Probleme aus den Western-Blot-Tests

Der folgende Leitfaden dient als Checkliste für die möglichen Ursachen und Lösungen in Bezug auf einige der am häufigsten auftretenden Probleme aus den Western-Blot-Tests. Hoher Hintergrund S.No. Mögliche Ursache Lösung 1 Zu hohe Antikörperkonzentration Optimieren und verringern Sie die Antikörperkonzentration 2 Aggregierte sekundäre Antikörperbildung Filtriere den sekundären Antikörper durch ein 0,2 um Filter Verwenden Sie … Read more


Product not found



EUR 131.00


EUR 370.00


A2005-1 1 mg
EUR 132.00
Description: Nutlin-3b is an inactive enantiomer of nutlin-3 [1].Nutlin-3 is a small-molecule inhibitor of MDM2, interfering with MDM2-directedTP53 degradation. The stabilization of WT-TP53 leads to cell cycle arrest, growth inhibition, and apoptosis.


A2005-10 10 mg
EUR 419.00
Description: Nutlin-3b is an inactive enantiomer of nutlin-3 [1].Nutlin-3 is a small-molecule inhibitor of MDM2, interfering with MDM2-directedTP53 degradation. The stabilization of WT-TP53 leads to cell cycle arrest, growth inhibition, and apoptosis.


A2005-25 25 mg
EUR 870.00
Description: Nutlin-3b is an inactive enantiomer of nutlin-3 [1].Nutlin-3 is a small-molecule inhibitor of MDM2, interfering with MDM2-directedTP53 degradation. The stabilization of WT-TP53 leads to cell cycle arrest, growth inhibition, and apoptosis.


A2005-5 5 mg
EUR 255.00
Description: Nutlin-3b is an inactive enantiomer of nutlin-3 [1].Nutlin-3 is a small-molecule inhibitor of MDM2, interfering with MDM2-directedTP53 degradation. The stabilization of WT-TP53 leads to cell cycle arrest, growth inhibition, and apoptosis.

Nutlin (3b)

HY-15335 10mg
EUR 326.00

pET- 3b

PVT0043 2 ug
EUR 266.00

Semaphorin 3B

RA25088 50 ul
EUR 474.00

Histone H3 (H3) Antibody

abx025760-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx025760-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx025761-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx025761-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx019106-100ug 100 ug
EUR 342.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx020052-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx215913-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Histone H3 (H3) Antibody

  • EUR 328.00
  • EUR 829.00
  • EUR 439.00
  • EUR 154.00
  • EUR 258.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Histone H3 (H3) Antibody

  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Histone H3 (H3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Histone H3 (H3) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Histone H3 (H3) Antibody

  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 384.00
  • EUR 606.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx010886-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx010887-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

abx010890-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Histone H3 (H3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Recombinant Histone H3 (H3)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human, Mouse, Rat, Guinea pig, Rabbit, Simian, Bovine, Horse, Chicken Histone H3 expressed in: E.coli

Recombinant Histone H3 (H3)

  • EUR 404.64
  • EUR 211.00
  • EUR 1242.40
  • EUR 480.80
  • EUR 861.60
  • EUR 334.00
  • EUR 2956.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.67kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Histone H3 expressed in: E.coli

Recombinant Histone H3 (H3)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P84229
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Chicken Histone Cluster 2, H3a expressed in: E.coli

Rat Histone H3 (H3) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1678.00
  • EUR 676.00
  • EUR 425.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Histone H3 (H3) ELISA Kit

  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Histone H3 (H3) ELISA Kit

  • EUR 6971.00
  • EUR 3714.00
  • EUR 864.00
  • 0
  • 1
  • 2
  • Shipped within 5-12 working days.

Histone-H3 (Histone-H3) Antibody

abx233890-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Histone H3 (H3) Antibody Pair

  • EUR 1581.00
  • EUR 1010.00
  • 0
  • 1
  • Shipped within 5-15 working days.

