Category: Data Sheet

ERN2 siRNA
20-abx915659	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

ERN2 antibody
70R-31969	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal ERN2 antibody

ERN2 Antibody
37554-100ul	SAB	100ul	EUR 252.00

ERN2 Antibody
1-CSB-PA006646	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against ERN2. Recognizes ERN2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/10000

ERN2 Antibody
1-CSB-PA436972	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ERN2. Recognizes ERN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ERN2 Antibody
1-CSB-PA585877	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ERN2. Recognizes ERN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

ERN2 Conjugated Antibody
C37554	SAB	100ul	EUR 397.00

Anti-ERN2 Antibody
A05659-1	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal ERN2 Antibody. Validated in IF, IHC and tested in Human, Mouse.

Mouse ERN2 shRNA Plasmid
20-abx973784	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

ERN2 ELISA KIT|Human
EF004905	Lifescience Market	96 Tests	EUR 689.00

Human ERN2 ELISA KIT
ELI-32772h	Lifescience Market	96 Tests	EUR 824.00

Mouse Ern2 ELISA KIT
ELI-32212m	Lifescience Market	96 Tests	EUR 865.00

Human ERN2 shRNA Plasmid
20-abx957212	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Anti-ERN2 / IRE1b antibody
STJ71582	St John's Laboratory	100 µg	EUR 260.00

Polyclonal ERN2 Antibody (N-term)
APR05846G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERN2 (N-term). This antibody is tested and proven to work in the following applications:

Polyclonal ERN2 Antibody (C-term)
APR05847G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ERN2 (C-term). This antibody is tested and proven to work in the following applications:

Ern2 ORF Vector (Rat) (pORF)
ORF066642	ABM	1.0 ug DNA	EUR 506.00

Ern2 ORF Vector (Mouse) (pORF)
ORF044071	ABM	1.0 ug DNA	EUR 506.00

ERN2 ORF Vector (Human) (pORF)
ORF018965	ABM	1.0 ug DNA	Ask for price

ERN2 ELISA Kit (Human) (OKCA00810)
OKCA00810	Aviva Systems Biology	96 Wells	EUR 833.00
Description: Description of target: Induces translational repression through 28S ribosomal RNA cleavage in response to ER stress. Pro-apoptotic. Appears to play no role in the unfolded-protein response, unlike closely related proteins.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 5.8 pg/mL

Polyclonal ERN2 / IRE1b Antibody (internal region)
APG00542G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ERN2 / IRE1b (internal region). This antibody is tested and proven to work in the following applications:

Ern2 sgRNA CRISPR Lentivector set (Rat)
K6215901	ABM	3 x 1.0 ug	EUR 339.00

ERN2 sgRNA CRISPR Lentivector set (Human)
K0693701	ABM	3 x 1.0 ug	EUR 339.00

Ern2 sgRNA CRISPR Lentivector set (Mouse)
K3997701	ABM	3 x 1.0 ug	EUR 339.00

Ern2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6215902	ABM	1.0 ug DNA	EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6215903	ABM	1.0 ug DNA	EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6215904	ABM	1.0 ug DNA	EUR 154.00

ERN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0693702	ABM	1.0 ug DNA	EUR 154.00

ERN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0693703	ABM	1.0 ug DNA	EUR 154.00

ERN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0693704	ABM	1.0 ug DNA	EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3997702	ABM	1.0 ug DNA	EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3997703	ABM	1.0 ug DNA	EUR 154.00

Ern2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3997704	ABM	1.0 ug DNA	EUR 154.00

