STPKIT3-50T

HLA-DR/CD34

HLADRF34PE-50T 50 test
EUR 323.00

HLA-DR/CD3

HLADRF3PE1-50T 50 test
EUR 350.30

HLA-DR/CD8

HLADRF8PE1-50T 50 test
EUR 350.30

IC IgG1/IgG1/ CD45

ICIGG1FPE45PP1-50T 50 test
EUR 479.00

CD8/CD38

8F138PE-50T 50 test
EUR 350.30

CD8/CD4

8F14PE1-50T 50 test
EUR 350.30

CD8/CD56

8F156PE-50T 50 test
EUR 350.30

CD3/CD16+56

3F11656PE-50T 50 test
EUR 350.30

CD3/CD16+56/CD45/CD19

3F11656PE45PC319A3-50T 50 test
EUR 850.80

CD3/CD16+56/CD45

3F11656PE45PP1-50T 50 test
EUR 479.00

CD3/CD19

3F119PE1-50T 50 test
EUR 350.30

CD3/CD19/CD45

3F119PE145PP1-50T 50 test
EUR 479.00

CD3/CD4

3F14PE1-50T 50 test
EUR 350.30

CD3/CD4/CD45

3F14PE145PC3-50T 50 test
EUR 564.80

CD3/CD4/CD45

3F14PE45PP1-50T 50 test
EUR 479.00

CD3/CD8

3F18PE1-50T 50 test
EUR 350.30

CD3/CD8/CD45/CD4

3F18PE145PC34A2-50T 50 test
EUR 707.80

CD3/CD8/CD45

3F18PE145PP1-50T 50 test
EUR 521.90

CD3/CD8/CD45/CD4

3F18PE145PP14A3-50T 50 test
EUR 609.00

CD4/CD8

4F18PE1-50T 50 test
EUR 350.30

CD4/CD8/CD3

4F18PE13PC2-50T 50 test
EUR 550.50

CD4/CD45RA

4F45RAPE2-50T 50 test
EUR 521.90

CD4/CD8/CD3

4F8PE13PP1-50T 50 test
EUR 521.90

CD45/CD14

45F114PE-50T 50 test
EUR 350.30

CD45RA/CD45RO/CD3/CD4

45RAF245ROPE3PP14A1-50T 50 test
EUR 609.00

CD45RA/CD45RO/CD3/CD8

45RAF245ROPE3PP18A3-50T 50 test
EUR 609.00

CD45RA/CD4

45RAF24PE1-50T 50 test
EUR 364.60

CD45RA/CD62L/CD3/CD4

45RAF262LPE3PP14A1-50T 50 test
EUR 609.00

CD45RA/CD62L/CD3/CD8

45RAF262LPE3PP18A3-50T 50 test
EUR 609.00

CD103/ CD22/ CD20

103F22PE20PP2-50T 50 test
EUR 700.00

CD157/ CD45/ CD64 (HPN)

157PE45PP264A-50T 50 test
EUR 953.50

CD15/CD117

15F117PE-50T 50 test
EUR 362.00

CD15/CD34

15F34PE-50T 50 test
EUR 436.10

CD16/CD56

16F256PE-50T 50 test
EUR 350.30

KAPPA/LAMBDA

1KF3LPE2-50T 50 test
EUR 672.05

CD5/CD19

5F19PE1-50T 50 test
EUR 350.30

CD5/CD20

5F20PE2-50T 50 test
EUR 350.30

MPO/CD22

MPOF22PE-50T 50 test
EUR 436.10

KAPPA/CD19

KAPPAF219PE1-50T 50 test
EUR 350.30

KAPPA/LAMBDA

KAPPAF2LAMBDAPE-50T 50 test
EUR 414.00

KAPPA/LAMBDA/CD19

KAPPAF2LAMBDAPE19PC2-50T 50 test
EUR 784.50

KAPPA/CD19

KF319PE4-50T 50 test
EUR 466.00

LAMBDA/CD19

LAMBDAF19PE1-50T 50 test
EUR 350.30

LAMBDA/CD19

LF219PE4-50T 50 test
EUR 466.00

LAMBDA/KAPPA

LF2KPE3-50T 50 test
EUR 615.50

StepCount Kit1

STPKIT1-50T 50 test
EUR 854.70

StepCount Kit2

STPKIT2-50T 50 test
EUR 999.00

StepCount Kit4

STPKIT4-50T 50 test
EUR 713.00

TDT

TDTF-50T 100 test
EUR 1220.00

CHCHD2

CHCHD2 Antibody

1-CSB-PA005317GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHCHD2. Recognizes CHCHD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

CHCHD2 Antibody

DF12066 200ul
EUR 304.00
Description: CHCHD2 antibody detects endogenous levels of CHCHD2.

