STPKIT3-50T

HLA-DR/CD34

HLADRF34PE-50T 50 test
EUR 323.00

HLA-DR/CD3

HLADRF3PE1-50T 50 test
EUR 350.30

HLA-DR/CD8

HLADRF8PE1-50T 50 test
EUR 350.30

IC IgG1/IgG1/ CD45

ICIGG1FPE45PP1-50T 50 test
EUR 479.00

CD8/CD38

8F138PE-50T 50 test
EUR 350.30

CD8/CD4

8F14PE1-50T 50 test
EUR 350.30

CD8/CD56

8F156PE-50T 50 test
EUR 350.30

CD3/CD16+56

3F11656PE-50T 50 test
EUR 350.30

CD3/CD16+56/CD45/CD19

3F11656PE45PC319A3-50T 50 test
EUR 850.80

CD3/CD16+56/CD45

3F11656PE45PP1-50T 50 test
EUR 479.00

CD3/CD19

3F119PE1-50T 50 test
EUR 350.30

CD3/CD19/CD45

3F119PE145PP1-50T 50 test
EUR 479.00

CD3/CD4

3F14PE1-50T 50 test
EUR 350.30

CD3/CD4/CD45

3F14PE145PC3-50T 50 test
EUR 564.80

CD3/CD4/CD45

3F14PE45PP1-50T 50 test
EUR 479.00

CD3/CD8

3F18PE1-50T 50 test
EUR 350.30

CD3/CD8/CD45/CD4

3F18PE145PC34A2-50T 50 test
EUR 707.80

CD3/CD8/CD45

3F18PE145PP1-50T 50 test
EUR 521.90

CD3/CD8/CD45/CD4

3F18PE145PP14A3-50T 50 test
EUR 609.00

CD4/CD8

4F18PE1-50T 50 test
EUR 350.30

CD4/CD8/CD3

4F18PE13PC2-50T 50 test
EUR 550.50

CD4/CD45RA

4F45RAPE2-50T 50 test
EUR 521.90

CD4/CD8/CD3

4F8PE13PP1-50T 50 test
EUR 521.90

CD45/CD14

45F114PE-50T 50 test
EUR 350.30

CD45RA/CD45RO/CD3/CD4

45RAF245ROPE3PP14A1-50T 50 test
EUR 609.00

CD45RA/CD45RO/CD3/CD8

45RAF245ROPE3PP18A3-50T 50 test
EUR 609.00

CD45RA/CD4

45RAF24PE1-50T 50 test
EUR 364.60

CD45RA/CD62L/CD3/CD4

45RAF262LPE3PP14A1-50T 50 test
EUR 609.00

CD45RA/CD62L/CD3/CD8

45RAF262LPE3PP18A3-50T 50 test
EUR 609.00

CD103/ CD22/ CD20

103F22PE20PP2-50T 50 test
EUR 700.00

CD157/ CD45/ CD64 (HPN)