ERN2 Protein Vector (Human) (pPB-C-His)
PV075857	ABM	500 ng	Ask for price

ERN2 Protein Vector (Human) (pPB-N-His)
PV075858	ABM	500 ng	Ask for price

ERN2 Protein Vector (Human) (pPM-C-HA)
PV075859	ABM	500 ng	Ask for price

ERN2 Protein Vector (Human) (pPM-C-His)
PV075860	ABM	500 ng	Ask for price

ERN2 Protein Vector (Mouse) (pPB-C-His)
PV176282	ABM	500 ng	EUR 1065.00

ERN2 Protein Vector (Mouse) (pPB-N-His)
PV176283	ABM	500 ng	EUR 1065.00

ERN2 Protein Vector (Mouse) (pPM-C-HA)
PV176284	ABM	500 ng	EUR 1065.00

ERN2 Protein Vector (Mouse) (pPM-C-His)
PV176285	ABM	500 ng	EUR 1065.00

ERN2 Protein Vector (Rat) (pPB-C-His)
PV266566	ABM	500 ng	EUR 1166.00

ERN2 Protein Vector (Rat) (pPB-N-His)
PV266567	ABM	500 ng	EUR 1166.00

ERN2 Protein Vector (Rat) (pPM-C-HA)
PV266568	ABM	500 ng	EUR 1166.00

ERN2 Protein Vector (Rat) (pPM-C-His)
PV266569	ABM	500 ng	EUR 1166.00

Ern2 3'UTR Luciferase Stable Cell Line
TU204094	ABM	1.0 ml	Ask for price

Ern2 3'UTR GFP Stable Cell Line
TU155939	ABM	1.0 ml	Ask for price

ERN2 3'UTR Luciferase Stable Cell Line
TU007029	ABM	1.0 ml	EUR 1394.00

Ern2 3'UTR Luciferase Stable Cell Line
TU105939	ABM	1.0 ml	Ask for price

ERN2 3'UTR GFP Stable Cell Line
TU057029	ABM	1.0 ml	EUR 1394.00

Ern2 3'UTR GFP Stable Cell Line
TU254094	ABM	1.0 ml	Ask for price

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody
abx033192-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody
abx033192-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody
abx028581-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody
abx028581-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody
20-abx325309	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody
abx430222-200ul	Abbexa	200 ul	EUR 286.00
Shipped within 1-3 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody
20-abx210949	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Endoplasmic Reticulum To Nucleus Signaling 2 (ERN2) Antibody
20-abx210950	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

ERN2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV656017	ABM	1.0 ug DNA	EUR 1355.00

ERN2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV656021	ABM	1.0 ug DNA	EUR 1355.00

ERN2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV656022	ABM	1.0 ug DNA	EUR 1355.00

Ern2 ELISA Kit| Mouse Serine/threonine-protein kinase/endoribon
EF014787	Lifescience Market	96 Tests	EUR 689.00

Human Serine/Threonine-Protein Kinase/Endoribonuclease IRE2 (ERN2) ELISA Kit
abx384836-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Mouse Serine/Threonine-Protein Kinase/Endoribonuclease IRE2 (ERN2) ELISA Kit
abx389157-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Ern2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6215905	ABM	3 x 1.0 ug	EUR 376.00

ERN2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0693705	ABM	3 x 1.0 ug	EUR 376.00

Ern2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3997705	ABM	3 x 1.0 ug	EUR 376.00

Ern2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6215906	ABM	1.0 ug DNA	EUR 167.00

Ern2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6215907	ABM	1.0 ug DNA	EUR 167.00

GGCX antibody
70R-17470	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal GGCX antibody

GGCX Antibody
36501-100ul	SAB	100ul	EUR 252.00

GGCX Antibody
1-CSB-PA962996	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GGCX Antibody
DF12616	Affbiotech	200ul	EUR 304.00
Description: GGCX Antibody detects endogenous levels of GGCX.

GGCX Antibody
1-CSB-PA181894	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

GGCX antibody
70R-6289	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal GGCX antibody raised against the middle region of GGCX

GGCX Antibody
1-CSB-PA009388GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GGCX Antibody
1-CSB-PA009388LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GGCX siRNA
20-abx902134	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GGCX siRNA
20-abx917820	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GGCX siRNA
20-abx917821	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-GGCX
YF-PA23776	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to GGCX

GGCX Blocking Peptide
33R-2973	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GGCX antibody, catalog no. 70R-6289

GGCX Blocking Peptide
DF12616-BP	Affbiotech	1mg	EUR 195.00

GGCX Conjugated Antibody
C36501	SAB	100ul	EUR 397.00

GGCX cloning plasmid
CSB-CL009388HU-10ug	Cusabio	10ug	EUR 474.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2277 Sequence: atggcggtgtctgccgggtccgcgcggacctcgcccagctcagataaagtacagaaagacaaggctgaactgatctcagggcccaggcaggacagccgaatagggaaactcttgggttttgagtggacagatttgtccagttggcggaggctggtgaccctgctgaatcgaccaa Show more
Description: A cloning plasmid for the GGCX gene.

