUMO2/3 (SUMO2/3) ELISA Kit
abx259859-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.
SUMO2 Conjugated Antibody
C32722 100ul
EUR 397.00
SUMO2 cloning plasmid
CSB-CL022949HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacgatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcag
  • Show more
Description: A cloning plasmid for the SUMO2 gene.
SUMO2 cloning plasmid
CSB-CL022949HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 288
  • Sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacaatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcag
  • Show more
Description: A cloning plasmid for the SUMO2 gene.
SUMO2-biotin Protein
E28003 50 µg
EUR 338.55
Description: reagents widely cited
SUMO2 Polyclonal Antibody
ES9018-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against SUMO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SUMO2 Polyclonal Antibody
ES9018-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against SUMO2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
SUMO2 Polyclonal Antibody
ABP60553-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
SUMO2 Polyclonal Antibody
ABP60553-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
SUMO2 Polyclonal Antibody
ABP60553-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of SUMO2 from Human, Mouse, Rat. This SUMO2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SUMO2 protein at amino acid sequence of 10-90
Human SUMO2 Protein
abx060006-100ug 100 ug
EUR 328.00
  • Shipped within 5-10 working days.
Xenopus SUMO2 Antibody
abx027062-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.
Xenopus SUMO2 Antibody
abx027062-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.
SUMO2/3 antibody
70R-50404 100 ul
EUR 244.00
Description: Purified Polyclonal SUMO2/3 antibody
SUMO2/3 antibody
70R-30820 100 ug
EUR 327.00
Description: Rabbit polyclonal SUMO2/3 antibody
SUMO2/3 antibody
70R-30839 100 ug
EUR 327.00
Description: Rabbit polyclonal SUMO2/3 antibody
SUMO2 Rabbit pAb
A1523-100ul 100 ul
EUR 308.00
SUMO2 Rabbit pAb
A1523-200ul 200 ul
EUR 459.00
SUMO2 Rabbit pAb
A1523-20ul 20 ul
EUR 183.00
SUMO2 Rabbit pAb
A1523-50ul 50 ul
EUR 223.00
SUMO2 Rabbit pAb
A2486-100ul 100 ul
EUR 308.00
SUMO2 Rabbit pAb
A2486-200ul 200 ul
EUR 459.00
SUMO2 Rabbit pAb
A2486-20ul 20 ul
EUR 183.00
SUMO2 Rabbit pAb
A2486-50ul 50 ul
EUR 223.00
SUMO2 Rabbit pAb
A2571-100ul 100 ul
EUR 308.00
SUMO2 Rabbit pAb
A2571-200ul 200 ul
EUR 459.00
SUMO2 Rabbit pAb
A2571-20ul 20 ul
EUR 183.00
SUMO2 Rabbit pAb
A2571-50ul 50 ul
EUR 223.00
SUMO2, human recombinant
EUR 251.00
SUMO2, human recombinant
EUR 1518.00
Human SUMO2 Antibody
32621-05111 150 ug
EUR 261.00
SUMO2/3 Antibody
25117-100ul 100ul
EUR 390.00
SUMO2 Blocking Peptide
DF7024-BP 1mg
EUR 195.00
pWPXLd-SUMO2 Plasmid
PVTB00794-4a 2 ug
EUR 356.00
p3*Flag- SUMO2
PVT10172 2 ug
EUR 301.00
Anti-SUMO2 antibody
STJ28142 100 µl
EUR 277.00
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-SUMO2 antibody
STJ25749 100 µl
EUR 277.00
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-SUMO2 antibody
STJ116151 100 µl
EUR 277.00
Description: This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.
Anti-SUMO2 antibody
STJ190176 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to SUMO2
Polyclonal SUMO2/3 Antibody
APR06632G 0.1 mg
EUR 659.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SUMO2/3 . This antibody is tested and proven to work in the following applications:
Mouse SUMO2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
EF007196 96 Tests
EUR 689.00
anti- SUMO2/3 antibody
FNab08390 100µg
EUR 548.75
  • Immunogen: SMT3 suppressor of mif two 3 homolog 2
  • Uniprot ID: P61956
  • Gene ID: 6613
  • Research Area: Epigenetics, Cell Division and Proliferation, Metabolism
Description: Antibody raised against SUMO2/3


Human Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Hu-96T 96T
EUR 494.00
  • Should the Human Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.
Mouse Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Mu-48T 48T
EUR 527.00
  • Should the Mouse Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 2 (THBS2) in samples from plasma, tissue homogenates or other biological fluids.