157PE45PP264A-50T 50 test
EUR 953.50

CD15/CD117

15F117PE-50T 50 test
EUR 362.00

CD15/CD34

15F34PE-50T 50 test
EUR 436.10

CD16/CD56

16F256PE-50T 50 test
EUR 350.30

KAPPA/LAMBDA

1KF3LPE2-50T 50 test
EUR 672.05

CD5/CD19

5F19PE1-50T 50 test
EUR 350.30

CD5/CD20

5F20PE2-50T 50 test
EUR 350.30

MPO/CD22

MPOF22PE-50T 50 test
EUR 436.10

KAPPA/CD19

KAPPAF219PE1-50T 50 test
EUR 350.30

KAPPA/LAMBDA

KAPPAF2LAMBDAPE-50T 50 test
EUR 414.00

KAPPA/LAMBDA/CD19

KAPPAF2LAMBDAPE19PC2-50T 50 test
EUR 784.50

KAPPA/CD19

KF319PE4-50T 50 test
EUR 466.00

LAMBDA/CD19

LAMBDAF19PE1-50T 50 test
EUR 350.30

LAMBDA/CD19

LF219PE4-50T 50 test
EUR 466.00

LAMBDA/KAPPA

LF2KPE3-50T 50 test
EUR 615.50

StepCount Kit1

STPKIT1-50T 50 test
EUR 854.70

StepCount Kit2

STPKIT2-50T 50 test
EUR 999.00

StepCount Kit4

STPKIT4-50T 50 test
EUR 713.00

TDT

TDTF-50T 100 test
EUR 1220.00

ERN2

ERN2 siRNA

20-abx915659
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ERN2 antibody

70R-31969 100 ug
EUR 327.00
Description: Rabbit polyclonal ERN2 antibody

ERN2 Antibody

37554-100ul 100ul
EUR 252.00

ERN2 Antibody

1-CSB-PA006646
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ERN2. Recognizes ERN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

ERN2 Antibody

1-CSB-PA436972
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ERN2. Recognizes ERN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ERN2 Antibody

1-CSB-PA585877
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ERN2. Recognizes ERN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ERN2 Conjugated Antibody

C37554 100ul
EUR 397.00

Anti-ERN2 Antibody

A05659-1 100ul
EUR 397.00
Description: Rabbit Polyclonal ERN2 Antibody. Validated in IF, IHC and tested in Human, Mouse.

Mouse ERN2 shRNA Plasmid

20-abx973784
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

ERN2 ELISA KIT|Human

EF004905 96 Tests
EUR 689.00

Human ERN2 ELISA KIT

ELI-32772h 96 Tests
EUR 824.00

Mouse Ern2 ELISA KIT

ELI-32212m 96 Tests
EUR 865.00

Human ERN2 shRNA Plasmid

20-abx957212
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Anti-ERN2 / IRE1b antibody

STJ71582 100 µg
EUR 260.00

Polyclonal ERN2 Antibody (N-term)

APR05846G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERN2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal ERN2 Antibody (C-term)

APR05847G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERN2 (C-term). This antibody is tested and proven to work in the following applications:

Ern2 ORF Vector (Rat) (pORF)

ORF066642 1.0 ug DNA
EUR 506.00

Ern2 ORF Vector (Mouse) (pORF)

ORF044071 1.0 ug DNA
EUR 506.00

ERN2 ORF Vector (Human) (pORF)

ORF018965 1.0 ug DNA Ask for price

ERN2 ELISA Kit (Human) (OKCA00810)

OKCA00810 96 Wells
EUR 833.00
Description: Description of target: Induces translational repression through 28S ribosomal RNA cleavage in response to ER stress. Pro-apoptotic. Appears to play no role in the unfolded-protein response, unlike closely related proteins.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

Polyclonal ERN2 / IRE1b Antibody (internal region)

APG00542G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ERN2 / IRE1b (internal region). This antibody is tested and proven to work in the following applications:

Ern2 sgRNA CRISPR Lentivector set (Rat)

K6215901 3 x 1.0 ug
EUR 339.00

ERN2 sgRNA CRISPR Lentivector set (Human)

K0693701 3 x 1.0 ug
EUR 339.00

Ern2 sgRNA CRISPR Lentivector set (Mouse)

K3997701 3 x 1.0 ug
EUR 339.00

Ern2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6215902 1.0 ug DNA
EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6215903 1.0 ug DNA
EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6215904 1.0 ug DNA
EUR 154.00

ERN2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0693702 1.0 ug DNA
EUR 154.00

ERN2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0693703 1.0 ug DNA
EUR 154.00

ERN2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0693704 1.0 ug DNA
EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3997702 1.0 ug DNA
EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3997703 1.0 ug DNA
EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3997704 1.0 ug DNA
EUR 154.00

ERN2 Protein Vector (Human) (pPB-C-His)

PV075857 500 ng Ask for price

ERN2 Protein Vector (Human) (pPB-N-His)

PV075858 500 ng Ask for price

ERN2 Protein Vector (Human) (pPM-C-HA)

PV075859 500 ng Ask for price

ERN2 Protein Vector (Human) (pPM-C-His)

PV075860 500 ng Ask for price

ERN2 Protein Vector (Mouse) (pPB-C-His)

