STPKIT3-50T

HLA-DR/CD34

HLADRF34PE-50T 50 test
EUR 323.00

HLA-DR/CD3

HLADRF3PE1-50T 50 test
EUR 350.30

HLA-DR/CD8

HLADRF8PE1-50T 50 test
EUR 350.30

IC IgG1/IgG1/ CD45

ICIGG1FPE45PP1-50T 50 test
EUR 479.00

CD8/CD38

8F138PE-50T 50 test
EUR 350.30

CD8/CD4

8F14PE1-50T 50 test
EUR 350.30

CD8/CD56

8F156PE-50T 50 test
EUR 350.30

CD3/CD16+56

3F11656PE-50T 50 test
EUR 350.30

CD3/CD16+56/CD45/CD19

3F11656PE45PC319A3-50T 50 test
EUR 850.80

CD3/CD16+56/CD45

3F11656PE45PP1-50T 50 test
EUR 479.00

CD3/CD19

3F119PE1-50T 50 test
EUR 350.30

CD3/CD19/CD45

3F119PE145PP1-50T 50 test
EUR 479.00

CD3/CD4

3F14PE1-50T 50 test
EUR 350.30

CD3/CD4/CD45

3F14PE145PC3-50T 50 test
EUR 564.80

CD3/CD4/CD45

3F14PE45PP1-50T 50 test
EUR 479.00

CD3/CD8

3F18PE1-50T 50 test
EUR 350.30

CD3/CD8/CD45/CD4

3F18PE145PC34A2-50T 50 test
EUR 707.80

CD3/CD8/CD45

3F18PE145PP1-50T 50 test
EUR 521.90

CD3/CD8/CD45/CD4

3F18PE145PP14A3-50T 50 test
EUR 609.00

CD4/CD8

4F18PE1-50T 50 test
EUR 350.30

CD4/CD8/CD3

4F18PE13PC2-50T 50 test
EUR 550.50

CD4/CD45RA

4F45RAPE2-50T 50 test
EUR 521.90

CD4/CD8/CD3

4F8PE13PP1-50T 50 test
EUR 521.90

CD45/CD14

45F114PE-50T 50 test
EUR 350.30

CD45RA/CD45RO/CD3/CD4

45RAF245ROPE3PP14A1-50T 50 test
EUR 609.00

CD45RA/CD45RO/CD3/CD8

45RAF245ROPE3PP18A3-50T 50 test
EUR 609.00

CD45RA/CD4

45RAF24PE1-50T 50 test
EUR 364.60

CD45RA/CD62L/CD3/CD4

45RAF262LPE3PP14A1-50T 50 test
EUR 609.00

CD45RA/CD62L/CD3/CD8

45RAF262LPE3PP18A3-50T 50 test
EUR 609.00

CD103/ CD22/ CD20

103F22PE20PP2-50T 50 test
EUR 700.00

CD157/ CD45/ CD64 (HPN)

157PE45PP264A-50T 50 test
EUR 953.50

CD15/CD117

15F117PE-50T 50 test
EUR 362.00

CD15/CD34

15F34PE-50T 50 test
EUR 436.10

CD16/CD56

16F256PE-50T 50 test
EUR 350.30

KAPPA/LAMBDA

1KF3LPE2-50T 50 test
EUR 672.05

CD5/CD19

5F19PE1-50T 50 test
EUR 350.30

CD5/CD20

5F20PE2-50T 50 test
EUR 350.30

MPO/CD22

MPOF22PE-50T 50 test
EUR 436.10

KAPPA/CD19

KAPPAF219PE1-50T 50 test
EUR 350.30

KAPPA/LAMBDA

KAPPAF2LAMBDAPE-50T 50 test
EUR 414.00

KAPPA/LAMBDA/CD19

KAPPAF2LAMBDAPE19PC2-50T 50 test
EUR 784.50

KAPPA/CD19

KF319PE4-50T 50 test
EUR 466.00

LAMBDA/CD19

LAMBDAF19PE1-50T 50 test
EUR 350.30

LAMBDA/CD19

LF219PE4-50T 50 test
EUR 466.00

LAMBDA/KAPPA

LF2KPE3-50T 50 test
EUR 615.50

StepCount Kit1

STPKIT1-50T 50 test
EUR 854.70

StepCount Kit2

STPKIT2-50T 50 test
EUR 999.00

StepCount Kit4

STPKIT4-50T 50 test
EUR 713.00

TDT

TDTF-50T 100 test
EUR 1220.00

create a molecule of recombinant dna, which of the following is cut with a restriction enzyme?

Rabbit Anti-Hemagglutinin Influenza A Virus H1N1 H1 (Pan H1N1 reacts with multiple strains of H1N1) IgG, purified

H1N1-02-A 100 ul
EUR 482.00

Rabbit anti-E-coli host cell proteins (HCP's) IgG, aff pure (a mix of rabbit and Chicken Ig's)

ECO12-A 100 ul
EUR 482.00

Rabbit Anti-(DRAAGQPAG)3 peptide (repeat-sequence peptide of the P. vivax circumsporozoite protein, CSP) IgG, aff pure

DRAA31-A 100 ul
EUR 482.00

Rabbit Anti-(PPPPNAND)3 peptide (repeat-sequence peptide of the P. berghei circumsporozoite protein, CSP) IgG, aff pure

PPPP321-A 100 ul
EUR 482.00

Cancer of the liver paired with normal of the liver, 51 cases (1.1mm), set 1

LVC1531 1
EUR 250.00
Description: Liver cancer tissue array, set 1, 51 cases, 153 cores, one normal paired with two tumor tissue cores from each patient with grading and TNM staging data.

Rabbit Anti-(NVDP)4 peptide (minor repeat-sequence peptide of the P. falciparum circumsporozoite protein, CSP) IgG, aff pure

NVDP41-A 100 ul
EUR 482.00

Goat Anti-Human Apolipoprotein A-IV A(ApoA4) peptid IgG, aff pure

APOA45-A 100 ul
EUR 482.00

Restriction enzyme FokI(Internal) Antibody

48219-100ul 100ul
EUR 333.00

Restriction enzyme FokI(Internal) Antibody

48219-50ul 50ul
EUR 239.00

Rabbit Anti-(NANP)5 peptide (25-aa, repeat-sequence peptide of the P. falciparum circumsporozoite protein), CSP IgG, aff pure

NANP51-A 100 ul
EUR 482.00

Rabbit Anti-human MART-1/Melanocyte Differentiation-A/Melan-A peptide (CT) IgG

MART12-A 100 ul
EUR 445.00

Recombinant purified allergen 1 of the fungus Alternaria alternate, Isoform Alt a 1.0101

ALTA15-R-100 1 mg Ask for price

Boc-a-Me-DL-Val-OH

A-4145.0001 1.0g
EUR 139.00
Description: Sum Formula: C11H21NO4; CAS# [139938-00-4]

Boc-a-Me-DL-Val-OH

A-4145.0005 5.0g
EUR 477.00
Description: Sum Formula: C11H21NO4; CAS# [139938-00-4]