CHCHD2 siRNA

20-abx911645
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CHCHD2 siRNA

20-abx911646
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

pOTB7-CHCHD2

PVT18548 2 ug
EUR 231.00

CHCHD2 Polyclonal Antibody

29923-100ul 100ul
EUR 252.00

CHCHD2 Polyclonal Antibody

29923-50ul 50ul
EUR 187.00

CHCHD2 cloning plasmid

CSB-CL897588HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atgccgcgtggaagccgaagccgcacctcccgcatggcccctccggccagccgggcccctcagatgagagctgcacccaggccagcaccagtcgctcagccaccagcagcggcacccccatctgcagttggctcttctgctgctgcgccccggcagccaggtctgatggcccagat
  • Show more
Description: A cloning plasmid for the CHCHD2 gene.

CHCHD2 cloning plasmid

CSB-CL897588HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atgccgcgtggaagccgaagccgcacctcccgcatggcccctccggccagccgggcccctcagatgagagctgcacccaggccagcaccagtcgctcagccaccagcagcggcacccccatctgcagttggctcttctgctgctgcgccccggcagccagttctgatggcccagat
  • Show more
Description: A cloning plasmid for the CHCHD2 gene.

CHCHD2 Blocking Peptide

DF12066-BP 1mg
EUR 195.00

CHCHD2 Rabbit pAb

A3429-100ul 100 ul
EUR 308.00

CHCHD2 Rabbit pAb

A3429-200ul 200 ul
EUR 459.00

CHCHD2 Rabbit pAb

A3429-20ul 20 ul Ask for price

CHCHD2 Rabbit pAb

A3429-50ul 50 ul Ask for price

anti- CHCHD2 antibody

FNab01635 100µg
EUR 548.75
  • Immunogen: coiled-coil-helix-coiled-coil-helix domain containing 2
  • Uniprot ID: Q9Y6H1
  • Gene ID: 51142
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CHCHD2

Anti-CHCHD2 antibody

PAab01635 100 ug
EUR 386.00

Anti-CHCHD2 antibody

STJ11100883 100 µl
EUR 413.00
Description: The protein encoded by this gene belongs to a class of eukaryotic CX(9)C proteins characterized by four cysteine residues spaced ten amino acids apart from one another. These residues form disulfide linkages that define a CHCH fold. In response to stress, the protein translocates from the mitochondrial intermembrane space to the nucleus where it binds to a highly conserved 13 nucleotide oxygen responsive element in the promoter of cytochrome oxidase 4I2, a subunit of the terminal enzyme of the electron transport chain. In concert with recombination signal sequence-binding protein J, binding of this protein activates the oxygen responsive element at four percent oxygen. In addition, it has been shown that this protein is a negative regulator of mitochondria-mediated apoptosis. In response to apoptotic stimuli, mitochondrial levels of this protein decrease, allowing BCL2-associated X protein to oligomerize and activate the caspase cascade. Pseudogenes of this gene are found on multiple chromosomes. Alternative splicing results in multiple transcript variants.

Anti-CHCHD2 antibody

STJ111189 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to a class of eukaryotic CX(9)C proteins characterized by four cysteine residues spaced ten amino acids apart from one another. These residues form disulfide linkages that define a CHCH fold. In response to stress, the protein translocates from the mitochondrial intermembrane space to the nucleus where it binds to a highly conserved 13 nucleotide oxygen responsive element in the promoter of cytochrome oxidase 4I2, a subunit of the terminal enzyme of the electron transport chain. In concert with recombination signal sequence-binding protein J, binding of this protein activates the oxygen responsive element at four percent oxygen. In addition, it has been shown that this protein is a negative regulator of mitochondria-mediated apoptosis. In response to apoptotic stimuli, mitochondrial levels of this protein decrease, allowing BCL2-associated X protein to oligomerize and activate the caspase cascade. Pseudogenes of this gene are found on multiple chromosomes. Alternative splicing results in multiple transcript variants.

Anti-CHCHD2 antibody

STJ119079 100 µl
EUR 277.00

Polyclonal CHCHD2 Antibody (Center)

APR03413G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHCHD2 (Center). This antibody is tested and proven to work in the following applications:

CHCHD2 ELISA KIT|Human

EF008625 96 Tests
EUR 689.00

CHCHD2 Polyclonal Conjugated Antibody

C29923 100ul
EUR 397.00

Human CHCHD2 shRNA Plasmid

20-abx959558
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse CHCHD2 shRNA Plasmid

20-abx970234
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human CHCHD2 ELISA KIT

ELI-50811h 96 Tests
EUR 824.00

Mouse Chchd2 ELISA KIT

ELI-50812m 96 Tests
EUR 865.00

CHCHD2 Recombinant Protein (Human)

RP006949 100 ug Ask for price

CHCHD2 Recombinant Protein (Human)

RP006952 100 ug Ask for price

CHCHD2 Recombinant Protein (Rat)

RP194777 100 ug Ask for price

CHCHD2 Recombinant Protein (Mouse)