PV176282 500 ng
EUR 1065.00

ERN2 Protein Vector (Mouse) (pPB-N-His)

PV176283 500 ng
EUR 1065.00

ERN2 Protein Vector (Mouse) (pPM-C-HA)

PV176284 500 ng
EUR 1065.00

ERN2 Protein Vector (Mouse) (pPM-C-His)

PV176285 500 ng
EUR 1065.00

ERN2 Protein Vector (Rat) (pPB-C-His)

PV266566 500 ng
EUR 1166.00

ERN2 Protein Vector (Rat) (pPB-N-His)

PV266567 500 ng
EUR 1166.00

ERN2 Protein Vector (Rat) (pPM-C-HA)

PV266568 500 ng
EUR 1166.00

ERN2 Protein Vector (Rat) (pPM-C-His)

PV266569 500 ng
EUR 1166.00

Ern2 3'UTR Luciferase Stable Cell Line

TU204094 1.0 ml Ask for price

Ern2 3'UTR GFP Stable Cell Line

TU155939 1.0 ml Ask for price

ERN2 3'UTR Luciferase Stable Cell Line

TU007029 1.0 ml
EUR 1394.00

Ern2 3'UTR Luciferase Stable Cell Line

TU105939 1.0 ml Ask for price

ERN2 3'UTR GFP Stable Cell Line

TU057029 1.0 ml
EUR 1394.00

Ern2 3'UTR GFP Stable Cell Line

TU254094 1.0 ml Ask for price

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody

abx033192-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody

abx033192-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody

abx028581-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody

abx028581-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody

20-abx325309
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody

abx430222-200ul 200 ul
EUR 286.00
  • Shipped within 1-3 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody

20-abx210949
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody

20-abx210950
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ERN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV656017 1.0 ug DNA
EUR 1355.00

ERN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV656021 1.0 ug DNA
EUR 1355.00

ERN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV656022 1.0 ug DNA
EUR 1355.00

Ern2 ELISA Kit| Mouse Serine/threonine-protein kinase/endoribon

EF014787 96 Tests
EUR 689.00

Human Serine/Threonine-Protein Kinase/Endoribonuclease IRE2 (ERN2) ELISA Kit

abx384836-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Serine/Threonine-Protein Kinase/Endoribonuclease IRE2 (ERN2) ELISA Kit

abx389157-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Ern2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6215905 3 x 1.0 ug
EUR 376.00

ERN2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0693705 3 x 1.0 ug
EUR 376.00

Ern2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3997705 3 x 1.0 ug
EUR 376.00

Ern2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6215906 1.0 ug DNA
EUR 167.00

Ern2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6215907 1.0 ug DNA
EUR 167.00

GGCX

GGCX antibody

70R-17470 50 ul
EUR 435.00
Description: Rabbit polyclonal GGCX antibody

GGCX Antibody

36501-100ul 100ul
EUR 252.00

GGCX Antibody

1-CSB-PA962996
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GGCX Antibody

DF12616 200ul
EUR 304.00
Description: GGCX Antibody detects endogenous levels of GGCX.

GGCX Antibody

1-CSB-PA181894
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

GGCX antibody

70R-6289 50 ug
EUR 467.00
Description: Rabbit polyclonal GGCX antibody raised against the middle region of GGCX

GGCX Antibody

1-CSB-PA009388GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GGCX Antibody

1-CSB-PA009388LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GGCX siRNA

20-abx902134
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GGCX siRNA

20-abx917820
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GGCX siRNA

20-abx917821
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-GGCX

YF-PA23776 50 ul
EUR 334.00
Description: Mouse polyclonal to GGCX

GGCX Blocking Peptide

33R-2973 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GGCX antibody, catalog no. 70R-6289

GGCX Blocking Peptide

DF12616-BP 1mg
EUR 195.00

GGCX Conjugated Antibody

C36501 100ul
EUR 397.00

GGCX cloning plasmid

CSB-CL009388HU-10ug 10ug
EUR 474.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2277
  • Sequence: atggcggtgtctgccgggtccgcgcggacctcgcccagctcagataaagtacagaaagacaaggctgaactgatctcagggcccaggcaggacagccgaatagggaaactcttgggttttgagtggacagatttgtccagttggcggaggctggtgaccctgctgaatcgaccaa
  • Show more
Description: A cloning plasmid for the GGCX gene.