GGCX Rabbit pAb
A1806-100ul	Abclonal	100 ul	EUR 308.00

GGCX Rabbit pAb
A1806-200ul	Abclonal	200 ul	EUR 459.00

GGCX Rabbit pAb
A1806-20ul	Abclonal	20 ul	EUR 183.00

GGCX Rabbit pAb
A1806-50ul	Abclonal	50 ul	EUR 223.00

anti- GGCX antibody
FNab03444	FN Test	100µg	EUR 505.25
Immunogen: gamma-glutamyl carboxylase Uniprot ID: P38435 Gene ID: 2677 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GGCX

Anti-GGCX antibody
PAab03444	Lifescience Market	100 ug	EUR 355.00

Anti-GGCX antibody
STJ111114	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.

Anti-GGCX Antibody
STJ501151	St John's Laboratory	100 µg	EUR 476.00

Anti-GGCX antibody
STJ71959	St John's Laboratory	100 µg	EUR 359.00

GGCX ELISA KIT|Human
EF009845	Lifescience Market	96 Tests	EUR 689.00

Mouse GGCX shRNA Plasmid
20-abx974692	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat GGCX shRNA Plasmid
20-abx986662	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GGCX Antibody, HRP conjugated
1-CSB-PA009388LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GGCX Antibody, FITC conjugated
1-CSB-PA009388LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GGCX Antibody, Biotin conjugated
1-CSB-PA009388LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GGCX shRNA Plasmid
20-abx951786	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GGCX Recombinant Protein (Human)
RP013150	ABM	100 ug	Ask for price

GGCX Recombinant Protein (Rat)
RP202541	ABM	100 ug	Ask for price

GGCX Recombinant Protein (Mouse)
RP136367	ABM	100 ug	Ask for price

Anti-GGCX Antibody (Biotin)
STJ501152	St John's Laboratory	100 µg	EUR 586.00

Anti-GGCX Antibody (FITC)
STJ501153	St John's Laboratory	100 µg	EUR 586.00

Polyclonal GGCX Antibody (C-Term)
APG00603G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GGCX (C-Term). This antibody is tested and proven to work in the following applications:

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx026095-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx026095-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx214843	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx112671	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx124056	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx242121	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Polyclonal GGCX Antibody (C-Terminus)
APG01214G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GGCX (C-Terminus). This antibody is tested and proven to work in the following applications:

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx233444-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx334131	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx432743-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

Ggcx ORF Vector (Rat) (pORF)
ORF067515	ABM	1.0 ug DNA	EUR 506.00

GGCX ORF Vector (Human) (pORF)
ORF004384	ABM	1.0 ug DNA	EUR 95.00

Ggcx ORF Vector (Mouse) (pORF)
ORF045457	ABM	1.0 ug DNA	EUR 506.00

pECMV-Ggcx-m-FLAG Plasmid
PVT15269	Lifescience Market	2 ug	EUR 325.00

GGCX ELISA Kit (Human) (OKEH08326)
OKEH08326	Aviva Systems Biology	96 Wells	EUR 896.00
Description: Description of target: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9pg/mL

GGCX ELISA Kit (Rat) (OKEH08327)
OKEH08327	Aviva Systems Biology	96 Wells	EUR 896.00
Description: Description of target: catalyzes the posttranslational modification of glutamate to gamma-carboxyglutamate (Gla); may mediate functions of vitamin K-dependent proteins (VKDPs) [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.068ng/mL

Gamma-Glutamyl Carboxylase (GGCX) Antibody (HRP)
20-abx338281	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (FITC)
20-abx338282	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (Biotin)
20-abx338283	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Ggcx sgRNA CRISPR Lentivector set (Rat)
K6943501	ABM	3 x 1.0 ug	EUR 339.00

Ggcx sgRNA CRISPR Lentivector set (Mouse)
K4585301	ABM	3 x 1.0 ug	EUR 339.00

GGCX sgRNA CRISPR Lentivector set (Human)
K0853901	ABM	3 x 1.0 ug	EUR 339.00

GNG4 siRNA
20-abx918198	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNG4 siRNA
20-abx918199	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNG4 Antibody
46006-100ul	SAB	100ul	EUR 252.00

GNG4 Antibody
46006-50ul	SAB	50ul	EUR 187.00

GNG4 antibody
70R-17532	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal GNG4 antibody

GNG4 Antibody
DF9560	Affbiotech	200ul	EUR 304.00
Description: GNG4 Antibody detects endogenous levels of total GNG4.