Histone H3 (H3) Antibody Pair

  • EUR 1581.00
  • EUR 1010.00
  • 0
  • 1
  • Shipped within 5-15 working days.

Histone H3 (H3) Antibody Pair

  • EUR 1581.00
  • EUR 1010.00
  • 0
  • 1
  • Shipped within 5-15 working days.

Histone H3 (H3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2
  • Please enquire.

GSK-3b Antibody

EUR 327.00

GSK-3b Antibody

EUR 146.00

BMP-3B, Human

HY-P7332 10ug
EUR 176.00

pET- 3b Plasmid

PVT0302 2 ug
EUR 266.00

pCMV- Tag 3B

PVT10713 2 ug
EUR 301.00

anti-Semaphorin 3B

YF-PA15485 100 ug
EUR 403.00
Description: Rabbit polyclonal to Semaphorin 3B

anti-Semaphorin 3B

YF-PA25020 50 ul
EUR 334.00
Description: Mouse polyclonal to Semaphorin 3B

Histone H3 (H3) Polyclonal Antibody (Human)

  • EUR 217.00
  • EUR 2048.00
  • EUR 520.00
  • EUR 268.00
  • EUR 201.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Histone H3 (H3)

Histone H3 (H3) Monoclonal Antibody (Human)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Mouse monoclonal antibody against Human Histone H3 (H3)

Mouse Histone H3 (H3) ELISA Kit

abx576695-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.


EXOC4 antibody

70R-17168 50 ul
EUR 435.00
Description: Rabbit polyclonal EXOC4 antibody

EXOC4 antibody

70R-2859 50 ug
EUR 467.00
Description: Rabbit polyclonal EXOC4 antibody raised against the N terminal of EXOC4

EXOC4 antibody

70R-9378 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal EXOC4 antibody

EXOC4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC4. Recognizes EXOC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EXOC4 Polyclonal Antibody

27683-100ul 100ul
EUR 252.00

EXOC4 Polyclonal Antibody

27683-50ul 50ul
EUR 187.00

EXOC4 Rabbit pAb

A12374-100ul 100 ul
EUR 308.00

EXOC4 Rabbit pAb

A12374-200ul 200 ul
EUR 459.00

EXOC4 Rabbit pAb

A12374-20ul 20 ul
EUR 183.00

EXOC4 Rabbit pAb

A12374-50ul 50 ul
EUR 223.00

EXOC4 Blocking Peptide

33R-5589 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC4 antibody, catalog no. 70R-2859

EXOC4 Blocking Peptide

33R-8974 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC4 antibody, catalog no. 70R-9378

EXOC4 cloning plasmid

CSB-CL007882HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1425
  • Sequence: atggcggcagaagcagctggtgggaaatacagaagcacagtcagcaaaagcaaagacccctcggggctgctcatctctgtgatcaggactctgtctactagtgacgatgtcgaagacagggaaaatgaaaagggtcgccttgaagaagcctacgagaaatgtgaccgtgacctgg
  • Show more
Description: A cloning plasmid for the EXOC4 gene.

Anti-EXOC4 antibody

STJ114252 100 µl
EUR 277.00
Description: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

Mouse EXOC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat EXOC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EXOC4 Polyclonal Conjugated Antibody

C27683 100ul
EUR 397.00

Human EXOC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Exoc4 ORF Vector (Rat) (pORF)

ORF066698 1.0 ug DNA
EUR 506.00

EXOC4 ORF Vector (Human) (pORF)

ORF003681 1.0 ug DNA
EUR 95.00

Exoc4 ORF Vector (Mouse) (pORF)

ORF044160 1.0 ug DNA
EUR 506.00

Exocyst Complex Component 4 (EXOC4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Exocyst Complex Component 4 (EXOC4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Polyclonal EXOC4 antibody - N-terminal region