GGCX Rabbit pAb

A1806-100ul 100 ul
EUR 308.00

GGCX Rabbit pAb

A1806-200ul 200 ul
EUR 459.00

GGCX Rabbit pAb

A1806-20ul 20 ul
EUR 183.00

GGCX Rabbit pAb

A1806-50ul 50 ul
EUR 223.00

anti- GGCX antibody

FNab03444 100µg
EUR 505.25
  • Immunogen: gamma-glutamyl carboxylase
  • Uniprot ID: P38435
  • Gene ID: 2677
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GGCX

Anti-GGCX antibody

PAab03444 100 ug
EUR 355.00

Anti-GGCX antibody

STJ111114 100 µl
EUR 277.00
Description: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.

Anti-GGCX Antibody

STJ501151 100 µg
EUR 476.00

Anti-GGCX antibody

STJ71959 100 µg
EUR 359.00

GGCX ELISA KIT|Human

EF009845 96 Tests
EUR 689.00

Mouse GGCX shRNA Plasmid

20-abx974692
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat GGCX shRNA Plasmid

20-abx986662
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GGCX Antibody, HRP conjugated

1-CSB-PA009388LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GGCX Antibody, FITC conjugated

1-CSB-PA009388LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GGCX Antibody, Biotin conjugated

1-CSB-PA009388LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GGCX shRNA Plasmid

20-abx951786
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GGCX Recombinant Protein (Human)

RP013150 100 ug Ask for price

GGCX Recombinant Protein (Rat)

RP202541 100 ug Ask for price

GGCX Recombinant Protein (Mouse)

RP136367 100 ug Ask for price

Anti-GGCX Antibody (Biotin)

STJ501152 100 µg
EUR 586.00

Anti-GGCX Antibody (FITC)

STJ501153 100 µg
EUR 586.00

Polyclonal GGCX Antibody (C-Term)

APG00603G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GGCX (C-Term). This antibody is tested and proven to work in the following applications:

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx026095-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx026095-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx214843
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx112671
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx124056
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx242121
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Polyclonal GGCX Antibody (C-Terminus)

APG01214G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GGCX (C-Terminus). This antibody is tested and proven to work in the following applications:

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx233444-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx334131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx432743-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Ggcx ORF Vector (Rat) (pORF)

ORF067515 1.0 ug DNA
EUR 506.00

GGCX ORF Vector (Human) (pORF)

ORF004384 1.0 ug DNA
EUR 95.00

Ggcx ORF Vector (Mouse) (pORF)

ORF045457 1.0 ug DNA
EUR 506.00

pECMV-Ggcx-m-FLAG Plasmid

PVT15269 2 ug
EUR 325.00

GGCX ELISA Kit (Human) (OKEH08326)

OKEH08326 96 Wells
EUR 896.00
Description: Description of target: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9pg/mL

GGCX ELISA Kit (Rat) (OKEH08327)

OKEH08327 96 Wells
EUR 896.00
Description: Description of target: catalyzes the posttranslational modification of glutamate to gamma-carboxyglutamate (Gla); may mediate functions of vitamin K-dependent proteins (VKDPs) [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.068ng/mL

Gamma-Glutamyl Carboxylase (GGCX) Antibody (HRP)

20-abx338281
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (FITC)

20-abx338282
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (Biotin)

20-abx338283
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ggcx sgRNA CRISPR Lentivector set (Rat)

K6943501 3 x 1.0 ug
EUR 339.00

Ggcx sgRNA CRISPR Lentivector set (Mouse)

K4585301 3 x 1.0 ug
EUR 339.00

GGCX sgRNA CRISPR Lentivector set (Human)

K0853901 3 x 1.0 ug
EUR 339.00

GNG4

GNG4 siRNA

20-abx918198
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG4 siRNA

20-abx918199
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG4 Antibody

46006-100ul 100ul
EUR 252.00

GNG4 Antibody

46006-50ul 50ul
EUR 187.00

GNG4 antibody

70R-17532 50 ul
EUR 435.00
Description: Rabbit polyclonal GNG4 antibody

GNG4 Antibody

DF9560 200ul
EUR 304.00
Description: GNG4 Antibody detects endogenous levels of total GNG4.