GNG4 Antibody
1-CSB-PA009616GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GNG4 Antibody
1-CSB-PA009616LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

pENTR223-GNG4
PVT12310	Lifescience Market	2 ug	EUR 391.00

GNG4 Conjugated Antibody
C46006	SAB	100ul	EUR 397.00

GNG4 cloning plasmid
CSB-CL009616HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 228 Sequence: atgaaagagggcatgtctaataacagcaccactagcatctcccaagccaggaaagctgtggagcagctaaagatggaagcctgtatggacagggtcaaggtctcccaggcagctgcggacctcctggcctactgtgaagctcacgtgcgggaagatcctctcatcattccagtgcc Show more
Description: A cloning plasmid for the GNG4 gene.

anti- GNG4 antibody
FNab03546	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:20-1:200 Immunogen: guanine nucleotide binding protein(G protein), gamma 4 Uniprot ID: P50150 Gene ID: 2786 Research Area: Signal Transduction
Description: Antibody raised against GNG4

GNG4 Polyclonal Antibody
A59266	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GNG4 Blocking Peptide
DF9560-BP	Affbiotech	1mg	EUR 195.00

Anti-GNG4 antibody
PAab03546	Lifescience Market	100 ug	EUR 386.00

GNG4 ELISA KIT|Human
EF009918	Lifescience Market	96 Tests	EUR 689.00

Human GNG4 ELISA KIT
ELI-43249h	Lifescience Market	96 Tests	EUR 824.00

Mouse Gng4 ELISA KIT
ELI-43530m	Lifescience Market	96 Tests	EUR 865.00

GNG4 protein (His tag)
80R-3652	Fitzgerald	50 ug	EUR 327.00
Description: Purified recombinant GNG4 protein (His tag)

Mouse GNG4 shRNA Plasmid
20-abx970599	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GNG4 shRNA Plasmid
20-abx951858	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GNG4 Antibody, HRP conjugated
1-CSB-PA009616LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG4 Antibody, FITC conjugated
1-CSB-PA009616LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG4 Antibody, Biotin conjugated
1-CSB-PA009616LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG4 Recombinant Protein (Human)
RP013549	ABM	100 ug	Ask for price

GNG4 Recombinant Protein (Mouse)
RP139031	ABM	100 ug	Ask for price

GNG4 Polyclonal Antibody, Biotin Conjugated
A59267	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GNG4 Polyclonal Antibody, FITC Conjugated
A59268	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GNG4 Polyclonal Antibody, HRP Conjugated
A59269	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GNG4 ORF Vector (Human) (pORF)
ORF004517	ABM	1.0 ug DNA	EUR 95.00

Gng4 ORF Vector (Mouse) (pORF)
ORF046345	ABM	1.0 ug DNA	EUR 506.00

GNG4 sgRNA CRISPR Lentivector set (Human)
K0876801	ABM	3 x 1.0 ug	EUR 339.00

Gng4 sgRNA CRISPR Lentivector set (Mouse)
K3157601	ABM	3 x 1.0 ug	EUR 339.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0876802	ABM	1.0 ug DNA	EUR 154.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0876803	ABM	1.0 ug DNA	EUR 154.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0876804	ABM	1.0 ug DNA	EUR 154.00

G Protein Subunit Gamma 4 (GNG4) Antibody
20-abx112897	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody
20-abx215655	Abbexa	EUR 425.00 EUR 342.00	0 1
Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody
20-abx301196	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Protein
20-abx262737	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	0 1 2
Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody
abx233546-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3157602	ABM	1.0 ug DNA	EUR 154.00

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3157603	ABM	1.0 ug DNA	EUR 154.00

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3157604	ABM	1.0 ug DNA	EUR 154.00

GNG4 Protein Vector (Mouse) (pPB-C-His)
PV185378	ABM	500 ng	EUR 603.00

GNG4 Protein Vector (Mouse) (pPB-N-His)
PV185379	ABM	500 ng	EUR 603.00

GNG4 Protein Vector (Mouse) (pPM-C-HA)
PV185380	ABM	500 ng	EUR 603.00

GNG4 Protein Vector (Mouse) (pPM-C-His)
PV185381	ABM	500 ng	EUR 603.00

Recombinant Human GNG4 Protein, His, E.coli-10ug
QP12019-10ug	EnQuireBio	10ug	EUR 201.00