Set of Rollers (A part)

1292233 1unit
EUR 246.00
Description: 6 r ol l er s and 1 cent r al dr i ve wheel

Human 52KDA repressor of the inhibitor of the protein kinase (PRKRIR)

1-CSB-EP018719HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 33.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human 52KDA repressor of the inhibitor of the protein kinase(PRKRIR),partial expressed in E.coli

pNCS-LanRFP. Driven by T7 promoter, with a 6xHis tag at the N-terminus of LanRFP

ABP-FP-RPNCS 5 ug Ask for price
    • Product line: Plasmids
    • Brand: E.coli Expression

pNCS-mTFP1. Driven by T7 promoter, with a 6xHis tag at the N-terminus of LanRFP

ABP-FP-TPNCS 5 ug Ask for price
    • Product line: Plasmids
    • Brand: E.coli Expression

pNCS-mWasabi. Driven by T7 promoter, with a 6xHis tag at the N-terminus of LanYFP

ABP-FP-WPNCS 5 ug Ask for price
    • Product line: Plasmids
    • Brand: E.coli Expression

pNCS-LanYFP. Driven by T7 promoter, with a 6xHis tag at the N-terminus of LanYFP

ABP-FP-YPNCS 5 ug Ask for price
    • Product line: Plasmids
    • Brand: E.coli Expression

Rabbit Anti-Influenza A HA (H1N1, 1-343aa) (A/Wyoming/3/03) protein IgG, aff pure

H3N22-A 100 ul
EUR 445.00

Fmoc-a-amino-DL-Gly(Boc)-OH

A-4320.0001 1.0g
EUR 273.00
Description: Sum Formula: C22H24N2O6; CAS# [176039-39-7]

Fmoc-a-amino-DL-Gly(Boc)-OH

A-4320.0005 5.0g
EUR 998.00
Description: Sum Formula: C22H24N2O6; CAS# [176039-39-7]

Chicken Anti-Protein A IgG, aff pure

PRTA11-A 1 mg
EUR 482.00

Goat Anti-Protein-A IgG aff pure

PRTA12-A 0.1 ml
EUR 408.00

Chicken Anti-Protein-A IgG aff pure

PRTA13-A 100 ug
EUR 408.00

Optional dimpled mat for use with a variety of tubes

B3D5000-DIMP 1 PC
EUR 140.40
  • To order instruments in 115V / US plug please delete the 'E' off the order code.European 2 pin plugs will be supplied as standard, please request UK if required.

Restriction enzyme FokI(C-term) Antibody

48218-100ul 100ul
EUR 333.00

Restriction enzyme FokI(C-term) Antibody

48218-50ul 50ul
EUR 239.00

Rabbit Anti-Influenza A nucleoprotein (H1N1-NP/1-320aa) protein (A/06/California/2009) IgG, aff pure

H1NP21-A 100 ul
EUR 445.00

Rabbit Anti-Influenza A HA2 (H5N1) (A/Vietnam/1203/2004 366-531aa, >95%, his-tag) protein IgG

HA2H012-A 100 ul
EUR 445.00

Recombinant purified allergen 2 of the fungus Alternaria alternata, enolase Isoform Alt a 6.0101

ALTA25-R-100 1 mg Ask for price

Human Receptor I for the Fc region of immunoglobulin A ELISA Kit

ELA-E1583h 96 Tests
EUR 824.00

52 kDa Repressor of The Inhibitor of The Protein Kinase (PRKRIR) Antibody

abx036590-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

52 kDa Repressor of The Inhibitor of The Protein Kinase (PRKRIR) Antibody

20-abx109464
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

52 kDa Repressor of The Inhibitor of The Protein Kinase (PRKRIR) Antibody

abx028362-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

52 kDa Repressor of The Inhibitor of The Protein Kinase (PRKRIR) Antibody

abx028362-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Rabbit Anti-Influenza A HA (H3N2, 1-531aa/HA1+HA2) (A/Brisbane/10/2007) protein IgG, aff pure

H3N23-A 100 ul
EUR 445.00

Goat Anti-Human recombinant Fetuin A (Alpha-2 HS-Glycoprotein, AHSG, A2HS) IgG

FETB12-A 100 ug
EUR 482.00

Goat Anti-Hepatitis A Virus (Strain HM175) IgG

HAV11-A 100 ul
EUR 457.00

Goat Anti-human Serum Amyloid A (SAA) antiserum

SAA11-A 100 ul
EUR 482.00

Rabbit Anti-Streptococcus A IgG, aff pure, #2

STA12-A 1 mg
EUR 286.00

Rabbit Anti-Rat phosphate regulating gene with homologies to endopeptidases on the X chromosome (PHEX) IgG (aff pure)

PHEX11-A 100 ug
EUR 482.00

The metabolite of Nitrofurantoin Antibody

20-abx210172
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

The metabolite of furaltadone Antibody

20-abx210174
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

The metabolite of nitrofurazone Antibody

20-abx210176
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

The metabolite of furazolidone Antibody

20-abx210179
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Cancer of the cervix paired with normal, 12 cases (2.5mm)

CXC241 1
EUR 221.00
Description: Cervical cancer tissue array containing 12 cases in 24 cores with normal paired with tumor tissues from the same patients, with grading and TNM staging data.

Cancer of the cervix paired with normal, 16 cases (2mm)

CXC481 1
EUR 250.00
Description: Cervical cancer tissue array, 16 cases, 48 cores, one normal cervical tissue core paired with two tumor tissue cores from each patient, with grading and TNM staging data.

Cancer of the colon paired with metastasis, 48 cases (1.5mm)

COM961 1
EUR 361.00
Description: Colon metastatic cancer tissue array, 96 cores including 12 cases of colon cancers with matched adjacent normal tissues, 36 cases of colon cancers paired with lymph node metastasis.

Cancer of the endometrium paired with normal, 12 cases (2.5mm)

EMC241 1
EUR 221.00
Description: Endometrial cancer tissue array containing 12 cases in 24 cores with normal paired with tumor tissues from the same patients, with grading and TNM staging data.

Cancer of the endometrium paired with normal, 16 cases (1.5mm)

EMC481 1
EUR 250.00
Description: Endometrial cancer tissue array, 16 cases, 48 cores, one normal endometrial tissue corepaired with two tumor tissue cores from each patient, with grading and TNM staging data.

Cancer of the esophagus paired with normal, 16 cases (2mm)

ESC481 1
EUR 221.00
Description: Esophagus cancer tissue array, 16 cases, 48 cores, one normal esophagus tissue core paired with two tumor tissue cores from each patient, with grading and TNM staging data.

Cancer of the kidney paired with normal, 16 cases (2mm)

KIC481 1
EUR 221.00
Description: Kidney cancer tissue array, non-overlapping with KIC241, 16 cases, 48 cores, one normal kidney tissue core paired with two tumor tissue cores from each patient, with grading and TNM staging data.