GNG4 Antibody

1-CSB-PA009616GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GNG4 Antibody

1-CSB-PA009616LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

pENTR223-GNG4

PVT12310 2 ug
EUR 391.00

GNG4 Conjugated Antibody

C46006 100ul
EUR 397.00

GNG4 cloning plasmid

CSB-CL009616HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 228
  • Sequence: atgaaagagggcatgtctaataacagcaccactagcatctcccaagccaggaaagctgtggagcagctaaagatggaagcctgtatggacagggtcaaggtctcccaggcagctgcggacctcctggcctactgtgaagctcacgtgcgggaagatcctctcatcattccagtgcc
  • Show more
Description: A cloning plasmid for the GNG4 gene.

anti- GNG4 antibody

FNab03546 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: guanine nucleotide binding protein(G protein), gamma 4
  • Uniprot ID: P50150
  • Gene ID: 2786
  • Research Area: Signal Transduction
Description: Antibody raised against GNG4

GNG4 Polyclonal Antibody

A59266 100 µg
EUR 570.55
Description: Ask the seller for details

GNG4 Blocking Peptide

DF9560-BP 1mg
EUR 195.00

Anti-GNG4 antibody

PAab03546 100 ug
EUR 386.00

GNG4 ELISA KIT|Human

EF009918 96 Tests
EUR 689.00

Human GNG4 ELISA KIT

ELI-43249h 96 Tests
EUR 824.00

Mouse Gng4 ELISA KIT

ELI-43530m 96 Tests
EUR 865.00

GNG4 protein (His tag)

80R-3652 50 ug
EUR 327.00
Description: Purified recombinant GNG4 protein (His tag)

Mouse GNG4 shRNA Plasmid

20-abx970599
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GNG4 shRNA Plasmid

20-abx951858
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GNG4 Antibody, HRP conjugated

1-CSB-PA009616LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG4 Antibody, FITC conjugated

1-CSB-PA009616LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG4 Antibody, Biotin conjugated

1-CSB-PA009616LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG4 Recombinant Protein (Human)

RP013549 100 ug Ask for price

GNG4 Recombinant Protein (Mouse)

RP139031 100 ug Ask for price

GNG4 Polyclonal Antibody, Biotin Conjugated

A59267 100 µg
EUR 570.55
Description: The best epigenetics products

GNG4 Polyclonal Antibody, FITC Conjugated

A59268 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNG4 Polyclonal Antibody, HRP Conjugated

A59269 100 µg
EUR 570.55
Description: fast delivery possible

GNG4 ORF Vector (Human) (pORF)

ORF004517 1.0 ug DNA
EUR 95.00

Gng4 ORF Vector (Mouse) (pORF)

ORF046345 1.0 ug DNA
EUR 506.00

GNG4 sgRNA CRISPR Lentivector set (Human)

K0876801 3 x 1.0 ug
EUR 339.00

Gng4 sgRNA CRISPR Lentivector set (Mouse)

K3157601 3 x 1.0 ug
EUR 339.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0876802 1.0 ug DNA
EUR 154.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0876803 1.0 ug DNA
EUR 154.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0876804 1.0 ug DNA
EUR 154.00

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx112897
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx215655
  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx301196
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Protein

20-abx262737
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

abx233546-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3157602 1.0 ug DNA
EUR 154.00

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3157603 1.0 ug DNA
EUR 154.00

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3157604 1.0 ug DNA
EUR 154.00

GNG4 Protein Vector (Mouse) (pPB-C-His)

PV185378 500 ng
EUR 603.00

GNG4 Protein Vector (Mouse) (pPB-N-His)

PV185379 500 ng
EUR 603.00

GNG4 Protein Vector (Mouse) (pPM-C-HA)