Mouse Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Mu-96T 96T
EUR 688.00
  • Should the Mouse Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 2 (THBS2) in samples from plasma, tissue homogenates or other biological fluids.
Rat Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Ra-48T 48T
EUR 549.00
  • Should the Rat Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.
Rat Thrombospondin 2 (THBS2) ELISA Kit
DLR-THBS2-Ra-96T 96T
EUR 718.00
  • Should the Rat Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Thrombospondin 2 (THBS2) in samples from serum, plasma or other biological fluids.
Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-48Tests 48 Tests
EUR 390.00
Human Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Hu-96Tests 96 Tests
EUR 536.00
Mouse Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Mu-48Tests 48 Tests
EUR 557.00
Mouse Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Mu-96Tests 96 Tests
EUR 774.00
Rat Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Ra-48Tests 48 Tests
EUR 583.00
Rat Thrombospondin 2 (THBS2) ELISA Kit
RDR-THBS2-Ra-96Tests 96 Tests
EUR 811.00
Human Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Hu-48Tests 48 Tests
EUR 374.00
Human Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Hu-96Tests 96 Tests
EUR 513.00
Mouse Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Mu-48Tests 48 Tests
EUR 533.00
Mouse Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Mu-96Tests 96 Tests
EUR 740.00
Rat Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Ra-48Tests 48 Tests
EUR 557.00
Rat Thrombospondin 2 (THBS2) ELISA Kit
RD-THBS2-Ra-96Tests 96 Tests
EUR 775.00
THBS2 antibody
70R-13958 100 ug
EUR 349.00
Description: Affinity purified Rabbit polyclonal THBS2 antibody
THBS2 Antibody
40245-100ul 100ul
EUR 252.00
THBS2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THBS2. Recognizes THBS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
THBS2 Antibody
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against THBS2. Recognizes THBS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC-p:1:100-1:300.ELISA:1/10000
THBS2 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against THBS2. Recognizes THBS2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100
Thbs2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs2. Recognizes Thbs2 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
THBS2 antibody
PAab09828 100 ug
EUR 386.00
THBS2 Conjugated Antibody
C40245 100ul
EUR 397.00
Rat THBS2 Protein
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Thbs2 Polyclonal Antibody
A57747 100 µg
EUR 570.55
Description: reagents widely cited
THBS2 Rabbit pAb
A8561-100ul 100 ul
EUR 308.00
THBS2 Rabbit pAb
A8561-200ul 200 ul
EUR 459.00
THBS2 Rabbit pAb
A8561-20ul 20 ul
EUR 183.00
THBS2 Rabbit pAb
A8561-50ul 50 ul
EUR 223.00
anti- THBS2 antibody
FNab09828 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • Immunogen: THBS2
  • Uniprot ID: P35442
  • Gene ID: 7058
  • Research Area: Cardiovascular, cancer
Description: Antibody raised against THBS2
Recombinant human THBS2
P2400 100ug Ask for price
  • Uniprot ID: P35442
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human THBS2
anti- THBS2 antibody
LSMab09828 100 ug
EUR 386.00
Anti-THBS2 antibody
STJ111296 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration.
Mouse Thrombospondin-2 (Thbs2)
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 28.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-2(Thbs2),partial expressed in E.coli
Mouse Thrombospondin-2 (Thbs2)
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 26.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Thrombospondin-2(Thbs2),partial expressed in Yeast
Thrombospondin 2 (THBS2) Antibody
  • EUR 1233.00
  • EUR 592.00
  • 0
  • 1
  • Please enquire.
Thrombospondin 2 (THBS2) Antibody
  • EUR 1302.00
  • EUR 620.00
  • 0
  • 1
  • Please enquire.
Thrombospondin 2 (THBS2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Thrombospondin 2 (THBS2) Antibody
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Thrombospondin 2 (THBS2) Antibody
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Thrombospondin 2 (THBS2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Thrombospondin 2 (THBS2) Antibody
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.
Thrombospondin 2 (THBS2) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Thrombospondin 2 (THBS2) Antibody
  • EUR 314.00
  • EUR 133.00
  • EUR 857.00
  • EUR 439.00
  • EUR 272.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Thrombospondin 2 (THBS2) Antibody
  • EUR 857.00
  • EUR 439.00
  • 0
  • 1
  • Please enquire.
Thrombospondin 2 (THBS2) Antibody
  • EUR 913.00
  • EUR 467.00
  • 0
  • 1
  • Please enquire.