RP123812 100 ug Ask for price

[KO Validated] CHCHD2 Rabbit pAb

A20007-100ul 100 ul
EUR 410.00

[KO Validated] CHCHD2 Rabbit pAb

A20007-200ul 200 ul
EUR 571.00

[KO Validated] CHCHD2 Rabbit pAb

A20007-20ul 20 ul
EUR 221.00

[KO Validated] CHCHD2 Rabbit pAb

A20007-50ul 50 ul
EUR 287.00

[KO Validated] CHCHD2 Rabbit pAb

A16645-100ul 100 ul
EUR 308.00

[KO Validated] CHCHD2 Rabbit pAb

A16645-200ul 200 ul
EUR 459.00

[KO Validated] CHCHD2 Rabbit pAb

A16645-20ul 20 ul
EUR 183.00

[KO Validated] CHCHD2 Rabbit pAb

A16645-50ul 50 ul
EUR 223.00

Chchd2 ORF Vector (Rat) (pORF)

ORF064927 1.0 ug DNA
EUR 506.00

CHCHD2 ORF Vector (Human) (pORF)

ORF002317 1.0 ug DNA
EUR 95.00

CHCHD2 ORF Vector (Human) (pORF)

ORF002318 1.0 ug DNA
EUR 95.00

Chchd2 ORF Vector (Mouse) (pORF)

ORF041272 1.0 ug DNA
EUR 506.00

CHCHD2 sgRNA CRISPR Lentivector set (Human)

K0441701 3 x 1.0 ug
EUR 339.00

Chchd2 sgRNA CRISPR Lentivector set (Rat)

K7229801 3 x 1.0 ug
EUR 339.00

Chchd2 sgRNA CRISPR Lentivector set (Mouse)

K3927401 3 x 1.0 ug
EUR 339.00

CHCHD2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0441702 1.0 ug DNA
EUR 154.00

CHCHD2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0441703 1.0 ug DNA
EUR 154.00

CHCHD2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0441704 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7229802 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7229803 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7229804 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3927402 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3927403 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3927404 1.0 ug DNA
EUR 154.00

CHCHD2 Protein Vector (Mouse) (pPB-C-His)

PV165086 500 ng
EUR 603.00

CHCHD2 Protein Vector (Mouse) (pPB-N-His)

PV165087 500 ng
EUR 603.00

CHCHD2 Protein Vector (Mouse) (pPM-C-HA)

PV165088 500 ng
EUR 603.00

CHCHD2 Protein Vector (Mouse) (pPM-C-His)

PV165089 500 ng
EUR 603.00

CHCHD2 Protein Vector (Rat) (pPB-C-His)

PV259706 500 ng
EUR 603.00

CHCHD2 Protein Vector (Rat) (pPB-N-His)

PV259707 500 ng
EUR 603.00

CHCHD2 Protein Vector (Rat) (pPM-C-HA)

PV259708 500 ng
EUR 603.00

CHCHD2 Protein Vector (Rat) (pPM-C-His)

PV259709 500 ng
EUR 603.00

CHCHD2 Protein Vector (Human) (pPB-C-His)

PV009265 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPB-N-His)

PV009266 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPM-C-HA)

PV009267 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPM-C-His)

PV009268 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPB-C-His)

PV009269 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPB-N-His)

PV009270 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPM-C-HA)

PV009271 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPM-C-His)

PV009272 500 ng
EUR 329.00

Chchd2 3'UTR GFP Stable Cell Line

TU153805 1.0 ml Ask for price

Chchd2 3'UTR Luciferase Stable Cell Line

TU103805 1.0 ml Ask for price

Chchd2 3'UTR Luciferase Stable Cell Line

TU202258 1.0 ml Ask for price

Chchd2 3'UTR GFP Stable Cell Line

TU252258 1.0 ml Ask for price

CHCHD2 3'UTR GFP Stable Cell Line

TU054318 1.0 ml
EUR 1394.00

CHCHD2 3'UTR Luciferase Stable Cell Line

TU004318 1.0 ml
EUR 1394.00

CHCHD2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV708693 1.0 ug DNA
EUR 316.00

CHCHD2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV708697 1.0 ug DNA
EUR 316.00

CHCHD2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV708698 1.0 ug DNA
EUR 316.00

CHCHD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV629947 1.0 ug DNA
EUR 514.00

CHCHD2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV629951 1.0 ug DNA
EUR 514.00

CHCHD2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV629952 1.0 ug DNA
EUR 514.00

CHCHD2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0441705 3 x 1.0 ug
EUR 376.00

Chchd2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7229805 3 x 1.0 ug
EUR 376.00

Chchd2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3927405 3 x 1.0 ug
EUR 376.00

CHCHD2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV708694 1.0 ug DNA
EUR 316.00

CHCHD2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV708695 1.0 ug DNA
EUR 374.00

CHCHD2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV708696 1.0 ug DNA
EUR 374.00

CHCHD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0441706 1.0 ug DNA
EUR 167.00