PV185380 500 ng
EUR 603.00

GNG4 Protein Vector (Mouse) (pPM-C-His)

PV185381 500 ng
EUR 603.00

Recombinant Human GNG4 Protein, His, E.coli-10ug

QP12019-10ug 10ug
EUR 201.00

Recombinant Human GNG4 Protein, His, E.coli-1mg

QP12019-1mg 1mg
EUR 5251.00

Recombinant Human GNG4 Protein, His, E.coli-2ug

QP12019-2ug 2ug
EUR 155.00

GNG4 Protein Vector (Human) (pPB-C-His)

PV018065 500 ng
EUR 329.00

GNG4 Protein Vector (Human) (pPB-N-His)

PV018066 500 ng
EUR 329.00

GNG4 Protein Vector (Human) (pPM-C-HA)

PV018067 500 ng
EUR 329.00

GNG4 Protein Vector (Human) (pPM-C-His)

PV018068 500 ng
EUR 329.00

Gng4 3'UTR Luciferase Stable Cell Line

TU205230 1.0 ml Ask for price

Gng4 3'UTR GFP Stable Cell Line

TU158871 1.0 ml Ask for price

GNG4 3'UTR Luciferase Stable Cell Line

TU008993 1.0 ml
EUR 2333.00

Gng4 3'UTR Luciferase Stable Cell Line

TU108871 1.0 ml Ask for price

GNG4 3'UTR GFP Stable Cell Line

TU058993 1.0 ml
EUR 2333.00

GNG6

Product not found

H2AX

Histone H2AX antibody

70R-31603 100 ug
EUR 327.00
Description: Rabbit polyclonal Histone H2AX antibody

Histone H2Ax antibody

70R-15297 100 ug
EUR 327.00
Description: Rabbit polyclonal Histone H2Ax antibody

Histone H2AX Antibody

33686-100ul 100ul
EUR 252.00

Histone H2AX Antibody

33686-50ul 50ul
EUR 187.00

Histone H2AX Antibody

3761-100
EUR 316.00

Histone H2AX Antibody

CSB-PA833019-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against Histone H2AX. Recognizes Histone H2AX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

Histone H2AX Antibody

CSB-PA833019-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against Histone H2AX. Recognizes Histone H2AX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

H2AX Polyclonal Antibody

A-7701 100 µl
EUR 847.50
Description: The best epigenetics products

H2AX (pY143) Antibody

abx215792-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

anti-p-H2AX

LF-PA0025 100 ul
EUR 334.00
Description: Rabbit polyclonal to p-H2AX

Histone H2AX Rabbit pAb

A11361-100ul 100 ul
EUR 308.00

Histone H2AX Rabbit pAb

A11361-200ul 200 ul
EUR 459.00

Histone H2AX Rabbit pAb

A11361-20ul 20 ul
EUR 183.00

Histone H2AX Rabbit pAb

A11361-50ul 50 ul
EUR 223.00

Histone H2AX Rabbit pAb

A11463-100ul 100 ul
EUR 308.00

Histone H2AX Rabbit pAb

A11463-200ul 200 ul
EUR 459.00

Histone H2AX Rabbit pAb

A11463-20ul 20 ul
EUR 183.00

Histone H2AX Rabbit pAb

A11463-50ul 50 ul
EUR 223.00

Histone H2AX Rabbit pAb

A11540-100ul 100 ul
EUR 308.00

Histone H2AX Rabbit pAb

A11540-200ul 200 ul
EUR 459.00

Histone H2AX Rabbit pAb

A11540-20ul 20 ul
EUR 183.00

Histone H2AX Rabbit pAb

A11540-50ul 50 ul
EUR 223.00

Histone H2Ax antibody (HRP)

60R-1726 100 ug
EUR 327.00
Description: Rabbit polyclonal Histone H2Ax antibody (HRP)

Histone H2Ax antibody (FITC)

60R-1727 100 ug
EUR 327.00
Description: Rabbit polyclonal Histone H2Ax antibody (FITC)

Histone H2Ax antibody (biotin)

60R-1728 100 ug
EUR 327.00
Description: Rabbit polyclonal Histone H2Ax antibody (biotin)

Human Histone H2AX (H2AFX)

1-CSB-RP154294h
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 17.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Histone H2AX(H2AFX),partial expressed in E.coli

Anti-H2AX pS139 Antibody

A00241 100uL
EUR 443.00
Description: Rabbit Polyclonal H2AX pS139 Antibody. Validated in WB and tested in Human.