Cancer of the lung paired with metastasis, 48 cases (1.5mm)

LUM961 1
EUR 361.00
Description: Lung cancer tissue array containing paired primary and metastatic tumors (in lymph nodes and other organs) from the same patients, 96 cores, 48 cases

Cancer of the pancreas with progressive changes, 48 cases (1.5mm)

PAC961 1
EUR 295.00
Description: Pancreatic cancer tissue array, 96 cores, 48 cases from normal, various benign and malignant tumor tissues with progressive grades and TNM stages in duplicates.

Cancer of the ovary paired with normal, 12 cases (2.5mm)

OVC241 1
EUR 221.00
Description: Ovary cancer tissue array containing 12 cases in 24 cores with normal paired with tumor tissues from the same patients, with grading and TNM staging data.

Cancer of the ovary paired with normal, 16 cases (2mm)

OVC481 1
EUR 221.00
Description: Ovary cancer tissue array, 16 cases, 48 cores, non-over lapping with OVC241, one normal ovary tissue core paired with two tumor tissue cores from each patient, with grading and TNM staging data.

Cancer of the ovary paired with metastasis, 48 cases (1.5mm)

OVM961 1
EUR 361.00
Description: Ovary cancer tissue array containing paired primary and metastatic tumors (in lymph nodes and other organs) from the same patients, 96 cores, 48 cases

Cancer of the prostate with progressive changes, 48 cases (1.5mm)

PRC961 1
EUR 295.00
Description: Prostate cancer tissue array, 48 cases from hyperplastic and cancer tissues with progressive Gleason scores and TNM stages in duplicates.

Cancer of the rectum paired with metastasis, 48 cases (1.5mm)

REM961 1
EUR 361.00
Description: Rectum cancer tissue array containing paired primary and metastatic tumors (in lymph nodes and other organs) from the same patients, 48 cases in duplicates

Cancer of the skin paired with normal, 16 cases (2mm)

SKT481 1
EUR 221.00
Description: Skin tumor tissue array, 16 cases, 48 cores, one normal paired with two tumor tissue cores from each patient

Cancer of the stomach paired with metastasis, 48 cases (1.5mm)

STM961 1
EUR 361.00
Description: Stomach cancer tissue array containing 48 cases of paired primary and metastatic tumors (in lymph nodes and other organs) from the same patients.

Cancer of the thyroid paired with normal, 12 cases (2.5mm)

THC241 1
EUR 221.00
Description: Thyroid cancer tissue array containing 12 cases in 24 cores with normal paired with tumor tissues from the same patients with grading and TNM staging data.

Rabbit Anti-Human Calcineurin A-subunit IgG aff pure

CALNA12-A 100 ug
EUR 482.00

Chicken Anti-Human+Mouse IgG+A+M IgG/Y

HGAM11-A 100 ul
EUR 482.00

Hematoxylin, Weigert's Iron (Part A)

HWI-A-250 250 ml
EUR 116.00

Brother of The Regulator of Imprinted Sites (BORIS) Antibody

20-abx141817
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Brother of The Regulator of Imprinted Sites (BORIS) Antibody

abx230931-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Brother of The Regulator of Imprinted Sites (BORIS) Antibody

abx230932-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

NSMCE4A

NSMCE4A cloning plasmid

CSB-CL882137HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 951
  • Sequence: atgtctggggacagcagcggccgcgggccagagggccggggccggggccgcgacccgcatcgggatcgcacccgctcccgctcccgctcgcggtcccctttgtcgcccaggtcccgccgcggctctgcgcgggagcgcagagaggccccagagcgcccgagcctggaggacacaga
  • Show more
Description: A cloning plasmid for the NSMCE4A gene.

Bovine NSMCE4A ELISA KIT

ELI-15033b 96 Tests
EUR 928.00

Human NSMCE4A ELISA KIT

ELI-44860h 96 Tests
EUR 824.00

Human NSMCE4A shRNA Plasmid

20-abx960212
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NSMCE4A Recombinant Protein (Human)

RP021703 100 ug Ask for price

NSMCE4A Recombinant Protein (Rat)

RP214622 100 ug Ask for price

NSMCE4A Recombinant Protein (Mouse)

RP155150 100 ug Ask for price

NSMCE4A ORF Vector (Human) (pORF)

ORF007235 1.0 ug DNA
EUR 95.00

Nsmce4a ORF Vector (Rat) (pORF)

ORF071542 1.0 ug DNA
EUR 506.00

Nsmce4a ORF Vector (Mouse) (pORF)

ORF051718 1.0 ug DNA
EUR 506.00

Polyclonal NSMCE4A Antibody - C-terminal region

APR01814G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NSMCE4A - C-terminal region. This antibody is tested and proven to work in the following applications:

NSMCE4A sgRNA CRISPR Lentivector set (Human)

K1457901 3 x 1.0 ug
EUR 339.00

Nsmce4a sgRNA CRISPR Lentivector set (Rat)

K6152601 3 x 1.0 ug
EUR 339.00

Nsmce4a sgRNA CRISPR Lentivector set (Mouse)

K3063601 3 x 1.0 ug
EUR 339.00

NSMCE4A sgRNA CRISPR Lentivector (Human) (Target 1)

K1457902 1.0 ug DNA
EUR 154.00

NSMCE4A sgRNA CRISPR Lentivector (Human) (Target 2)

K1457903 1.0 ug DNA
EUR 154.00

NSMCE4A sgRNA CRISPR Lentivector (Human) (Target 3)

K1457904 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Rat) (Target 1)

K6152602 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Rat) (Target 2)

K6152603 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Rat) (Target 3)

K6152604 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3063602 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3063603 1.0 ug DNA
EUR 154.00

Nsmce4a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3063604 1.0 ug DNA
EUR 154.00

NSMCE4A Protein Vector (Human) (pPB-C-His)

PV028937 500 ng
EUR 329.00

NSMCE4A Protein Vector (Human) (pPB-N-His)

PV028938 500 ng
EUR 329.00

NSMCE4A Protein Vector (Human) (pPM-C-HA)

PV028939 500 ng
EUR 329.00

NSMCE4A Protein Vector (Human) (pPM-C-His)

PV028940 500 ng
EUR 329.00

NSMCE4A Protein Vector (Mouse) (pPB-C-His)

PV206870 500 ng
EUR 603.00

NSMCE4A Protein Vector (Mouse) (pPB-N-His)

PV206871 500 ng
EUR 603.00

NSMCE4A Protein Vector (Mouse) (pPM-C-HA)

PV206872 500 ng
EUR 603.00

NSMCE4A Protein Vector (Mouse) (pPM-C-His)

PV206873 500 ng
EUR 603.00

NSMCE4A Protein Vector (Rat) (pPB-C-His)

PV286166 500 ng
EUR 603.00

NSMCE4A Protein Vector (Rat) (pPB-N-His)

PV286167 500 ng
EUR 603.00

NSMCE4A Protein Vector (Rat) (pPM-C-HA)

PV286168 500 ng
EUR 603.00

NSMCE4A Protein Vector (Rat) (pPM-C-His)