CHCHD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0441707 1.0 ug DNA
EUR 167.00

EIF2S3

EIF2S3 antibody

70R-17045 50 ul
EUR 435.00
Description: Rabbit polyclonal EIF2S3 antibody

EIF2S3 antibody

70R-1058 100 ug
EUR 377.00
Description: Rabbit polyclonal EIF2S3 antibody raised against the N terminal of EIF2S3

EIF2S3 antibody

70R-2892 50 ug
EUR 467.00
Description: Rabbit polyclonal EIF2S3 antibody raised against the N terminal of EIF2S3

EIF2S3 Antibody

47253-100ul 100ul
EUR 252.00

EIF2S3 Antibody

DF12974 200ul
EUR 304.00
Description: EIF2S3 Antibody detects endogenous levels of EIF2S3.

EIF2S3 antibody

70R-36621 100 ug
EUR 349.00
Description: Rabbit Polyclonal EIF2S3 antibody

EIF2S3 Antibody

1-CSB-PA007528ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EIF2S3 Antibody

1-CSB-PA007528ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EIF2S3 Antibody

1-CSB-PA007528GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EIF2S3 siRNA

20-abx915155
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EIF2S3 Blocking Peptide

33R-4841 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S3 antibody, catalog no. 70R-1058

EIF2S3 Blocking Peptide

33R-1197 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRM6 antibody, catalog no. 70R-9576

EIF2S3 Blocking Peptide

DF12974-BP 1mg
EUR 195.00

EIF2S3 Conjugated Antibody

C47253 100ul
EUR 397.00

EIF2S3 cloning plasmid

CSB-CL007528HU-10ug 10ug
EUR 507.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1419
  • Sequence: atggcgggcggagaagctggagtgactctagggcagccgcatctttcgcgtcaggatctcaccaccttggatgttaccaagttgacgccactttcacacgaagttatcagcagacaagccacaattaacataggtacaattggtcatgtagctcatgggaaatccacagtcgtca
  • Show more
Description: A cloning plasmid for the EIF2S3 gene.

EIF2S3 Rabbit pAb

A3848-100ul 100 ul
EUR 308.00

EIF2S3 Rabbit pAb

A3848-200ul 200 ul
EUR 459.00

EIF2S3 Rabbit pAb

A3848-20ul 20 ul
EUR 183.00

EIF2S3 Rabbit pAb

A3848-50ul 50 ul
EUR 223.00

EIF2S3 Rabbit pAb

A6581-100ul 100 ul
EUR 308.00

EIF2S3 Rabbit pAb

A6581-200ul 200 ul
EUR 459.00

EIF2S3 Rabbit pAb

A6581-20ul 20 ul
EUR 183.00

EIF2S3 Rabbit pAb

A6581-50ul 50 ul
EUR 223.00

anti- EIF2S3 antibody

FNab02701 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
  • Uniprot ID: P41091
  • Gene ID: 1968
  • Research Area: Metabolism
Description: Antibody raised against EIF2S3

Anti-EIF2S3 antibody

PAab02701 100 ug
EUR 386.00

Anti-EIF2S3 antibody

STJ28664 100 µl
EUR 277.00
Description: The protein encoded by this gene is the largest subunit of a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA(i) to the 40 S ribosomal subunit.

Anti-EIF2S3 antibody

STJ23510 100 µl
EUR 277.00
Description: The protein encoded by this gene is the largest subunit of a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA(i) to the 40 S ribosomal subunit.

Human EIF2S3 ELISA KIT

ELI-20270h 96 Tests
EUR 824.00

Chicken EIF2S3 ELISA KIT

ELI-21435c 96 Tests
EUR 928.00

EIF2S3 ELISA KIT|Human

EF009337 96 Tests
EUR 689.00

Human EIF2S3 shRNA Plasmid

20-abx951362
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Bovine EIF2S3 ELISA KIT

ELI-48207b 96 Tests
EUR 928.00

pCMV-SPORT6-EIF2S3 Plasmid

PVT16227 2 ug
EUR 325.00

EIF2S3 Recombinant Protein (Human)

RP010393 100 ug Ask for price

EIF2S3 ORF Vector (Human) (pORF)

ORF003465 1.0 ug DNA
EUR 95.00

EIF2S3 sgRNA CRISPR Lentivector set (Human)

K0666901 3 x 1.0 ug
EUR 339.00

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0666902 1.0 ug DNA
EUR 154.00

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0666903 1.0 ug DNA
EUR 154.00

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0666904 1.0 ug DNA
EUR 154.00

EIF2S3 Protein Vector (Human) (pPB-C-His)

PV013857 500 ng
EUR 329.00

EIF2S3 Protein Vector (Human) (pPB-N-His)

PV013858 500 ng
EUR 329.00

EIF2S3 Protein Vector (Human) (pPM-C-HA)