APR11882G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXOC4 - N-terminal region. This antibody is tested and proven to work in the following applications:

EXOC4 sgRNA CRISPR Lentivector set (Human)

K0702601 3 x 1.0 ug
EUR 339.00

Exoc4 sgRNA CRISPR Lentivector set (Rat)

K7050701 3 x 1.0 ug
EUR 339.00

Exoc4 sgRNA CRISPR Lentivector set (Mouse)

K3420701 3 x 1.0 ug
EUR 339.00

Monoclonal EXOC4 Antibody (monoclonal) (M06), Clone: 4F1

APR11881G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human EXOC4 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4F1. This antibody is applicable in WB, E

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0702602 1.0 ug DNA
EUR 154.00

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0702603 1.0 ug DNA
EUR 154.00

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0702604 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7050702 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7050703 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7050704 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3420702 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3420703 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3420704 1.0 ug DNA
EUR 154.00

EXOC4 Protein Vector (Mouse) (pPB-C-His)

PV176638 500 ng
EUR 1065.00

EXOC4 Protein Vector (Mouse) (pPB-N-His)

PV176639 500 ng
EUR 1065.00

EXOC4 Protein Vector (Mouse) (pPM-C-HA)

PV176640 500 ng
EUR 1065.00

EXOC4 Protein Vector (Mouse) (pPM-C-His)

PV176641 500 ng
EUR 1065.00

EXOC4 Protein Vector (Rat) (pPB-C-His)

PV266790 500 ng
EUR 1166.00

EXOC4 Protein Vector (Rat) (pPB-N-His)

PV266791 500 ng
EUR 1166.00

EXOC4 Protein Vector (Rat) (pPM-C-HA)

PV266792 500 ng
EUR 1166.00

EXOC4 Protein Vector (Rat) (pPM-C-His)

PV266793 500 ng
EUR 1166.00

EXOC4 Protein Vector (Human) (pPB-C-His)

PV014721 500 ng
EUR 329.00

EXOC4 Protein Vector (Human) (pPB-N-His)

PV014722 500 ng
EUR 329.00

EXOC4 Protein Vector (Human) (pPM-C-HA)

PV014723 500 ng
EUR 329.00

EXOC4 Protein Vector (Human) (pPM-C-His)

PV014724 500 ng
EUR 329.00

Exoc4 3'UTR GFP Stable Cell Line

TU156009 1.0 ml Ask for price

Exoc4 3'UTR Luciferase Stable Cell Line

TU106009 1.0 ml Ask for price

Exoc4 3'UTR Luciferase Stable Cell Line

TU204151 1.0 ml Ask for price

Exoc4 3'UTR GFP Stable Cell Line

TU254151 1.0 ml Ask for price

EXOC4 3'UTR GFP Stable Cell Line

TU057122 1.0 ml
EUR 1394.00

EXOC4 3'UTR Luciferase Stable Cell Line

TU007122 1.0 ml
EUR 1394.00

Human Exocyst complex component 4, EXOC4 ELISA KIT

ELI-20566h 96 Tests
EUR 824.00

Mouse Exocyst complex component 4, Exoc4 ELISA KIT

ELI-26990m 96 Tests
EUR 865.00

EXOC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665203 1.0 ug DNA
EUR 1355.00

EXOC4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665207 1.0 ug DNA
EUR 1355.00

EXOC4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665208 1.0 ug DNA
EUR 1355.00

EXOC4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0702605 3 x 1.0 ug
EUR 376.00

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7050705 3 x 1.0 ug
EUR 376.00

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3420705 3 x 1.0 ug
EUR 376.00

EXOC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0702606 1.0 ug DNA
EUR 167.00

EXOC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0702607 1.0 ug DNA
EUR 167.00

EXOC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0702608 1.0 ug DNA
EUR 167.00

EXOC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV665204 1.0 ug DNA
EUR 1355.00