Mouse THBS2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Thbs2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs2. Recognizes Thbs2 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA
Thbs2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs2. Recognizes Thbs2 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA
Thbs2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Thbs2. Recognizes Thbs2 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA
Thrombospondin 2 (THBS2) Antibody
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Human THBS2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Recombinant Thrombospondin 2 (THBS2)
  • EUR 472.74
  • EUR 229.00
  • EUR 1497.76
  • EUR 565.92
  • EUR 1031.84
  • EUR 379.00
  • EUR 3594.40
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P35442
  • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 27.4kDa
  • Isoelectric Point: 6.7
Description: Recombinant Human Thrombospondin 2 expressed in: E.coli
Recombinant Thrombospondin 2 (THBS2)
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q03350
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 55.3kDa
  • Isoelectric Point: 6.2
Description: Recombinant Mouse Thrombospondin 2 expressed in: E.coli
Recombinant Thrombospondin 2 (THBS2)
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Inquire
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 53.3kDa
  • Isoelectric Point: 6.4
Description: Recombinant Rat Thrombospondin 2 expressed in: E.coli
PVT15929 2 ug
EUR 370.00
PVT17142 2 ug
EUR 325.00
Anti-Thrombospondin 2/THBS2 Antibody
A03253-1 100ug/vial
EUR 294.00
Thrombospondin 2 (THBS2) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Thrombospondin 2 (THBS2) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Thrombospondin 2 (THBS2) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Human Thrombospondin 2 (THBS2) Protein
  • EUR 662.00
  • EUR 272.00
  • EUR 2026.00
  • EUR 787.00
  • EUR 481.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.
Thrombospondin 2 (THBS2) Blocking Peptide
  • EUR 606.00
  • EUR 1428.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Mouse Thrombospondin 2 (THBS2) Protein
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.
Thrombospondin 2 (THBS2) Antibody (FITC)
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.
Thrombospondin 2 (THBS2) Antibody (Biotin)
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.
Thbs2 Polyclonal Antibody, Biotin Conjugated
A57744 100 µg
EUR 570.55
Description: fast delivery possible
Thbs2 Polyclonal Antibody, FITC Conjugated
A57745 100 µg
EUR 570.55
Description: reagents widely cited
Thbs2 Polyclonal Antibody, HRP Conjugated
A57746 100 µg
EUR 570.55
Description: Ask the seller for details
Anti-Thrombospondin 2/THBS2 Antibody
PA1417 100ug/vial
EUR 334.00
Thbs2 ORF Vector (Rat) (pORF)
ORF077671 1.0 ug DNA
EUR 506.00


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
TIMM9 antibody
70R-20833 50 ul
EUR 435.00
Description: Rabbit polyclonal TIMM9 antibody
TIMM9 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
TIMM9 Antibody
DF12487 200ul
EUR 304.00
Description: TIMM9 antibody detects endogenous levels of TIMM9.
TIMM9 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
YF-PA26003 50 ul
EUR 334.00
Description: Mouse polyclonal to TIMM9
anti- TIMM9 antibody
FNab08704 100µg
EUR 548.75
  • Immunogen: translocase of inner mitochondrial membrane 9 homolog(yeast)
  • Uniprot ID: Q9Y5J7
  • Gene ID: 26520
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against TIMM9
TIMM9 Polyclonal Antibody
A61318 100 µg
EUR 570.55
Description: reagents widely cited
TIMM9 Rabbit pAb
A4627-100ul 100 ul
EUR 308.00
TIMM9 Rabbit pAb
A4627-200ul 200 ul
EUR 459.00
TIMM9 Rabbit pAb
A4627-20ul 20 ul
EUR 183.00
TIMM9 Rabbit pAb
A4627-50ul 50 ul
EUR 223.00
TIMM9 Polyclonal Antibody
30594-100ul 100ul
EUR 252.00
TIMM9 Polyclonal Antibody
30594-50ul 50ul
EUR 187.00
TIMM9 Blocking Peptide
DF12487-BP 1mg
EUR 195.00
TIMM9 cloning plasmid
CSB-CL897296HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 270
  • Sequence: atggctgcacaaataccagaatctgatcagataaaacagtttaaggaatttctggggacctacaataaacttacagagacctgctttttggactgtgttaaagacttcacaacaagagaagtaaaacctgaagagaccacctgttcagaacattgcttacagaaatatttaaaaat
  • Show more
Description: A cloning plasmid for the TIMM9 gene.