Recombinant Human GNG4 Protein, His, E.coli-1mg
QP12019-1mg	EnQuireBio	1mg	EUR 5251.00

Recombinant Human GNG4 Protein, His, E.coli-2ug
QP12019-2ug	EnQuireBio	2ug	EUR 155.00

GNG4 Protein Vector (Human) (pPB-C-His)
PV018065	ABM	500 ng	EUR 329.00

GNG4 Protein Vector (Human) (pPB-N-His)
PV018066	ABM	500 ng	EUR 329.00

GNG4 Protein Vector (Human) (pPM-C-HA)
PV018067	ABM	500 ng	EUR 329.00

GNG4 Protein Vector (Human) (pPM-C-His)
PV018068	ABM	500 ng	EUR 329.00

Gng4 3'UTR Luciferase Stable Cell Line
TU205230	ABM	1.0 ml	Ask for price

Gng4 3'UTR GFP Stable Cell Line
TU158871	ABM	1.0 ml	Ask for price

GNG4 3'UTR Luciferase Stable Cell Line
TU008993	ABM	1.0 ml	EUR 2333.00

Gng4 3'UTR Luciferase Stable Cell Line
TU108871	ABM	1.0 ml	Ask for price

GNG4 3'UTR GFP Stable Cell Line
TU058993	ABM	1.0 ml	EUR 2333.00

Product not found

Histone H2AX antibody
70R-31603	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal Histone H2AX antibody

Histone H2Ax antibody
70R-15297	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal Histone H2Ax antibody

Histone H2AX Antibody
33686-100ul	SAB	100ul	EUR 252.00

Histone H2AX Antibody
33686-50ul	SAB	50ul	EUR 187.00

Histone H2AX Antibody
3761-100	Biovision		EUR 316.00

Histone H2AX Antibody
CSB-PA833019-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against Histone H2AX. Recognizes Histone H2AX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

Histone H2AX Antibody
CSB-PA833019-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against Histone H2AX. Recognizes Histone H2AX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF;WB:1:500-1:3000, IF:1:100-1:500

H2AX Polyclonal Antibody
A-7701	EpiGentek	100 µl	EUR 847.50
Description: The best epigenetics products

H2AX (pY143) Antibody
abx215792-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

anti-p-H2AX
LF-PA0025	Abfrontier	100 ul	EUR 334.00
Description: Rabbit polyclonal to p-H2AX

Histone H2AX Rabbit pAb
A11361-100ul	Abclonal	100 ul	EUR 308.00

Histone H2AX Rabbit pAb
A11361-200ul	Abclonal	200 ul	EUR 459.00

Histone H2AX Rabbit pAb
A11361-20ul	Abclonal	20 ul	EUR 183.00

Histone H2AX Rabbit pAb
A11361-50ul	Abclonal	50 ul	EUR 223.00

Histone H2AX Rabbit pAb
A11463-100ul	Abclonal	100 ul	EUR 308.00

Histone H2AX Rabbit pAb
A11463-200ul	Abclonal	200 ul	EUR 459.00

Histone H2AX Rabbit pAb
A11463-20ul	Abclonal	20 ul	EUR 183.00

Histone H2AX Rabbit pAb
A11463-50ul	Abclonal	50 ul	EUR 223.00

Histone H2AX Rabbit pAb
A11540-100ul	Abclonal	100 ul	EUR 308.00

Histone H2AX Rabbit pAb
A11540-200ul	Abclonal	200 ul	EUR 459.00

Histone H2AX Rabbit pAb
A11540-20ul	Abclonal	20 ul	EUR 183.00

Histone H2AX Rabbit pAb
A11540-50ul	Abclonal	50 ul	EUR 223.00

Histone H2Ax antibody (HRP)
60R-1726	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal Histone H2Ax antibody (HRP)

Histone H2Ax antibody (FITC)
60R-1727	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal Histone H2Ax antibody (FITC)

Histone H2Ax antibody (biotin)
60R-1728	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal Histone H2Ax antibody (biotin)

Human Histone H2AX (H2AFX)
1-CSB-RP154294h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 17.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Histone H2AX(H2AFX),partial expressed in E.coli

Anti-H2AX pS139 Antibody
A00241	BosterBio	100uL	EUR 443.00
Description: Rabbit Polyclonal H2AX pS139 Antibody. Validated in WB and tested in Human.