Histone H2AX (H2AFX) Antibody

20-abx123403
  • EUR 592.00
  • EUR 857.00
  • EUR 411.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H2AX (H2AFX) Antibody

20-abx013399
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Histone H2AX Conjugated Antibody

C33686 100ul
EUR 397.00

Histone H2AX (H2AFX) Antibody

abx330514-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Phospho-H2AX (Tyr143) Antibody

AF8482 200ul
EUR 376.00
Description: H2AX (Phospho-Tyr143) Antibody detects endogenous levels of H2AX only when phosphorylated at Tyr143.

H2AX (Phospho- Tyr143) Antibody

ABF8482 100 ug
EUR 438.00

Histone H2AX Mouse mAb

A19415-100ul 100 ul Ask for price

Histone H2AX Mouse mAb

A19415-200ul 200 ul Ask for price

Histone H2AX Mouse mAb

A19415-20ul 20 ul Ask for price

Histone H2AX Mouse mAb

A19415-50ul 50 ul
EUR 308.00

Histone H2AX Rabbit pAb

A2082-100ul 100 ul
EUR 308.00

Histone H2AX Rabbit pAb

A2082-200ul 200 ul
EUR 459.00

Histone H2AX Rabbit pAb

A2082-20ul 20 ul
EUR 183.00

Histone H2AX Rabbit pAb

A2082-50ul 50 ul
EUR 223.00

Anti-Histone H2AX antibody

STJ11100613 50 µl
EUR 287.00
Description: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the histone H2A family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.

Phospho-H2AX (Tyr143) Blocking Peptide

AF8482-BP 1mg
EUR 195.00

H2AX ELISA Kit (Human) (OKAN04813)

OKAN04813 96 Wells
EUR 792.00
Description: Description of target: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the histone H2A family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

Phospho-Histone H2AX-S139 Rabbit mAb

AP0687-100ul 100 ul
EUR 459.00

Phospho-Histone H2AX-S139 Rabbit mAb

AP0687-200ul 200 ul Ask for price

Phospho-Histone H2AX-S139 Rabbit mAb

AP0687-20ul 20 ul
EUR 221.00

Phospho-Histone H2AX-S139 Rabbit mAb

AP0687-50ul 50 ul
EUR 308.00

Mouse H2afx/ Histone H2AX ELISA Kit

E0645Mo 1 Kit
EUR 632.00

Human H2AFX/ Histone H2AX ELISA Kit

E1083Hu 1 Kit
EUR 605.00

Human H2AFX(Histone H2AX) ELISA Kit

EH14622 96T
EUR 524.10
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Histone H2AX Phospho-Ser139 (H2AFX pS139) Antibody

20-abx242923
  • EUR 467.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Rabbit Anti Human Histone H2ax Polyclonal Antibody

CPBT-67531RH 0.1 mg
EUR 944.00

Phospho Histone H2AX (S139) Monoclonal Antibody [RMC097A]

A68410 100 µl
EUR 628.55
Description: kits suitable for this type of research

Anti-PSer 139 Histone H2AX Antibody (Monoclonal, 9F3)

M00241 200ug/vial
EUR 553.00
Description: Mouse Anti-PSer 139 Histone H2AX Antibody (Monoclonal, 9F3) for H2AFX detection tested with WB in Human, Mouse, Rat.

Anti-Histone H2AX Rabbit Monoclonal Antibody, Clone#RM214

M00241-2 100ug
EUR 478.00
Description: Anti-Histone H2AX Rabbit Monoclonal Antibody, Clone#RM214 tested in WB, ELISA, Multiplex, ICC, reactive to All Vertebrates

H3C7

Product not found

H3C9

Product not found

H4C6

Product not found

IGF3

Product not found