Anti-TIMM9 antibody
PAab08704 100 ug
EUR 386.00
Anti-TIMM9 antibody
STJ26765 100 µl
EUR 277.00
Anti-TIMM9 (1D6)
YF-MA11441 100 ug
EUR 363.00
Description: Mouse monoclonal to TIMM9
TIMM9 Polyclonal Conjugated Antibody
C30594 100ul
EUR 397.00
Mouse TIMM9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Rat TIMM9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
ELI-16252c 96 Tests
EUR 928.00
EF003618 96 Tests
EUR 689.00
Human TIMM9 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
TIMM9 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
TIMM9 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
TIMM9 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TIMM9. Recognizes TIMM9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
TIMM9 Recombinant Protein (Human)
RP031597 100 ug Ask for price
TIMM9 Recombinant Protein (Mouse)
RP178799 100 ug Ask for price
TIMM9 Recombinant Protein (Mouse)
RP178802 100 ug Ask for price
TIMM9 Recombinant Protein (Mouse)
RP178805 100 ug Ask for price
TIMM9 Polyclonal Antibody, Biotin Conjugated
A61319 100 µg
EUR 570.55
Description: Ask the seller for details
TIMM9 Polyclonal Antibody, FITC Conjugated
A61320 100 µg
EUR 570.55
Description: The best epigenetics products
TIMM9 Polyclonal Antibody, HRP Conjugated
A61321 100 µg
EUR 570.55
Description: kits suitable for this type of research
Timm9 ORF Vector (Mouse) (pORF)
ORF059601 1.0 ug DNA
EUR 506.00
Timm9 ORF Vector (Mouse) (pORF)
ORF059602 1.0 ug DNA
EUR 506.00
Timm9 ORF Vector (Mouse) (pORF)
ORF059603 1.0 ug DNA
EUR 506.00
TIMM9 ORF Vector (Human) (pORF)
ORF010533 1.0 ug DNA
EUR 95.00
TIMM9 ELISA Kit (Human) (OKEH08563)
OKEH08563 96 Wells
EUR 896.00
Description: Description of target: TIMM9 belongs to a family of evolutionarily conserved proteins that are organized in heterooligomeric complexes in the mitochondrial intermembrane space. These proteins mediate the import and insertion of hydrophobic membrane proteins into the mitochondrial inner membrane.[supplied by OMIM, Apr 2004];Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 23.45pg/mL
TIMM9 sgRNA CRISPR Lentivector set (Human)
K2374901 3 x 1.0 ug
EUR 339.00
Timm9 sgRNA CRISPR Lentivector set (Mouse)
K4768701 3 x 1.0 ug
EUR 339.00
Monoclonal TIMM9 Antibody (monoclonal) (M01), Clone: 1D6
APR13737G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human TIMM9 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 1D6. This antibody is applicable in WB and IHC, E
TIMM9 sgRNA CRISPR Lentivector (Human) (Target 1)
K2374902 1.0 ug DNA
EUR 154.00
TIMM9 sgRNA CRISPR Lentivector (Human) (Target 2)
K2374903 1.0 ug DNA
EUR 154.00
TIMM9 sgRNA CRISPR Lentivector (Human) (Target 3)
K2374904 1.0 ug DNA
EUR 154.00
Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4768702 1.0 ug DNA
EUR 154.00
Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4768703 1.0 ug DNA
EUR 154.00
Timm9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4768704 1.0 ug DNA
EUR 154.00
TIMM9 Protein Vector (Human) (pPB-C-His)
PV042129 500 ng
EUR 329.00
TIMM9 Protein Vector (Human) (pPB-N-His)
PV042130 500 ng
EUR 329.00
TIMM9 Protein Vector (Human) (pPM-C-HA)
PV042131 500 ng
EUR 329.00
TIMM9 Protein Vector (Human) (pPM-C-His)
PV042132 500 ng
EUR 329.00
TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238402 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238403 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238404 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238405 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238406 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238407 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238408 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238409 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-C-His)
PV238410 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPB-N-His)
PV238411 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-HA)
PV238412 500 ng
EUR 603.00
TIMM9 Protein Vector (Mouse) (pPM-C-His)
PV238413 500 ng
EUR 603.00
Timm9 3'UTR GFP Stable Cell Line
TU170508 1.0 ml Ask for price
TIMM9 3'UTR GFP Stable Cell Line
TU075591 1.0 ml
EUR 1394.00
Timm9 3'UTR Luciferase Stable Cell Line
TU120508 1.0 ml Ask for price
TIMM9 3'UTR Luciferase Stable Cell Line
TU025591 1.0 ml
EUR 1394.00
Timm9 3'UTR Luciferase Stable Cell Line
TU221902 1.0 ml Ask for price
Timm9 3'UTR GFP Stable Cell Line
TU271902 1.0 ml Ask for price
Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.