FBXW5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FBXW5 Antibody

DF13011 200ul
EUR 304.00
Description: FBXW5 Antibody detects endogenous levels of FBXW5.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


YF-PA19299 50 ug
EUR 363.00
Description: Mouse polyclonal to FBXW5

FBXW5 Polyclonal Antibody

31706-100ul 100ul
EUR 252.00

FBXW5 Polyclonal Antibody

31706-50ul 50ul
EUR 187.00

FBXW5 Blocking Peptide

DF13011-BP 1mg
EUR 195.00

FBXW5 cloning plasmid

CSB-CL846577HU1-10ug 10ug
EUR 586.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1701
  • Sequence: atggacgagggcggcacgcccctgctccccgacagcctggtctaccagatcttcctgagcctgggcccggccgacgtgctggccgccgggctggtgtgccgccaatggcaggccgtgtcgcgggacgagttcctgtggagggagcagttctaccgctactaccaggtggcccgcg
  • Show more
Description: A cloning plasmid for the FBXW5 gene.

FBXW5 cloning plasmid

CSB-CL846577HU2-10ug 10ug
EUR 244.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 480
  • Sequence: atgggcctgtcgcccgacaacaggtacctgtacgtgaacagccgcgcctggcccaacggtgcggtggtggccgaccccatgcagccgccaccaatcgcggaggagattgacctgctggtgttcgacctcaagaccatgcgggaggtgaggcgggctctgcgtgcgcaccgcgccta
  • Show more
Description: A cloning plasmid for the FBXW5 gene.

FBXW5 Rabbit pAb

A9345-100ul 100 ul
EUR 308.00

FBXW5 Rabbit pAb

A9345-200ul 200 ul
EUR 459.00

FBXW5 Rabbit pAb

A9345-20ul 20 ul
EUR 183.00

FBXW5 Rabbit pAb

A9345-50ul 50 ul
EUR 223.00

anti- FBXW5 antibody

FNab03056 100µg
EUR 505.25
  • Immunogen: F-box and WD repeat domain containing 5
  • Uniprot ID: Q969U6
  • Gene ID: 54461
  • Research Area: Metabolism
Description: Antibody raised against FBXW5

Anti-FBXW5 antibody

PAab03056 100 ug
EUR 355.00

Anti-FBXW5 antibody

STJ111668 100 µl
EUR 277.00
Description: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented.

FBXW5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA


EF009597 96 Tests
EUR 689.00

Rat FBXW5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse FBXW5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

FBXW5 Polyclonal Conjugated Antibody

C31706 100ul
EUR 397.00

Human FBXW5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

FBXW5 Recombinant Protein (Human)

RP011965 100 ug Ask for price

FBXW5 Recombinant Protein (Human)

RP011968 100 ug Ask for price

FBXW5 Recombinant Protein (Rat)

RP201080 100 ug Ask for price

FBXW5 Recombinant Protein (Mouse)

RP134156 100 ug Ask for price

Fbxw5 ORF Vector (Rat) (pORF)

ORF067028 1.0 ug DNA
EUR 506.00

FBXW5 ORF Vector (Human) (pORF)

ORF003989 1.0 ug DNA
EUR 95.00

FBXW5 ORF Vector (Human) (pORF)

ORF003990 1.0 ug DNA
EUR 95.00

Fbxw5 ORF Vector (Mouse) (pORF)

ORF044720 1.0 ug DNA
EUR 506.00

Fbxw5 sgRNA CRISPR Lentivector set (Rat)

K7164801 3 x 1.0 ug
EUR 339.00

FBXW5 sgRNA CRISPR Lentivector set (Human)

K0767501 3 x 1.0 ug
EUR 339.00

Fbxw5 sgRNA CRISPR Lentivector set (Mouse)

K4573401 3 x 1.0 ug
EUR 339.00

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7164802 1.0 ug DNA
EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7164803 1.0 ug DNA
EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7164804 1.0 ug DNA
EUR 154.00