PV286169 500 ng
EUR 603.00

Nsmce4a 3'UTR GFP Stable Cell Line

TU164352 1.0 ml Ask for price

NSMCE4A 3'UTR Luciferase Stable Cell Line

TU016000 1.0 ml
EUR 1394.00

Nsmce4a 3'UTR Luciferase Stable Cell Line

TU114352 1.0 ml Ask for price

NSMCE4A 3'UTR GFP Stable Cell Line

TU066000 1.0 ml
EUR 1394.00

Nsmce4a 3'UTR GFP Stable Cell Line

TU264220 1.0 ml Ask for price

Nsmce4a 3'UTR Luciferase Stable Cell Line

TU214220 1.0 ml Ask for price

NSMCE4A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1457905 3 x 1.0 ug
EUR 376.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6152605 3 x 1.0 ug
EUR 376.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3063605 3 x 1.0 ug
EUR 376.00

Non-Structural Maintenance of Chromosomes Element 4 Homolog A (NSMCE4A) Antibody

abx122125-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

NSMCE4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1457906 1.0 ug DNA
EUR 167.00

NSMCE4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1457907 1.0 ug DNA
EUR 167.00

NSMCE4A sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1457908 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6152606 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6152607 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6152608 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3063606 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3063607 1.0 ug DNA
EUR 167.00

Nsmce4a sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3063608 1.0 ug DNA
EUR 167.00

ADAMTS10

ADAMTS10 siRNA

20-abx906747
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ADAMTS10 Antibody

ABD9169 100 ug
EUR 438.00

ADAMTS10 Antibody

37310-100ul 100ul
EUR 252.00

ADAMTS10 Antibody

DF9169 200ul
EUR 304.00
Description: ADAMTS10 Antibody detects endogenous levels of total ADAMTS10.

ADAMTS10 Antibody

1-CSB-PA798156
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTS10. Recognizes ADAMTS10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

ADAMTS10 Conjugated Antibody

C37310 100ul
EUR 397.00

ADAMTS10 Blocking Peptide

20-abx161254
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ADAMTS10 Blocking Peptide

DF9169-BP 1mg
EUR 195.00

Mouse ADAMTS10 shRNA Plasmid

20-abx981351
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human ADAMTS10 shRNA Plasmid

20-abx963052
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Adamts10 ELISA KIT

ELI-48887m 96 Tests
EUR 865.00

Human ADAMTS10 ELISA KIT

ELI-49609h 96 Tests
EUR 824.00

Polyclonal ADAMTS10 Antibody (N-term)

APR03418G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADAMTS10 (N-term). This antibody is tested and proven to work in the following applications:

Adamts10 ORF Vector (Mouse) (pORF)

ORF038097 1.0 ug DNA
EUR 506.00

ADAMTS10 ORF Vector (Human) (pORF)

ORF015292 1.0 ug DNA Ask for price

ADAMTS10 sgRNA CRISPR Lentivector set (Human)

K0044501 3 x 1.0 ug
EUR 339.00

Adamts10 sgRNA CRISPR Lentivector set (Mouse)

K4523801 3 x 1.0 ug
EUR 339.00

ADAMTS10 sgRNA CRISPR Lentivector (Human) (Target 1)

K0044502 1.0 ug DNA
EUR 154.00

ADAMTS10 sgRNA CRISPR Lentivector (Human) (Target 2)

K0044503 1.0 ug DNA
EUR 154.00

ADAMTS10 sgRNA CRISPR Lentivector (Human) (Target 3)

K0044504 1.0 ug DNA
EUR 154.00

Adamts10 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4523802 1.0 ug DNA
EUR 154.00

Adamts10 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4523803 1.0 ug DNA
EUR 154.00

Adamts10 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4523804 1.0 ug DNA
EUR 154.00

ADAMTS10 Protein Vector (Human) (pPB-C-His)

PV061165 500 ng Ask for price

ADAMTS10 Protein Vector (Human) (pPB-N-His)

PV061166 500 ng Ask for price

ADAMTS10 Protein Vector (Human) (pPM-C-HA)

PV061167 500 ng Ask for price

ADAMTS10 Protein Vector (Human) (pPM-C-His)

PV061168 500 ng Ask for price

ADAMTS10 Protein Vector (Human) (pPB-His-MBP)

PV319838 500 ng Ask for price

ADAMTS10 Protein Vector (Human) (pPB-His-GST)

PV319839 500 ng Ask for price

ADAMTS10 Protein Vector (Mouse) (pPB-C-His)

PV152386 500 ng
EUR 1065.00

ADAMTS10 Protein Vector (Mouse) (pPB-N-His)

PV152387 500 ng
EUR 1065.00

ADAMTS10 Protein Vector (Mouse) (pPM-C-HA)

PV152388 500 ng
EUR 1065.00

ADAMTS10 Protein Vector (Mouse) (pPM-C-His)

PV152389 500 ng
EUR 1065.00

Adamts10 3'UTR GFP Stable Cell Line

TU151386 1.0 ml Ask for price

ADAMTS10 3'UTR Luciferase Stable Cell Line

TU000325 1.0 ml
EUR 2333.00

Adamts10 3'UTR Luciferase Stable Cell Line

TU101386 1.0 ml Ask for price

ADAMTS10 3'UTR GFP Stable Cell Line

TU050325 1.0 ml
EUR 2333.00

A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Antibody

20-abx128117
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Antibody

20-abx121254
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Antibody

20-abx104711
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Antibody

abx025590-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Antibody

abx025590-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Antibody

20-abx212721
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Recombinant A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10)

4-RPK210Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q9H324
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 43.7KDa
  • Isoelectric Point: Inquire
Description: Recombinant Human A Disintegrin And Metalloproteinase With Thrombospondin 10 expressed in: E.coli

ADAMTS10 Protein Vector (Human) (pPM-N-D-C-HA)

PV319840 500 ng Ask for price

ADAMTS10 Protein Vector (Human) (pPM-N-D-C-His)

PV319841 500 ng Ask for price

Rat A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Protein

20-abx652354
  • EUR 732.00
  • EUR 286.00
  • EUR 2305.00
  • EUR 885.00
  • EUR 523.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

ADAMTS10 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0044505 3 x 1.0 ug
EUR 376.00

Human A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Protein

20-abx166879
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

A Disintegrin And Metalloproteinase With Thrombospondin 10 (ADAMTS10) Antibody (Biotin)

20-abx274474
  • EUR 453.00
  • EUR 244.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

crp price

PRICE DROP

110-012L 5x 4 x 1000 µl
EUR 518.00

PRICE DROP

110-012XL 10x 4 x 1000 µl
EUR 939.00

Bovine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-b-48T 48T
EUR 547.00
  • Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-b-96T 96T
EUR 715.00
  • Should the Bovine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ch-48T 48T
EUR 508.00
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Chicken C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ch-96T 96T
EUR 661.00
  • Should the Chicken C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Chicken C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-48T 48T
EUR 385.00
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Human C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Hu-96T 96T
EUR 492.00
  • Should the Human C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, urine, cerebrospinal fluid, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Mu-48T 48T
EUR 489.00
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Mu-96T 96T
EUR 635.00
  • Should the Mouse C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-p-48T 48T
EUR 547.00
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Porcine C Reactive Protein (CRP) ELISA Kit