PV013859 500 ng
EUR 329.00

EIF2S3 Protein Vector (Human) (pPM-C-His)

PV013860 500 ng
EUR 329.00

EIF2S3 3'UTR GFP Stable Cell Line

TU056727 1.0 ml
EUR 1394.00

EIF2S3 3'UTR Luciferase Stable Cell Line

TU006727 1.0 ml
EUR 1394.00

EIF2S3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791545 1.0 ug DNA
EUR 316.00

EIF2S3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791546 1.0 ug DNA
EUR 316.00

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

20-abx006825
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

20-abx002795
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

20-abx112361
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

abx036559-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (eIF2S3) Antibody

20-abx141883
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

abx030059-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

abx030059-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

20-abx321796
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

20-abx321797
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

abx232701-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

EIF2S3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0666905 3 x 1.0 ug
EUR 376.00

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E02E0374-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E02E0374-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E02E0374-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E03E0374-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E03E0374-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E03E0374-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E01E0374-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E01E0374-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E01E0374-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E06E0374-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E06E0374-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E06E0374-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ENGASE

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

DLR-ENGASE-Hu-96T 96T
EUR 725.00
  • Should the Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

RDR-ENGASE-Hu-48Tests 48 Tests
EUR 589.00

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

RDR-ENGASE-Hu-96Tests 96 Tests
EUR 820.00

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

RD-ENGASE-Hu-48Tests 48 Tests
EUR 563.00

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

RD-ENGASE-Hu-96Tests 96 Tests
EUR 783.00

ENGASE siRNA

20-abx915401
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ENGASE siRNA

20-abx915402
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Mouse ENGASE shRNA Plasmid

20-abx981120
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human ENGASE shRNA Plasmid

20-abx962078
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

ENGASE Recombinant Protein (Human)

RP056676 100 ug Ask for price

ENGASE Recombinant Protein (Rat)

RP199616 100 ug Ask for price

ENGASE Recombinant Protein (Mouse)

RP131735 100 ug Ask for price

Engase ORF Vector (Rat) (pORF)

ORF066540 1.0 ug DNA
EUR 506.00

ENGASE ORF Vector (Human) (pORF)

ORF018893 1.0 ug DNA Ask for price

Engase ORF Vector (Mouse) (pORF)

ORF043913 1.0 ug DNA
EUR 506.00

ENGASE ELISA Kit (Human) (OKCD02078)

OKCD02078 96 Wells
EUR 909.00
Description: Description of target: Endoglycosidase that releases N-glycans from glycoproteins by cleaving the beta-1,4-glycosidic bond in the N,N'-diacetylchitobiose core. Involved in the processing of free oligosaccharides in the cytosol.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.126 ng/mL

Endo Beta-N-Acetylglucosaminidase (ENGASE) Antibody

20-abx176249
  • EUR 1316.00
  • EUR 620.00
  • 0
  • 1
  • Please enquire.

Endo Beta-N-Acetylglucosaminidase (ENGASE) Antibody

20-abx172220
  • EUR 926.00
  • EUR 467.00
  • 0
  • 1
  • Please enquire.

ENGASE sgRNA CRISPR Lentivector set (Human)

K0680901 3 x 1.0 ug
EUR 339.00

Engase sgRNA CRISPR Lentivector set (Rat)

K6619401 3 x 1.0 ug
EUR 339.00

Engase sgRNA CRISPR Lentivector set (Mouse)

K3632301 3 x 1.0 ug
EUR 339.00

Human Cytosolic endo-beta-N-acetylglucosaminidase (ENGASE)

1-CSB-EP854117HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 59.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Cytosolic endo-beta-N-acetylglucosaminidase(ENGASE),partial expressed in E.coli

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) Protein

20-abx653259
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

ENGASE sgRNA CRISPR Lentivector (Human) (Target 1)

K0680902 1.0 ug DNA
EUR 154.00

ENGASE sgRNA CRISPR Lentivector (Human) (Target 2)

K0680903 1.0 ug DNA
EUR 154.00

ENGASE sgRNA CRISPR Lentivector (Human) (Target 3)

K0680904 1.0 ug DNA
EUR 154.00

Engase sgRNA CRISPR Lentivector (Rat) (Target 1)

K6619402 1.0 ug DNA
EUR 154.00

Engase sgRNA CRISPR Lentivector (Rat) (Target 2)

K6619403 1.0 ug DNA
EUR 154.00

Engase sgRNA CRISPR Lentivector (Rat) (Target 3)

K6619404 1.0 ug DNA
EUR 154.00

Engase sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3632302 1.0 ug DNA
EUR 154.00

Engase sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3632303 1.0 ug DNA
EUR 154.00

Engase sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3632304 1.0 ug DNA
EUR 154.00

ENGASE Protein Vector (Mouse) (pPB-C-His)

PV175650 500 ng
EUR 1065.00

ENGASE Protein Vector (Mouse) (pPB-N-His)