Mitochondrial Import Inner Membrane Translocase Subunit Tim9 (TIMM9) Antibody
abx238704-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.


SPCS2 Antibody
42942-100ul 100ul
EUR 252.00
SPCS2 Antibody
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200
SPCS2 Antibody
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.
SPCS2 Conjugated Antibody
C42942 100ul
EUR 397.00
SPCS2 cloning plasmid
CSB-CL617993HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 681
  • Sequence: atggcggcggcagctgtacagggcgggagaagcggtggtagcggaggctgtagtggggctggtggtgcttccaactgcgggacaggaagtggccgtagcggcttgttggataagtggaagatagatgataagcctgtaaaaattgacaagtgggatggatcagctgtgaaaaactc
  • Show more
Description: A cloning plasmid for the SPCS2 gene.
SPCS2 cloning plasmid
CSB-CL617993HU2-10ug 10ug
EUR 213.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 372
  • Show more
Description: A cloning plasmid for the SPCS2 gene.
SPCS2 Polyclonal Antibody
A64714 100 µg
EUR 570.55
Description: kits suitable for this type of research
anti- SPCS2 antibody
FNab08168 100µg
EUR 548.75
  • Immunogen: signal peptidase complex subunit 2 homolog(S. cerevisiae)
  • Uniprot ID: Q15005
  • Gene ID: 9789
  • Research Area: Metabolism
Description: Antibody raised against SPCS2
Anti-SPCS2 antibody
PAab08168 100 ug
EUR 386.00
SPCS2 Antibody, HRP conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
SPCS2 Antibody, FITC conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
SPCS2 Antibody, Biotin conjugated
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPCS2. Recognizes SPCS2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
ELI-18259d 96 Tests
EUR 928.00
EF003181 96 Tests
EUR 689.00
Mouse SPCS2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
Human SPCS2 shRNA Plasmid
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.
SPCS2 Recombinant Protein (Rat)
RP230714 100 ug Ask for price
SPCS2 Recombinant Protein (Human)
RP043705 100 ug Ask for price
SPCS2 Recombinant Protein (Human)
RP029848 100 ug Ask for price
SPCS2 Recombinant Protein (Mouse)
RP174878 100 ug Ask for price
SPCS2 Polyclonal Antibody, HRP Conjugated
A64715 100 µg
EUR 570.55
Description: fast delivery possible
SPCS2 Polyclonal Antibody, FITC Conjugated
A64716 100 µg
EUR 570.55
Description: reagents widely cited
SPCS2 Polyclonal Antibody, Biotin Conjugated
A64717 100 µg
EUR 570.55
Description: Ask the seller for details
Spcs2 ORF Vector (Rat) (pORF)
ORF076906 1.0 ug DNA
EUR 506.00
SPCS2 ORF Vector (Human) (pORF)
ORF014569 1.0 ug DNA
EUR 354.00
SPCS2 ORF Vector (Human) (pORF)
ORF009950 1.0 ug DNA
EUR 95.00
Spcs2 ORF Vector (Mouse) (pORF)
ORF058294 1.0 ug DNA
EUR 506.00
Spcs2 sgRNA CRISPR Lentivector set (Mouse)
K4803001 3 x 1.0 ug
EUR 339.00
Spcs2 sgRNA CRISPR Lentivector set (Rat)
K6187301 3 x 1.0 ug
EUR 339.00
SPCS2 sgRNA CRISPR Lentivector set (Human)
K2269601 3 x 1.0 ug
EUR 339.00
Signal Peptidase Complex Subunit 2 (Spcs2) Antibody
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody
abx238168-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Spcs2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4803002 1.0 ug DNA
EUR 154.00
Spcs2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4803003 1.0 ug DNA
EUR 154.00
Spcs2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4803004 1.0 ug DNA
EUR 154.00
Spcs2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6187302 1.0 ug DNA
EUR 154.00
Spcs2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6187303 1.0 ug DNA
EUR 154.00
Spcs2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6187304 1.0 ug DNA
EUR 154.00
SPCS2 sgRNA CRISPR Lentivector (Human) (Target 1)
K2269602 1.0 ug DNA
EUR 154.00