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0767502 1.0 ug DNA
EUR 154.00

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0767503 1.0 ug DNA
EUR 154.00

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0767504 1.0 ug DNA
EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4573402 1.0 ug DNA
EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4573403 1.0 ug DNA
EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4573404 1.0 ug DNA
EUR 154.00

FBXW5 Protein Vector (Mouse) (pPB-C-His)

PV178878 500 ng
EUR 603.00

FBXW5 Protein Vector (Mouse) (pPB-N-His)

PV178879 500 ng
EUR 603.00

FBXW5 Protein Vector (Mouse) (pPM-C-HA)

PV178880 500 ng
EUR 603.00

FBXW5 Protein Vector (Mouse) (pPM-C-His)

PV178881 500 ng
EUR 603.00

FBXW5 Protein Vector (Rat) (pPB-C-His)

PV268110 500 ng
EUR 603.00

FBXW5 Protein Vector (Rat) (pPB-N-His)

PV268111 500 ng
EUR 603.00

FBXW5 Protein Vector (Rat) (pPM-C-HA)

PV268112 500 ng
EUR 603.00

FBXW5 Protein Vector (Rat) (pPM-C-His)

PV268113 500 ng
EUR 603.00

FBXW5 Protein Vector (Human) (pPB-C-His)

PV015953 500 ng
EUR 329.00

FBXW5 Protein Vector (Human) (pPB-N-His)

PV015954 500 ng
EUR 329.00

FBXW5 Protein Vector (Human) (pPM-C-HA)

PV015955 500 ng
EUR 329.00

FBXW5 Protein Vector (Human) (pPM-C-His)

PV015956 500 ng
EUR 329.00

FBXW5 Protein Vector (Human) (pPB-C-His)

PV015957 500 ng
EUR 329.00

FBXW5 Protein Vector (Human) (pPB-N-His)

PV015958 500 ng
EUR 329.00

FBXW5 Protein Vector (Human) (pPM-C-HA)

PV015959 500 ng
EUR 329.00

FBXW5 Protein Vector (Human) (pPM-C-His)

PV015960 500 ng
EUR 329.00

Fbxw5 3'UTR GFP Stable Cell Line

TU156465 1.0 ml Ask for price

Fbxw5 3'UTR Luciferase Stable Cell Line

TU106465 1.0 ml Ask for price

Fbxw5 3'UTR Luciferase Stable Cell Line

TU204532 1.0 ml Ask for price

Fbxw5 3'UTR GFP Stable Cell Line

TU254532 1.0 ml Ask for price

FBXW5 3'UTR GFP Stable Cell Line

TU057812 1.0 ml
EUR 1394.00

FBXW5 3'UTR Luciferase Stable Cell Line

TU007812 1.0 ml
EUR 1394.00

FBXW5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV710091 1.0 ug DNA
EUR 316.00

FBXW5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV710095 1.0 ug DNA
EUR 316.00



  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAO1 antibody

70R-5233 50 ug
EUR 467.00
Description: Rabbit polyclonal GNAO1 antibody

GNAO1 antibody

70R-5236 50 ug
EUR 467.00
Description: Rabbit polyclonal GNAO1 antibody raised against the middle region of Gnao1

GNAO1 Antibody

ABD6975 100 ug
EUR 438.00

GNAO1 Antibody

43020-100ul 100ul
EUR 252.00

GNAO1 Antibody

32682-100ul 100ul
EUR 252.00

GNAO1 antibody

70R-17522 50 ul
EUR 435.00
Description: Rabbit polyclonal GNAO1 antibody

GNAO1 Antibody

DF6975 200ul
EUR 304.00
Description: GNAO1 Antibody detects endogenous levels of total GNAO1.