PV175651 500 ng
EUR 1065.00

ENGASE Protein Vector (Mouse) (pPM-C-HA)

PV175652 500 ng
EUR 1065.00

ENGASE Protein Vector (Mouse) (pPM-C-His)

PV175653 500 ng
EUR 1065.00

ENGASE Protein Vector (Rat) (pPB-C-His)

PV266158 500 ng
EUR 1166.00

ENGASE Protein Vector (Rat) (pPB-N-His)

PV266159 500 ng
EUR 1166.00

ENGASE Protein Vector (Rat) (pPM-C-HA)

PV266160 500 ng
EUR 1166.00

ENGASE Protein Vector (Rat) (pPM-C-His)

PV266161 500 ng
EUR 1166.00

ENGASE Protein Vector (Human) (pPB-C-His)

PV075569 500 ng Ask for price

ENGASE Protein Vector (Human) (pPB-N-His)

PV075570 500 ng Ask for price

ENGASE Protein Vector (Human) (pPM-C-HA)

PV075571 500 ng Ask for price

ENGASE Protein Vector (Human) (pPM-C-His)

PV075572 500 ng Ask for price

Engase 3'UTR GFP Stable Cell Line

TU155818 1.0 ml Ask for price

Engase 3'UTR Luciferase Stable Cell Line

TU105818 1.0 ml Ask for price

Engase 3'UTR Luciferase Stable Cell Line

TU203978 1.0 ml Ask for price

Engase 3'UTR GFP Stable Cell Line

TU253978 1.0 ml Ask for price

ENGASE 3'UTR GFP Stable Cell Line

TU056893 1.0 ml
EUR 1521.00

ENGASE 3'UTR Luciferase Stable Cell Line

TU006893 1.0 ml
EUR 1521.00

Human Endo beta N-Acetylglucosaminidase (ENGASE) ELISA Kit

20-abx151413
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Human Cytosolic endo- beta- N- acetylglucosaminidase, ENGASE ELI

ELI-09979h 96 Tests
EUR 824.00

Mouse Cytosolic endo- beta- N- acetylglucosaminidase, Engase ELI

ELI-08659m 96 Tests
EUR 865.00

Human Endo beta N-Acetylglucosaminidase (ENGASE) CLIA Kit

20-abx496092
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 0
  • 1
  • 2
  • Please enquire.

Chicken Cytosolic endo- beta- N- acetylglucosaminidase, ENGASE E

ELI-48095c 96 Tests
EUR 928.00

ENGASE Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV621079 1.0 ug DNA
EUR 1355.00

ENGASE Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV621083 1.0 ug DNA
EUR 1355.00

ENGASE Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV621084 1.0 ug DNA
EUR 1355.00

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

SEN281Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) in Tissue homogenates, cell lysates and other biological fluids.

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

SEN281Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) in Tissue homogenates, cell lysates and other biological fluids.

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

SEN281Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.90
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) in Tissue homogenates, cell lysates and other biological fluids.

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

SEN281Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) in Tissue homogenates, cell lysates and other biological fluids.

Human Endo Beta-N-Acetylglucosaminidase (ENGASE) ELISA Kit

4-SEN281Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 0
  • 1
  • 2
  • Known also as Endo Beta-N-Acetylglucosaminidase elisa. Alternative names of the recognized antigen: Mannosyl-Glycoprotein Endo-Beta-N-Acetylglucosaminidase
  • Di-N-Acetylchitobiosyl Beta-N-Acetylglucosaminidase
  • Cytosolic endo-beta-N-acetylglucosaminid
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Endo Beta-N-Acetylglucosaminidase (ENGASE) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Cytosolic endo β N acetylglucosaminidase(ENGASE) ELISA kit

E02C2286-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytosolic endo β N acetylglucosaminidase(ENGASE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytosolic endo β N acetylglucosaminidase(ENGASE) ELISA kit

E02C2286-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytosolic endo β N acetylglucosaminidase(ENGASE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Cytosolic endo β N acetylglucosaminidase(ENGASE) ELISA kit

E02C2286-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Cytosolic endo β N acetylglucosaminidase(ENGASE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytosolic endo β N acetylglucosaminidase(ENGASE) ELISA kit

E03C2286-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytosolic endo β N acetylglucosaminidase(ENGASE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytosolic endo β N acetylglucosaminidase(ENGASE) ELISA kit

E03C2286-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytosolic endo β N acetylglucosaminidase(ENGASE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Cytosolic endo β N acetylglucosaminidase(ENGASE) ELISA kit

E03C2286-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Cytosolic endo β N acetylglucosaminidase(ENGASE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Cytosolic endo β N acetylglucosaminidase(ENGASE) ELISA kit

E06C2286-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Cytosolic endo β N acetylglucosaminidase(ENGASE) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GPR119

GPR119 antibody

70R-31399 100 ug
EUR 327.00
Description: Rabbit polyclonal GPR119 antibody

GPR119 Antibody

DF4892 200ul
EUR 304.00
Description: GPR119 Antibody detects endogenous levels of total GPR119.