DLR-CRP-p-96T 96T
EUR 715.00
  • Should the Porcine C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Porcine C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ra-48T 48T
EUR 426.00
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Ra-96T 96T
EUR 549.00
  • Should the Rat C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat C Reactive Protein (CRP) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Rb-48T 48T
EUR 508.00
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Rabbit C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Rb-96T 96T
EUR 661.00
  • Should the Rabbit C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rabbit C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Bovine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-b-48Tests 48 Tests
EUR 580.00

Bovine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-b-96Tests 96 Tests
EUR 807.00

Chicken C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ch-48Tests 48 Tests
EUR 534.00

Chicken C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ch-96Tests 96 Tests
EUR 742.00

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-48Tests 48 Tests
EUR 388.00

Human C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Hu-96Tests 96 Tests
EUR 533.00

Mouse C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Mu-48Tests 48 Tests
EUR 511.00

Mouse C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Mu-96Tests 96 Tests
EUR 709.00

Porcine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-p-48Tests 48 Tests
EUR 580.00

Porcine C Reactive Protein (CRP) ELISA Kit

RDR-CRP-p-96Tests 96 Tests
EUR 807.00

Rat C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ra-48Tests 48 Tests
EUR 437.00

Rat C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Ra-96Tests 96 Tests
EUR 603.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Rb-48Tests 48 Tests
EUR 534.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Rb-96Tests 96 Tests
EUR 742.00

Bovine C Reactive Protein (CRP) ELISA Kit

RD-CRP-b-48Tests 48 Tests
EUR 555.00

Bovine C Reactive Protein (CRP) ELISA Kit

RD-CRP-b-96Tests 96 Tests
EUR 771.00

Chicken C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ch-48Tests 48 Tests
EUR 511.00

Chicken C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ch-96Tests 96 Tests
EUR 709.00

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-48Tests 48 Tests
EUR 372.00

Human C Reactive Protein (CRP) ELISA Kit

RD-CRP-Hu-96Tests 96 Tests
EUR 510.00

Mouse C Reactive Protein (CRP) ELISA Kit

RD-CRP-Mu-48Tests 48 Tests
EUR 489.00

Mouse C Reactive Protein (CRP) ELISA Kit

RD-CRP-Mu-96Tests 96 Tests
EUR 677.00

Porcine C Reactive Protein (CRP) ELISA Kit

RD-CRP-p-48Tests 48 Tests
EUR 555.00

Porcine C Reactive Protein (CRP) ELISA Kit

RD-CRP-p-96Tests 96 Tests
EUR 771.00

Rat C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ra-48Tests 48 Tests
EUR 419.00

Rat C Reactive Protein (CRP) ELISA Kit

RD-CRP-Ra-96Tests 96 Tests
EUR 577.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RD-CRP-Rb-48Tests 48 Tests
EUR 511.00

Rabbit C Reactive Protein (CRP) ELISA Kit

RD-CRP-Rb-96Tests 96 Tests
EUR 709.00

Guinea pig C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Gu-48T 48T
EUR 527.00
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit

DLR-CRP-Gu-96T 96T
EUR 688.00
  • Should the Guinea pig C Reactive Protein (CRP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Guinea pig C Reactive Protein (CRP) in samples from serum, plasma or other biological fluids.

Guinea pig C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Gu-48Tests 48 Tests
EUR 557.00

Guinea pig C Reactive Protein (CRP) ELISA Kit

RDR-CRP-Gu-96Tests 96 Tests
EUR 774.00

Guinea pig C Reactive Protein (CRP) ELISA Kit

RD-CRP-Gu-48Tests 48 Tests
EUR 533.00

Guinea pig C Reactive Protein (CRP) ELISA Kit

RD-CRP-Gu-96Tests 96 Tests
EUR 740.00

TruStrip RDT Dog C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-D10 1 pack
EUR 171.00

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-H10 1 pack
EUR 171.00

TruStrip RDT Human C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-H25 1 pack
EUR 293.00

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-M10 1 pack
EUR 171.00

TruStrip RDT Monkey C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-M25 1 pack
EUR 293.00

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 10 tests/pack

CRP-RDT-R10 1 pack
EUR 171.00

TruStrip RDT Rat C-reactive Protein (CRP) Rapid Test cards, 25 tests/pack

CRP-RDT-R25 1 pack
EUR 293.00

CRP/ Rat CRP ELISA Kit

ELA-E0829r 96 Tests
EUR 886.00

Crp/ Rat Crp ELISA Kit

ELI-02799r 96 Tests
EUR 886.00

Canine CRP(CRP) ELISA Kit

QY-E70170 96T
EUR 426.00

CRP protein

30C-CP1000U 1 mg
EUR 349.00
Description: Purified native Human CRP protein

CRP protein

30R-2081 100 ug
EUR 322.00
Description: Recombinant human CRP protein

CRP protein

30R-2389 250 ug
EUR 152.00
Description: Purified recombinant Human CRP protein

CRP protein

30R-2740 10 ug
EUR 341.00
Description: Purified recombinant Human CRP protein

CRP protein

30R-2984 1 mg
EUR 380.00
Description: Purified recombinant Human CRP protein

CRP Protein

30R-3412 1 mg
EUR 300.00
Description: Human C-reactive protein

CRP protein

30R-AC001x 10 mg
EUR 457.00
Description: Highly purifed Human CRP protein

CRP protein

30R-AC067 1 mg
EUR 448.00
Description: Purified native Human CRP protein

CRP protein

30-1092 1 mg
EUR 393.00
Description: Purified recombinant Human CRP protein

CRP protein

30-1094 100 ug
EUR 155.00
Description: Purified native Human CRP protein

cyl2 results

2-Propyl-β-D-glucuronide, 2 mg

0904-2 2 mg
EUR 162.00

IL-2 Interleukin-2 Human Recombinant Protein, His Tag

PROTP60568-2 Regular: 10ug
EUR 317.00
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer

PROTP12643-2 Regular: 20ug
EUR 317.00
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

Individual Reaction Mix 2

G065-2 200 reactions
EUR 167.00

Anti-Fascin 2/FSCN2 Antibody

A07840-2 100ug/vial
EUR 294.00

Anti-EIF4A1/2/3 Antibody

A03922-2 100ug/vial
EUR 334.00

Anti-ErbB 2/ERBB2 Antibody

A00010-2 100ug/vial
EUR 334.00

Anti-Bcl-2/BCL2 Antibody

A00040-2 100ug/vial
EUR 334.00

Anti-Angiopoietin-2/ANGPT2 Antibody

A00370-2 100ug/vial
EUR 334.00

Dr. P Kit-Solution 2

K2021010-2 6 ml
EUR 120.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Recombinant Human TFF-2 Protein

PROTQ03403-2 20ug
EUR 317.00
Description: The Trefoil Factor peptides (TFF1, TFF2 and TFF3) are expressed in the gastrointestinal tract, and appear to play an important role in intestinal mucosal defense and repair. TFF2 has been shown to inhibit gastrointestinal motility and gastric acid secretion. Recent data suggests a potential role for TFF2 in acute and chronic asthma (Nikolaidis, N.M. et al. Am. Journal Respir. Cell Mol. Biol. (2003) 4: 458-464). Recombinant human TFF2 is a 12.0 kDa polypeptide of 107 amino acid residues, which includes a 40-amino acid trefoil motif containing three conserved intramolecular disulfide bonds.