GNAO1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNAO1. Recognizes GNAO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNAO1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAO1. Recognizes GNAO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Gnao1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

GNAO1 Conjugated Antibody

C43020 100ul
EUR 397.00

GNAO1 Conjugated Antibody

C32682 100ul
EUR 397.00

GNAO1 cloning plasmid

CSB-CL009593HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggt
  • Show more
Description: A cloning plasmid for the GNAO1 gene.

anti- GNAO1 antibody

FNab03534 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
  • Uniprot ID: P09471
  • Gene ID: 2775
  • Research Area: Signal Transduction
Description: Antibody raised against GNAO1

Gnao1 Polyclonal Antibody

A55105 100 µg
EUR 570.55
Description: Ask the seller for details

GNAO1 Rabbit pAb

A2510-100ul 100 ul
EUR 308.00

GNAO1 Rabbit pAb

A2510-200ul 200 ul
EUR 459.00

GNAO1 Rabbit pAb

A2510-20ul 20 ul
EUR 183.00

GNAO1 Rabbit pAb

A2510-50ul 50 ul
EUR 223.00

GNAO1 Blocking Peptide

33R-1672 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAO1 antibody, catalog no. 70R-5236

GNAO1 Blocking Peptide

33R-7429 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAO1 antibody, catalog no. 70R-5233

GNAO1 Blocking Peptide

DF6975-BP 1mg
EUR 195.00

Anti-GNAO1 antibody

PAab03534 100 ug
EUR 355.00

Anti-GNAO1 antibody

STJ23814 100 µl
EUR 277.00
Description: The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have been found for this gene.

Rat GNAO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


EF009909 96 Tests
EUR 689.00


ELI-43679h 96 Tests
EUR 824.00

Mouse Gnao1 ELISA KIT

ELI-31793m 96 Tests
EUR 865.00


ELI-48019b 96 Tests
EUR 928.00

Mouse GNAO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GNAO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Gnao1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Gnao1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Gnao1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAO1 Recombinant Protein (Human)

RP013480 100 ug Ask for price

GNAO1 Recombinant Protein (Rat)

RP202955 100 ug Ask for price

GNAO1 Recombinant Protein (Mouse)

RP138911 100 ug Ask for price

GNAO1 Recombinant Protein (Mouse)

RP138914 100 ug Ask for price

Polyclonal GNAO1 Antibody (C-term)

APR14113G 0.1ml
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAO1 (C-term). This antibody is tested and proven to work in the following applications:

Gnao1 Polyclonal Antibody, Biotin Conjugated

A57849 100 µg
EUR 570.55
Description: kits suitable for this type of research

Gnao1 Polyclonal Antibody, FITC Conjugated

A55103 100 µg
EUR 570.55
Description: Ask the seller for details

Gnao1 Polyclonal Antibody, HRP Conjugated

A55104 100 µg
EUR 570.55
Description: The best epigenetics products

GNAO1 ORF Vector (Human) (pORF)

ORF004494 1.0 ug DNA
EUR 95.00

Gnao1 ORF Vector (Rat) (pORF)

ORF067653 1.0 ug DNA
EUR 506.00

Gnao1 ORF Vector (Mouse) (pORF)

ORF046305 1.0 ug DNA
EUR 506.00

Gnao1 ORF Vector (Mouse) (pORF)

ORF046306 1.0 ug DNA
EUR 506.00

GNAO1 sgRNA CRISPR Lentivector set (Human)

K0875001 3 x 1.0 ug
EUR 339.00

Gnao1 sgRNA CRISPR Lentivector set (Mouse)

K4721701 3 x 1.0 ug
EUR 339.00

Gnao1 sgRNA CRISPR Lentivector set (Rat)

K6872701 3 x 1.0 ug
EUR 339.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0875002 1.0 ug DNA
EUR 154.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0875003 1.0 ug DNA
EUR 154.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0875004 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4721702 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4721703 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4721704 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6872702 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6872703 1.0 ug DNA
EUR 154.00



  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG11 Antibody

ABD2206 100 ug
EUR 438.00

GNG11 Antibody

44667-100ul 100ul
EUR 252.00

GNG11 Antibody

44667-50ul 50ul
EUR 187.00

GNG11 Antibody

DF2206 200ul
EUR 304.00
Description: GNG11 antibody detects endogenous levels of total GNG11.