GPR119 Antibody

1-CSB-PA007283
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

GPR119 siRNA

20-abx902267
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR119 siRNA

20-abx918416
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR119 siRNA

20-abx918417
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR119 Antibody

ABD4892 100 ug
EUR 438.00

Anti-GPR119 Antibody

A07391 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for GPR119 Antibody (GPR119) detection.tested for WB in Human.

GPR119 Polyclonal Antibody

40973-100ul 100ul
EUR 252.00

GPR119 Polyclonal Antibody

40973-50ul 50ul
EUR 187.00

GPR119 Blocking Peptide

DF4892-BP 1mg
EUR 195.00

GPR119 Blocking Peptide

20-abx162463
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR119 cloning plasmid

CSB-CL840575HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct
  • Show more
Description: A cloning plasmid for the GPR119 gene.

GPR119 Polyclonal Antibody

ABP53820-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Rabbit pAb

A18544-100ul 100 ul
EUR 308.00

GPR119 Rabbit pAb

A18544-200ul 200 ul
EUR 459.00

GPR119 Rabbit pAb

A18544-20ul 20 ul
EUR 183.00

GPR119 Rabbit pAb

A18544-50ul 50 ul
EUR 223.00

GPR119 Polyclonal Antibody

ES4819-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody

ES4819-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

Anti-GPR119 antibody

STJ11100495 100 µl
EUR 277.00

Anti-GPR119 antibody

STJ93327 200 µl
EUR 197.00
Description: Rabbit polyclonal to GPR119.

Anti-GPR119 antibody

STJ71609 100 µg
EUR 359.00

Mouse Gpr119 ELISA KIT

ELI-09750m 96 Tests
EUR 865.00

Rat GPR119 shRNA Plasmid

20-abx989158
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GPR119 shRNA Plasmid

20-abx965265
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GPR119 Polyclonal Conjugated Antibody

C40973 100ul
EUR 397.00

Mouse GPR119 shRNA Plasmid

20-abx982252
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GPR119 ELISA KIT

ELI-48829h 96 Tests
EUR 824.00

GPR119 Recombinant Protein (Human)

RP039541 100 ug Ask for price

GPR119 Recombinant Protein (Rat)

RP203282 100 ug Ask for price

GPR119 Recombinant Protein (Mouse)

RP139418 100 ug Ask for price

Polyclonal Goat Anti-GPR119 Antibody

APR16300G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (aa186-235)

APR16477G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16478G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16479G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Gpr119 ORF Vector (Rat) (pORF)

ORF067762 1.0 ug DNA
EUR 506.00

GPR119 ORF Vector (Human) (pORF)

ORF013181 1.0 ug DNA
EUR 354.00

Gpr119 ORF Vector (Mouse) (pORF)

ORF046474 1.0 ug DNA
EUR 506.00

Gpr119 sgRNA CRISPR Lentivector set (Rat)

K7204201 3 x 1.0 ug
EUR 339.00

Gpr119 sgRNA CRISPR Lentivector set (Mouse)

K3605701 3 x 1.0 ug
EUR 339.00

GPR119 sgRNA CRISPR Lentivector set (Human)

K0895801 3 x 1.0 ug
EUR 339.00

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx215630-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

20-abx121407
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 119 (GPR119) Antibody

20-abx324143
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx432763-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7204202 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7204203 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7204204 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3605702 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3605703 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3605704 1.0 ug DNA
EUR 154.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)

K0895802 1.0 ug DNA
EUR 154.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)

K0895803 1.0 ug DNA
EUR 154.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)

K0895804 1.0 ug DNA
EUR 154.00

GPR119 Protein Vector (Rat) (pPB-C-His)

PV271046 500 ng
EUR 603.00

GPR119 Protein Vector (Rat) (pPB-N-His)

PV271047 500 ng
EUR 603.00

GPR119 Protein Vector (Rat) (pPM-C-HA)

PV271048 500 ng
EUR 603.00

PSMC1

PSMC1 antibody

70R-19591 50 ul
EUR 435.00
Description: Rabbit polyclonal PSMC1 antibody

PSMC1 Antibody

36704-100ul 100ul
EUR 252.00

PSMC1 Antibody

1-CSB-PA098589
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

PSMC1 Antibody

1-CSB-PA123862
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

PSMC1 Antibody

DF12710 200ul
EUR 304.00
Description: PSMC1 Antibody detects endogenous levels of PSMC1.