Recombinant Human BD-2 Protein

PROTO15263-2 20ug
EUR 317.00
Description: Defensins (alpha and beta) are cationic peptides with a broad spectrum of antimicrobial activity that comprise an important arm of the innate immune system. The α-defensins are distinguished from the β-defensins by the pairing of their three disulfide bonds. To date, six human β-defensins have been identified; BD-1, BD-2, BD-3, BD-4, BD-5 and BD-6. β-defensins are expressed on some leukocytes and at epithelial surfaces. In addition to their direct antimicrobial activities, they can act as chemoattractants towards immature dendritic cells and memory T cells. The β-defensin proteins are expressed as the C-terminal portion of precursors and are released by proteolytic cleavage of a signal sequence and in some cases, a propeptide sequence. β-defensins contain a six-cysteine motif that forms three intra-molecular disulfide bonds. Recombinant human BD-2 is a 4.3 kDa protein containing 41 amino acid residues.

Recombinant Human Relaxin-2 Protein

PROTP04090-2 25ug
EUR 317.00
Description: Relaxin-2 is a peptide hormone structurally related to insulin, which is expressed in the placenta, decidua, prostate, and in the ovary during pregnancy. Of the three known relaxin genes, Relaxin-2 is the only relaxin known to circulate in the blood. Relaxin-2 binds specifically to the LGR7 and LGR8 receptors, previously identified as an “orphan” G protein coupled receptors. Signaling by Relaxin-2 through its target receptors enhances the growth of pubic ligaments and ripening of the cervix during birth. Recombinant Relaxin-2 is a nonglycosylated 6.0 kDa disulfide linked heterodimeric protein consisting of a 24 amino acid A-chain and a 29 amino acid B-chain.

Recombinant Murine IL-2 Protein

PROTP04351-2 20ug
EUR 317.00
Description: IL-2 is a powerful immunoregulatory lymphokine produced by T-cells in response to antigenic or mitogenic stimulation. IL-2/IL-2R signaling is required for T-cell proliferation and other fundamental functions which are essential for the immune response. IL-2 stimulates growth and differentiation of B-cells, NK cells, lymphokine activated killer cells, monocytes, macrophages and oligodendrocytes. Recombinant murine IL-2 is a 17.2 kDa protein, containing 149 amino acid residues.

Recombinant Human PAI-2 Protein

PROTP05120-2 10ug
EUR 317.00
Description: PAI-2 is an inhibitory serpin expressed mainly in keratinocytes, activated monocytes, and placental trophoblasts. It exists predominantly as a 47 kDa nonglycosylated intracellular protein which can be induced to be secreted as 60 kDa glycoprotein. The glycosylated and unglycosylated forms of PAI-2 are equally effective as inhibitors of urokinase-type plasminogen activator (uPA), the only established physiological target of this serpin. PAI-2 has a unique ability to form dormant polymers spontaneously and reversibly under physiological conditions. The physiological relevance of this property, which is neither a consequence of any mutation in the PAI-2 gene nor associated with any known disorder, is still unclear. However, it appears that the formation of intracellular dormant polymers may be important for the controlled release of the inhibitor from PAI-2 producing cells. Plasma levels of PAI-2 are usually low or undetectable, except during pregnancy and in some forms of monocytic leukemia. Secretion of PAI-2 from the placenta normally occurs during the third trimester of pregnancy and accounts for the dramatic increase in PAI-2 levels (up to 250 ng/ml), which are maintained at these levels until postpartum, and then rapidly decline. In addition to its vital role in protecting the placenta from degradation by uPA and/or uPA-activated proteases, PAI-2 has been shown to be essential for the prevention of metastatic spread of neck, lung and breast cancers. The beneficial effect of PAI-2 seen in these studies is presumed to stem from its ability to inhibit uPA-dependent cell dissemination. PAI-2 has also been reported to inhibit keratinocyte proliferation, and to participate in the innate immune response during viral infection. Recombinant human PAI-2 is a 415-residue nonglycosylated protein.

Recombinant Human MMP-2 Protein

PROTP08253-2 10ug
EUR 317.00
Description: Matrix metalloproteinases (MMPs) are a family of endoproteases that require zinc and calcium for expressing catalytic activity. These enzymes play a central role in the maintenance and remodeling of the extracellular matrix. Elevated expression of their activity, caused either by up-regulation of their expression or down-regulation of their cognate inhibitors, has been implicated in various degenerative disorders, including arthritis, cardiovascular disease, skeletal growth-plate disorders, and cancer metastasis. MMP-2 is a secreted collagenase with specificity toward Type IV, V, VII, and X collagens. Recombinant human MMP-2 is a 62.0 kDa protein containing the entire catalytic N-terminal domain and the C-terminal domain (552 amino acids).

pLenti-CARM1 shRNA-2 Plasmid

PVTBAV03691-2 2 ug
EUR 356.00

pLenti-CTLA4 shRNA-2 Plasmid

PVTBAV05689-2 2 ug
EUR 356.00

pLenti-FOXM1 shRNA-2 Plasmid

PVTBAV08732-2 2 ug
EUR 356.00

pLenti-JUN shRNA-2 Plasmid

PVTBAV11741-2 2 ug
EUR 356.00

pLenti-LHX6 shRNA-2 Plasmid

PVTBAV12881-2 2 ug
EUR 356.00

pLenti-MAGEA3 shRNA-2 Plasmid

PVTBAV13661-2 2 ug
EUR 356.00

pLenti-RUNX3 shRNA-2 Plasmid

PVTBAV20583-2 2 ug
EUR 356.00

pLenti-Slc7a11 shRNA-2 Plasmid

PVTBAV21973-2 2 ug
EUR 356.00

pLenti-STAT3 shRNA-2 Plasmid

PVTBAV22921-2 2 ug
EUR 356.00

pLenti-XRCC5 shRNA-2 Plasmid

PVTBAV26238-2 2 ug
EUR 356.00

Mouse FGF-2 Recombinant Protein

R00121-2 5ug/vial
EUR 259.00
Description: FGF basic (FGF2) is a multipotential fibroblast growth factor that stimulates and supports proliferation, migration and differentiation. Mouse FGF basic (FGF-2) Recombinant Protein is purified FGF basic (FGF-2) produced in yeast.