GNG11 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


YF-PA12066 50 ug
EUR 363.00
Description: Mouse polyclonal to GNG11


YF-PA23797 50 ul
EUR 334.00
Description: Mouse polyclonal to GNG11

GNG11 Conjugated Antibody

C44667 100ul
EUR 397.00

GNG11 cloning plasmid

CSB-CL009611HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 222
  • Sequence: atgcctgcccttcacatcgaagatttgccagagaaggaaaaactgaaaatggaagttgagcagcttcgcaaagaagtgaagttgcagagacaacaagtgtctaaatgttctgaagaaataaagaactatattgaagaacgttctggagaggatcctctagtaaagggaattccaga
  • Show more
Description: A cloning plasmid for the GNG11 gene.

GNG11 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNG11 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNG11 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNG11 Polyclonal Antibody

A62670 100 µg
EUR 570.55
Description: fast delivery possible

Human GNG11 Antibody

32692-05111 150 ug
EUR 261.00

GNG11 Blocking Peptide

DF2206-BP 1mg
EUR 195.00


PVT13249 2 ug
EUR 391.00

Anti-GNG11 (2H5)

YF-MA13279 100 ug
EUR 363.00
Description: Mouse monoclonal to GNG11

Mouse GNG11 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat GNG11 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


ELI-26649b 96 Tests
EUR 928.00

Mouse Gng11 ELISA KIT

ELI-26650m 96 Tests
EUR 865.00


ELI-37685h 96 Tests
EUR 824.00

GNG11 protein (His tag)

80R-3666 100 ug
EUR 327.00
Description: Purified recombinant GNG11 protein (His tag)

Human GNG11 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GNG11 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG11 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG11 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG11 Recombinant Protein (Human)

RP013537 100 ug Ask for price

GNG11 Recombinant Protein (Rat)

RP203012 100 ug Ask for price

GNG11 Recombinant Protein (Mouse)

RP138998 100 ug Ask for price

GNG11 Polyclonal Antibody, HRP Conjugated

A62671 100 µg
EUR 570.55
Description: reagents widely cited

GNG11 Polyclonal Antibody, FITC Conjugated

A62672 100 µg
EUR 570.55
Description: Ask the seller for details

GNG11 Polyclonal Antibody, Biotin Conjugated

A62673 100 µg
EUR 570.55
Description: The best epigenetics products

Human GNG11 Antibody (Biotin Conjugate)

32692-05121 150 ug
EUR 369.00

GNG11 ORF Vector (Human) (pORF)

ORF004513 1.0 ug DNA
EUR 95.00

Gng11 ORF Vector (Rat) (pORF)

ORF067672 1.0 ug DNA
EUR 506.00

Gng11 ORF Vector (Mouse) (pORF)

ORF046334 1.0 ug DNA
EUR 506.00

GNG11 sgRNA CRISPR Lentivector set (Human)

K0877801 3 x 1.0 ug
EUR 339.00

Human GNG11 AssayLite Antibody (FITC Conjugate)

32692-05141 150 ug
EUR 428.00

Human GNG11 AssayLite Antibody (RPE Conjugate)

32692-05151 150 ug
EUR 428.00

Human GNG11 AssayLite Antibody (APC Conjugate)

32692-05161 150 ug
EUR 428.00

Human GNG11 AssayLite Antibody (PerCP Conjugate)

32692-05171 150 ug
EUR 471.00

Gng11 sgRNA CRISPR Lentivector set (Mouse)

K3659501 3 x 1.0 ug
EUR 339.00

Gng11 sgRNA CRISPR Lentivector set (Rat)