SPCS2 sgRNA CRISPR Lentivector (Human) (Target 2)
K2269603 1.0 ug DNA
EUR 154.00
SPCS2 sgRNA CRISPR Lentivector (Human) (Target 3)
K2269604 1.0 ug DNA
EUR 154.00
SPCS2 Protein Vector (Rat) (pPB-C-His)
PV307622 500 ng
EUR 603.00
SPCS2 Protein Vector (Rat) (pPB-N-His)
PV307623 500 ng
EUR 603.00
SPCS2 Protein Vector (Rat) (pPM-C-HA)
PV307624 500 ng
EUR 603.00
SPCS2 Protein Vector (Rat) (pPM-C-His)
PV307625 500 ng
EUR 603.00
SPCS2 Protein Vector (Human) (pPB-C-His)
PV058273 500 ng
EUR 481.00
SPCS2 Protein Vector (Human) (pPB-N-His)
PV058274 500 ng
EUR 481.00
SPCS2 Protein Vector (Human) (pPM-C-HA)
PV058275 500 ng
EUR 481.00
SPCS2 Protein Vector (Human) (pPM-C-His)
PV058276 500 ng
EUR 481.00
SPCS2 Protein Vector (Human) (pPB-C-His)
PV039797 500 ng
EUR 329.00
SPCS2 Protein Vector (Human) (pPB-N-His)
PV039798 500 ng
EUR 329.00
SPCS2 Protein Vector (Human) (pPM-C-HA)
PV039799 500 ng
EUR 329.00
SPCS2 Protein Vector (Human) (pPM-C-His)
PV039800 500 ng
EUR 329.00
SPCS2 Protein Vector (Mouse) (pPB-C-His)
PV233174 500 ng
EUR 603.00
SPCS2 Protein Vector (Mouse) (pPB-N-His)
PV233175 500 ng
EUR 603.00
SPCS2 Protein Vector (Mouse) (pPM-C-HA)
PV233176 500 ng
EUR 603.00
SPCS2 Protein Vector (Mouse) (pPM-C-His)
PV233177 500 ng
EUR 603.00
Spcs2 3'UTR Luciferase Stable Cell Line
TU119554 1.0 ml Ask for price
Spcs2 3'UTR GFP Stable Cell Line
TU169554 1.0 ml Ask for price
Spcs2 3'UTR Luciferase Stable Cell Line
TU221054 1.0 ml Ask for price
SPCS2 3'UTR GFP Stable Cell Line
TU074430 1.0 ml
EUR 1521.00
Spcs2 3'UTR GFP Stable Cell Line
TU271054 1.0 ml Ask for price
SPCS2 3'UTR Luciferase Stable Cell Line
TU024430 1.0 ml
EUR 1521.00
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody (HRP)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody (FITC)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
Signal Peptidase Complex Subunit 2 (SPCS2) Antibody (Biotin)
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.
SPCS2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV705963 1.0 ug DNA
EUR 450.00
SPCS2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV705967 1.0 ug DNA
EUR 450.00
SPCS2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV705968 1.0 ug DNA
EUR 450.00
Mouse Signal peptidase complex subunit 2, Spcs2 ELISA KIT
ELI-52854m 96 Tests
EUR 865.00
Human Signal peptidase complex subunit 2, SPCS2 ELISA KIT
ELI-39499h 96 Tests
EUR 824.00
Human Signal Peptidase Complex Subunit 2 Homolog (SPCS2) ELISA Kit
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4803005 3 x 1.0 ug
EUR 376.00
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6187305 3 x 1.0 ug
EUR 376.00
SPCS2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K2269605 3 x 1.0 ug
EUR 376.00
SPCS2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV705964 1.0 ug DNA
EUR 450.00
SPCS2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV705965 1.0 ug DNA
EUR 508.00
SPCS2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV705966 1.0 ug DNA
EUR 508.00
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4803006 1.0 ug DNA
EUR 167.00
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4803007 1.0 ug DNA
EUR 167.00
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4803008 1.0 ug DNA
EUR 167.00
Spcs2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6187306 1.0 ug DNA
EUR 167.00


SRP68 Antibody
37926-100ul 100ul
EUR 252.00
SRP68 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRP68. Recognizes SRP68 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
SRP68 Antibody
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against SRP68. Recognizes SRP68 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100
SRP68 Antibody