Chicken IL-2 Recombinant Protein

R00387-2 5ug/vial
EUR 259.00
Description: Interleukin-2 (IL-2) is a cytokine produced by T-helper cells in response to antigenic or mitogenic stimulation. It is required for T-cell proliferation and other activities crucial to the regulation of the immune response. Chicken IL-2 Recombinant Protein is purified interleukin-2 produced in yeast.

Anti-p56Dok-2 (Ab-299) Antibody

A07956-2 100ul
EUR 397.00
Description: Rabbit Polyclonal p56Dok-2 (Ab-299) Antibody. Validated in IF, IHC, WB and tested in Human.

Ethyl-β-D-glucuronide, 2 mg

0901-2 2 mg
EUR 162.00

Ethyl sulfate, sodium salt, 2 mg

0902-2 2 mg
EUR 69.00

Propyl-β-D-glucuronide, 2 mg

0903-2 2 mg
EUR 162.00

Anti-VEGF Receptor 2/KDR Antibody

A00901-2 100ug/vial
EUR 334.00

Anti-Adiponectin Receptor 2 (mouse) Antibody

A02218-2 200ug
EUR 498.00
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.

Anti-Anterior Gradient 2/AGR2 Antibody

A02922-2 100ug/vial
EUR 334.00

Anti-COX2/Cyclooxygenase 2/PTGS2 Antibody

A00084-2 100ug/vial
EUR 294.00

Anti-beta 2 Microglobulin/B2m Antibody

A00456-2 100ug/vial
EUR 294.00

Anti-HIF-2-alpha/EPAS1 Antibody

PA1129-2 100ug/vial
EUR 294.00

Anti-Bcl-2 Rabbit Monoclonal Antibody

M00040-2 100ug/vial
EUR 397.00
Description: Rabbit Monoclonal Bcl-2 Antibody. Validated in IF, WB and tested in Human, Mouse.

ErbB2 ErbB-2 Human Recombinant Protein

PROTP04626-2 Regular: 20ug
EUR 317.00
Description: ErbB-2 Human Recombinant is a 43.4 kDa protein containing 397 amino acid residues of the human Herstatin, and an extra Methionine at N-Terminal (underlined), produced in E.coli.

Mouse Pancreas PrimaCell 2: Pancreatic Epithelial Cells

2-82102 1 Kit Ask for price

Rat Pancreas PrimaCell 2: Pancreatic Epithelial Cells

2-82597 1 Kit Ask for price

Human Pancreas PrimaCell 2: Pancreatic Epithelial Cells

2-96123 1 Kit Ask for price

Ethyl-β-D-glucuronide-d5, 2 mg

0901D-2 2 mg
EUR 386.00

Ethyl sulfate-d5, sodium salt, 2 mg

0902D-2 2 mg
EUR 92.00

Ethyl-β-D-glucuronide-13C6, 2 mg

0905-2 2 mg
EUR 366.00

Anti-Beta 2 Microglobulin Antibody (monoclonal, 2H10)

M00456-2 100ug/vial
EUR 334.00

ENO2 Neurone Specific Enolase 2 Human protein

PROTP09104-2 Regular: 20ug
EUR 317.00
Description: Human Neurone Specific Enolase produced in Human CNS having a molecular mass of 45kDa.

IL-2

E13-013-2 50μg
EUR 505.00

FGF-2

E13-024-2 50μg
EUR 245.00

Custom Anti-Peptide antibodies 2 peptides (upto 20-aa, synthesis, 2 conjugation, 2 rabbits, 2 ELISA & 2 Aff. Purif.)

ABPEP-20A-2 1
EUR 3806.00

Ethyl-β-D-glucuronide-13C6-d5, 2 mg

0906-2 2 mg
EUR 493.00

Anti-Rsk 2/MAPKAP Kinase 1b/RPS6KA3 Antibody

A02215-2 100ug/vial
EUR 334.00

Biotin-16-7-Deaza-7-Propargylamino-2'-dGTP

B8158-.2 200 µl (5 mM)
EUR 2436.00

Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348

M00084-2 100uL
EUR 397.00
Description: Anti-COX-2 Rabbit Monoclonal Antibody, Clone#RM348 tested in WB, IHC, reactive to Human

Recombinant Human TGF-Beta 2 (insect derived) Protein

PROTP61812-2 10ug
EUR 317.00
Description: The three mammalian isoforms of TGF-β, TGF-β1, β2, β3, signal through the same receptor and elicit similar biological responses. They are multifunctional cytokines that regulate cell proliferation, growth, differentiation and motility as well as synthesis and deposition of the extracellular matrix. They are involved in various physiological processes including embryogenesis, tissue remodeling and wound healing. They are secreted predominantly as latent complexes which are stored at the cell surface and in the extracellular matrix. The release of biologically active TGF-β isoform from a latent complex involves proteolytic processing of the complex and /or induction of conformational changes by proteins such as thrombospondin-1. TGF-β2 has been shown to exert suppressive effects on IL-2 dependent T-cell growth, and may also have an autocrine function in enhancing tumor growth by suppressing immuno-surveillance of tumor development. Recombinant human TGF-β2 is a 25.0 kDa protein composed of two identical 112 amino acid polypeptide chains linked by a single disulfide bond.
* Manufactured using (BTI-Tn-5B1-4) cells under license from the Boyce Thompson Institute for Plant Research, Inc.

Custom Anti-Peptide antibodies, 2 peptides (upto 20-aa; synthesis, 2 conjugation, 2 rabbits, 2 ELISA)

ABPEP-20-2 1
EUR 2356.00

AHSG Alpha-2-HS-Glycoprotein Human Recombinant Protein HEK

PROTP02765-2 Regular: 10ug
EUR 317.00
Description: AHSG Human Recombinant produced by transfected human cells is a single polypeptide chain containing 357 amino acids (19-367). AHSG is fused to an 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

FGF-2 Fibroblast Growth Factor-Basic Human Recombinant Protein

PROTP09038-2 Regular: 50ug
EUR 317.00
Description: Fibroblast Growth Factor-2 Human Recombinant (FGF-2) produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 154 amino acids and having a molecular mass of 17.2kDa.;The FGF-b is purified by proprietary chromatographic techniques.

TIMP2 Tissue Inhibitor of Metalloprotease 2 Human Recombinant Protein

PROTP16035-2 Regular: 20ug
EUR 317.00
Description: TIMP2 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 194 amino acids and having a molecular mass of 21.8kDa. 