K6977801 3 x 1.0 ug
EUR 339.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 1)

K0877802 1.0 ug DNA
EUR 154.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 2)

K0877803 1.0 ug DNA
EUR 154.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 3)

K0877804 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3659502 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3659503 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3659504 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6977802 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6977803 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6977804 1.0 ug DNA
EUR 154.00

GNG11 Protein Vector (Mouse) (pPB-C-His)

PV185334 500 ng
EUR 603.00

GNG11 Protein Vector (Mouse) (pPB-N-His)

PV185335 500 ng
EUR 603.00

GNG11 Protein Vector (Mouse) (pPM-C-HA)

PV185336 500 ng
EUR 603.00

GNG11 Protein Vector (Mouse) (pPM-C-His)

PV185337 500 ng
EUR 603.00


Product not found



  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti- CLSPN antibody

FNab01775 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:1000
  • IP: 1:500-1:2000
  • IF: 1:20-1:200
  • Immunogen: claspin homolog(Xenopus laevis)
  • Uniprot ID: Q9HAW4
  • Gene ID: 63967
Description: Antibody raised against CLSPN

CLSPN Polyclonal Antibody

ES8971-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against CLSPN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CLSPN Polyclonal Antibody

ES8971-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against CLSPN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

CLSPN Polyclonal Antibody

ABP58194-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human CLSPN protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CLSPN from Human. This CLSPN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLSPN protein at amino acid sequence of 10-90

CLSPN Polyclonal Antibody

ABP58194-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human CLSPN protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CLSPN from Human. This CLSPN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLSPN protein at amino acid sequence of 10-90

CLSPN Polyclonal Antibody

ABP58194-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human CLSPN protein at amino acid sequence of 10-90
  • Applications tips:
Description: A polyclonal antibody for detection of CLSPN from Human. This CLSPN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human CLSPN protein at amino acid sequence of 10-90

Claspin (CLSPN) Antibody

abx231775-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

CLSPN Rabbit pAb

A17202-100ul 100 ul
EUR 308.00

CLSPN Rabbit pAb

A17202-200ul 200 ul
EUR 459.00

CLSPN Rabbit pAb

A17202-20ul 20 ul
EUR 183.00

CLSPN Rabbit pAb

A17202-50ul 50 ul
EUR 223.00

CLSPN Polyclonal Antibody

29995-100ul 100ul
EUR 252.00

CLSPN Polyclonal Antibody

29995-50ul 50ul
EUR 187.00

Recombinant human CLSPN

P1167 100ug Ask for price
  • Uniprot ID: Q9HAW4
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human CLSPN

Anti-CLSPN antibody

PAab01775 100 ug
EUR 355.00

Anti-CLSPN antibody

STJ119393 100 µl
EUR 277.00
Description: The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-CLSPN antibody

STJ190129 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to CLSPN

CLSPN Polyclonal Conjugated Antibody

C29995 100ul
EUR 397.00

Mouse CLSPN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


EF008736 96 Tests
EUR 689.00

Human CLSPN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Goat Claspin(CLSPN) ELISA kit

E06C1815-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Claspin(CLSPN) ELISA kit

E06C1815-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Claspin(CLSPN) ELISA kit

E06C1815-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claspin(CLSPN) ELISA kit

E02C1815-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claspin(CLSPN) ELISA kit

E02C1815-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Claspin(CLSPN) ELISA kit

E02C1815-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claspin(CLSPN) ELISA kit

E03C1815-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claspin(CLSPN) ELISA kit

E03C1815-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Claspin(CLSPN) ELISA kit

E03C1815-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claspin(CLSPN) ELISA kit

E04C1815-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claspin(CLSPN) ELISA kit

E04C1815-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Claspin(CLSPN) ELISA kit

E04C1815-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claspin(CLSPN) ELISA kit

E01C1815-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Claspin(CLSPN) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Claspin(CLSPN) ELISA kit