Psmc1 antibody

70R-9398 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal Psmc1 antibody

PSMC1 Antibody

1-CSB-PA018888GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PSMC1. Recognizes PSMC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PSMC1 siRNA

20-abx904319
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMC1 siRNA

20-abx930160
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PSMC1 siRNA

20-abx930161
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

pOTB7-PSMC1

PVT18289 2 ug
EUR 231.00

PSMC1 Rabbit pAb

A1040-100ul 100 ul
EUR 308.00

PSMC1 Rabbit pAb

A1040-200ul 200 ul
EUR 459.00

PSMC1 Rabbit pAb

A1040-20ul 20 ul Ask for price

PSMC1 Rabbit pAb

A1040-50ul 50 ul Ask for price

PSMC1 Rabbit pAb

A15712-100ul 100 ul
EUR 308.00

PSMC1 Rabbit pAb

A15712-200ul 200 ul
EUR 459.00

PSMC1 Rabbit pAb

A15712-20ul 20 ul
EUR 183.00

PSMC1 Rabbit pAb

A15712-50ul 50 ul
EUR 223.00

Psmc1 Blocking Peptide

33R-2542 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of Psmc1 antibody, catalog no. 70R-9398

PSMC1 Blocking Peptide

DF12710-BP 1mg
EUR 195.00

PSMC1 Conjugated Antibody

C36704 100ul
EUR 397.00

PSMC1 cloning plasmid

CSB-CL018888HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc
  • Show more
Description: A cloning plasmid for the PSMC1 gene.

PSMC1 cloning plasmid

CSB-CL018888HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc
  • Show more
Description: A cloning plasmid for the PSMC1 gene.

PSMC1 cloning plasmid

CSB-CL018888HU3-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1323
  • Sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgcc
  • Show more
Description: A cloning plasmid for the PSMC1 gene.

anti- PSMC1 antibody

FNab06877 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:5000
  • Immunogen: proteasome(prosome, macropain) 26S subunit, ATPase, 1
  • Uniprot ID: P62191
  • Gene ID: 5700
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against PSMC1

Anti-PSMC1 antibody

PAab06877 100 ug
EUR 355.00

Anti-PSMC1 antibody

STJ111058 100 µl
EUR 277.00
Description: The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes one of the ATPase subunits, a member of the triple-A family of ATPases which have a chaperone-like activity. This subunit and a 20S core alpha subunit interact specifically with the hepatitis B virus X protein, a protein critical to viral replication. This subunit also interacts with the adenovirus E1A protein and this interaction alters the activity of the proteasome. Finally, this subunit interacts with ataxin-7, suggesting a role for the proteasome in the development of spinocerebellar ataxia type 7, a progressive neurodegenerative disorder.

Anti-PSMC1 antibody

STJ118172 100 µl
EUR 277.00

PSMC1 ELISA KIT|Human

EF002119 96 Tests
EUR 689.00

Mouse PSMC1 shRNA Plasmid

20-abx972245
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat PSMC1 shRNA Plasmid

20-abx987436
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human PSMC1 shRNA Plasmid

20-abx953847
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PSMC1 Recombinant Protein (Human)

RP024949 100 ug Ask for price

PSMC1 Recombinant Protein (Human)

RP024952 100 ug Ask for price

PSMC1 Recombinant Protein (Human)

RP024955 100 ug Ask for price

PSMC1 Recombinant Protein (Mouse)

RP165293 100 ug Ask for price

PSMC1 Recombinant Protein (Rat)

RP222635 100 ug Ask for price

Psmc1 ORF Vector (Rat) (pORF)

ORF074213 1.0 ug DNA
EUR 506.00

PSMC1 ORF Vector (Human) (pORF)

ORF008317 1.0 ug DNA
EUR 95.00

PSMC1 ORF Vector (Human) (pORF)

ORF008318 1.0 ug DNA
EUR 95.00

PSMC1 ORF Vector (Human) (pORF)

ORF008319 1.0 ug DNA
EUR 95.00

Psmc1 ORF Vector (Mouse) (pORF)

ORF055099 1.0 ug DNA
EUR 506.00

Polyclonal Psmc1 antibody - C-terminal region

APR01319G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Psmc1 - C-terminal region. This antibody is tested and proven to work in the following applications:

Psmc1 sgRNA CRISPR Lentivector set (Rat)

K7082801 3 x 1.0 ug
EUR 339.00

Psmc1 sgRNA CRISPR Lentivector set (Mouse)

K4691501 3 x 1.0 ug
EUR 339.00

PSMC1 sgRNA CRISPR Lentivector set (Human)

K1740701 3 x 1.0 ug
EUR 339.00

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx214050
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx114740
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx123801
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx128623
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

abx122069-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

20-abx242173
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Proteasome 26S Subunit, ATPase 1 (PSMC1) Antibody

abx236877-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Psmc1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7082802 1.0 ug DNA
EUR 154.00

PSMD8

PSMD8 Antibody

35895-100ul 100ul
EUR 252.00

PSMD8 Antibody

1-CSB-PA073605
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD8. Recognizes PSMD8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PSMD8 Antibody

1-CSB-PA933880
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PSMD8. Recognizes PSMD8 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

PSMD8 Antibody

1-CSB-PA018913ESR2HU