ExoStd? Lyophilized Exosome Standard (30 µg, Human Plasma, 2 vials)

M1040-2
EUR 593.00

ExoStd? Lyophilized Exosome Standard (100 µg, Human Plasma, 2 vials)

M1041-2
EUR 711.00

ExoStd? Lyophilized Exosome Standard (30 µg, Human Serum, 2 vials)

M1042-2
EUR 599.00

ExoStd? Lyophilized Exosome Standard (100 µg, Human Serum, 2 vials)

M1043-2
EUR 713.00

ExoStd? Lyophilized Exosome Standard (30 µg, Human Urine, 2 vials)

M1044-2
EUR 599.00

ExoStd? Lyophilized Exosome Standard (100 µg, Human Urine, 2 vials)

M1045-2
EUR 707.00

ExoStd? Lyophilized Exosome Standard (30 µg, Human Saliva, 2 vials)

M1046-2
EUR 604.00

ExoStd? Lyophilized Exosome Standard (100 µg, Human Saliva, 2 vials)

M1047-2
EUR 729.00

ExoStd? Lyophilized Exosome Standard (30 µg, U87 MG, 2 vials)

M1054-2
EUR 604.00

ExoStd? Lyophilized Exosome Standard (100 µg, U87 MG, 2 vials)

M1055-2
EUR 718.00

cyclic heart container

COLLECTION CONTAINER 10L, METALLOCENE FILM

91-002-MX 1/pk
EUR 84.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 30L, METALLOCENE FILM

91-100-30 1/pk
EUR 167.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 100L, METALLOCENE FILM

91-100-35 1/pk
EUR 189.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 1L, EVA FILM

91-200-01 1/pk
EUR 80.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 2L, EVA FILM

91-200-02 1/pk
EUR 88.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 5L, EVA FILM

91-200-05 1/pk
EUR 99.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 10L, EVA FILM

91-200-10 1/pk
EUR 101.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 20L, EVA FILM

91-200-20 1/pk
EUR 110.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 10L, EVA FILM

91-200-36 1/pk
EUR 86.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 20L, EVA FILM

91-200-39 1/pk
EUR 89.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 1L, EVA FILM

91-200-42 1/pk
EUR 73.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 5L, EVA FILM

91-200-43 1/pk
EUR 151.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 10L, EVA FILM

91-200-45 1/pk
EUR 126.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 20L, EVA FILM

91-200-47 1/pk
EUR 132.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 50L, EVA FILM

91-200-48 1/pk
EUR 146.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 100L, EVA FILM

91-200-82 1/pk
EUR 279.00
Description: Flexible Containers; Bioprocess Bags and Parts

COLLECTION CONTAINER 200L, EVA FILM

91-200-83 1/pk
EUR 292.00
Description: Flexible Containers; Bioprocess Bags and Parts

Mouse Heart PrimaCell3: Normal Heart Fibroblasts

2-82047 1 Kit Ask for price

Rat Heart PrimaCell3: Normal Heart Fibroblasts

2-82548 1 Kit Ask for price

Human Heart PrimaCell3: Normal Heart Fibroblasts

2-96068 1 Kit Ask for price

cDNA from Congenital heart disease: Heart

C1236122Hd-3 40 reactions
EUR 668.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

cDNA from Congestive Heart Failure: Heart

C1236122Hd-6 40 reactions
EUR 811.00
Description: Can be used for various studies in the realm of gene expression, both normal and pathological. It is an excellent control and suitable for educational purposes.

COLLECTION CONTAINER 500 ML, EVA FILM

91-200-41 1/pk
EUR 69.00
Description: Flexible Containers; Bioprocess Bags and Parts

Total Protein from Congenital heart disease: Heart

P1236122Hd-3 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total Protein from Congestive Heart Failure: Heart

P1236122Hd-6 1 mg
EUR 461.00
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Total RNA from Congenital heart disease: Heart

R1236122Hd-3 50 ug
EUR 351.00
Description: Can be used for various studies in the realm of gene expression and regulation, both normal and pathological. It is an excellent control and suitable for educational purposes.

Frozen Tissue Section - Congenital heart disease: Heart

T1236122Hd-3 5 slides
EUR 465.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Frozen Tissue Section - Congestive Heart Failure: Heart

T1236122Hd-6 5 slides
EUR 743.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

Paraffin Tissue Section - Congenital heart disease: Heart

T2236122Hd-3 5 slides
EUR 257.00
Description: Our tissue products are produced by strictly following the IRB ethical standards and procedures and from highest quality tissues. Immediately after collection the tissues are placed in liquid nitrogen and examined by certified pathologists. The thickness of each individual section is ~5um. They are Hematoxylin and Eosin stained and quality tested by immunostaining with anti-beta-actin antibodies. Our tissue products are suitable for various studies on cellular level (RNA localization, Protein expression, etc.) on both normal and pathological cases. It is also an excellent control and educational tool.

CONTAINER LID,PE,S,BK,20/500

430181 20/pk
EUR 194.00
Description: Bags; Containers

CoreDish Prostate Biopsy Container with 10% Formalin

M970-D12P-PREFILLED 1 Case(s)
EUR 164.00

CoreDish Prostate Biopsy Container with 10% Formalin

M971-D12P 1 Case(s)
EUR 164.00

Rat Heart PrimaCell3: Normal Heart Fibroblasts Growth Medium

9-25048 5 x 100 ml Ask for price

Mouse Heart PrimaCell3: Normal Heart Fibroblasts Growth Medium

9-32047 5 x 100 ml Ask for price

Human Heart PrimaCell3: Normal Heart Fibroblasts Growth Medium

9-46068 5 x 100 ml Ask for price

Cyclic AMP

HY-B1511 500mg
EUR 119.00

Cyclic somatostatin

HY-P0084 50mg
EUR 257.00

Cadherin, Heart Antibody

20-abx101261
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Brain Heart Infusion

abx082020-100g 100 g
EUR 230.00
  • Shipped within 5-10 working days.

CYSTINE HEART AGAR

C03-122-10kg 10 kg
EUR 1317.00

CYSTINE HEART AGAR

C03-122-2kg 2kg
EUR 325.00

CYSTINE HEART AGAR

C03-122-500g 500 g
EUR 125.00

HEART INFUSION AGAR

H08-100-10kg 10 kg
EUR 1166.00

HEART INFUSION AGAR

H08-100-2kg 2kg
EUR 293.00

HEART INFUSION AGAR

H08-100-500g 500 g
EUR 116.00

HEART INFUSION BROTH

H08-101-10kg 10 kg
EUR 1126.00

HEART INFUSION BROTH

H08-101-2Kg 2 Kg
EUR 284.00

HEART INFUSION BROTH

H08-101-500g 500 g
EUR 114.00

Rat Whole Heart

PC35133 P0 Rat - Whole Heart X2
EUR 1341.00

Mouse Whole Heart

PC35135 P0 Mouse - Whole heart X2
EUR 1341.00

Human Heart Tissue Preparation Buffer 3: Normal Heart Fibroblasts

9-80068 1 x 100 ml Ask for price

Mouse Heart Tissue Preparation Buffer 3: Normal Heart Fibroblasts

9-80161 1 x 100 ml Ask for price

Rat Heart Tissue Preparation Buffer 3: Normal Heart Fibroblasts

9-80255 1 x 100 ml Ask for price

FABP protein (heart specific)

30R-3136 50 ug
EUR 257.00
Description: Purified recombinant FABP protein

Human Heart Tissue Lysate

30R-AH049 150 ug
EUR 534.00
Description: Fresh tissue lysate isolated from human heart

BRAIN HEART INFUSION AGAR

B02-112-10kg 10 kg
EUR 1247.00

BRAIN HEART INFUSION AGAR

B02-112-2kg 2kg
EUR 310.00