Histone H2AX (H2AFX) Antibody
20-abx123403	Abbexa	EUR 592.00 EUR 857.00 EUR 411.00	0 1 2
Shipped within 5-10 working days.

Histone H2AX (H2AFX) Antibody
20-abx013399	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

Histone H2AX Conjugated Antibody
C33686	SAB	100ul	EUR 397.00

Histone H2AX (H2AFX) Antibody
abx330514-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Phospho-H2AX (Tyr143) Antibody
AF8482	Affbiotech	200ul	EUR 376.00
Description: H2AX (Phospho-Tyr143) Antibody detects endogenous levels of H2AX only when phosphorylated at Tyr143.

H2AX (Phospho- Tyr143) Antibody
ABF8482	Lifescience Market	100 ug	EUR 438.00

Histone H2AX Mouse mAb
A19415-100ul	Abclonal	100 ul	Ask for price

Histone H2AX Mouse mAb
A19415-200ul	Abclonal	200 ul	Ask for price

Histone H2AX Mouse mAb
A19415-20ul	Abclonal	20 ul	Ask for price

Histone H2AX Mouse mAb
A19415-50ul	Abclonal	50 ul	EUR 308.00

Histone H2AX Rabbit pAb
A2082-100ul	Abclonal	100 ul	EUR 308.00

Histone H2AX Rabbit pAb
A2082-200ul	Abclonal	200 ul	EUR 459.00

Histone H2AX Rabbit pAb
A2082-20ul	Abclonal	20 ul	EUR 183.00

Histone H2AX Rabbit pAb
A2082-50ul	Abclonal	50 ul	EUR 223.00

Anti-Histone H2AX antibody
STJ11100613	St John's Laboratory	50 µl	EUR 287.00
Description: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the histone H2A family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.

Phospho-H2AX (Tyr143) Blocking Peptide
AF8482-BP	Affbiotech	1mg	EUR 195.00

H2AX ELISA Kit (Human) (OKAN04813)
OKAN04813	Aviva Systems Biology	96 Wells	EUR 792.00
Description: Description of target: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene encodes a replication-independent histone that is a member of the histone H2A family, and generates two transcripts through the use of the conserved stem-loop termination motif, and the polyA addition motif.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.059 ng/mL

Phospho-Histone H2AX-S139 Rabbit mAb
AP0687-100ul	Abclonal	100 ul	EUR 459.00

Phospho-Histone H2AX-S139 Rabbit mAb
AP0687-200ul	Abclonal	200 ul	Ask for price

Phospho-Histone H2AX-S139 Rabbit mAb
AP0687-20ul	Abclonal	20 ul	EUR 221.00

Phospho-Histone H2AX-S139 Rabbit mAb
AP0687-50ul	Abclonal	50 ul	EUR 308.00

Mouse H2afx/ Histone H2AX ELISA Kit
E0645Mo	Sunlong	1 Kit	EUR 632.00

Human H2AFX/ Histone H2AX ELISA Kit
E1083Hu	Sunlong	1 Kit	EUR 605.00

Human H2AFX(Histone H2AX) ELISA Kit
EH14622	FN Test	96T	EUR 524.10
Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Histone H2AX Phospho-Ser139 (H2AFX pS139) Antibody
20-abx242923	Abbexa	EUR 467.00 EUR 328.00	0 1
Shipped within 1-2 weeks.

Rabbit Anti Human Histone H2ax Polyclonal Antibody
CPBT-67531RH	Creative Diagnostics	0.1 mg	EUR 944.00

Phospho Histone H2AX (S139) Monoclonal Antibody [RMC097A]
A68410	EpiGentek	100 µl	EUR 628.55
Description: kits suitable for this type of research

Anti-PSer 139 Histone H2AX Antibody (Monoclonal, 9F3)
M00241	BosterBio	200ug/vial	EUR 553.00
Description: Mouse Anti-PSer 139 Histone H2AX Antibody (Monoclonal, 9F3) for H2AFX detection tested with WB in Human, Mouse, Rat.

Anti-Histone H2AX Rabbit Monoclonal Antibody, Clone#RM214
M00241-2	BosterBio	100ug	EUR 478.00
Description: Anti-Histone H2AX Rabbit Monoclonal Antibody, Clone#RM214 tested in WB, ELISA, Multiplex, ICC, reactive to All Vertebrates