Preparation of a novel antiserum to aromatase with high affinity and specificity: Its clinicopathological significance on breast cancer tissue.

Aromatase inhibitors have been broadly used for the endocrine therapy of estrogen-dependent breast cancer in postmenopausal sufferers. However, clinicopathological research of aromatase have been restricted due to unsatisfactory specificity and/or restricted availability of anti-aromatase antibodies. Here, we have now generated a polyclonal antiserum with high affinity and specificity for human aromatase utilizing a monoclonal antibody … Read more

A Novel Antiserum Against a Predicted Human Peripheral Choline Acetyltransferase (hpChAT) for Labeling Neuronal Structures in Human Colon.

Choline acetyltransferase (ChAT), the enzyme synthesizing acetylcholine (ACh), has an exon-skipping splice variant which is expressed preferentially in the peripheral nervous system (PNS) and thus termed peripheral ChAT (pChAT). A rabbit antiserum beforehand produced towards rat pChAT (rpChAT) has been used for immunohistochemistry (IHC) to research peripheral cholinergic buildings in numerous animals. The current research … Read more

STPKIT3-50T

HLA-DR/CD34

HLADRF34PE-50T 50 test
EUR 323.00

HLA-DR/CD3

HLADRF3PE1-50T 50 test
EUR 350.30

HLA-DR/CD8

HLADRF8PE1-50T 50 test
EUR 350.30

IC IgG1/IgG1/ CD45

ICIGG1FPE45PP1-50T 50 test
EUR 479.00

CD8/CD38

8F138PE-50T 50 test
EUR 350.30

CD8/CD4

8F14PE1-50T 50 test
EUR 350.30

CD8/CD56

8F156PE-50T 50 test
EUR 350.30

CD3/CD16+56

3F11656PE-50T 50 test
EUR 350.30

CD3/CD16+56/CD45/CD19

3F11656PE45PC319A3-50T 50 test
EUR 850.80

CD3/CD16+56/CD45

3F11656PE45PP1-50T 50 test
EUR 479.00

CD3/CD19

3F119PE1-50T 50 test
EUR 350.30

CD3/CD19/CD45

3F119PE145PP1-50T 50 test
EUR 479.00

CD3/CD4

3F14PE1-50T 50 test
EUR 350.30

CD3/CD4/CD45

3F14PE145PC3-50T 50 test
EUR 564.80

CD3/CD4/CD45

3F14PE45PP1-50T 50 test
EUR 479.00

CD3/CD8

3F18PE1-50T 50 test
EUR 350.30

CD3/CD8/CD45/CD4

3F18PE145PC34A2-50T 50 test
EUR 707.80

CD3/CD8/CD45

3F18PE145PP1-50T 50 test
EUR 521.90

CD3/CD8/CD45/CD4

3F18PE145PP14A3-50T 50 test
EUR 609.00

CD4/CD8

4F18PE1-50T 50 test
EUR 350.30

CD4/CD8/CD3

4F18PE13PC2-50T 50 test
EUR 550.50

CD4/CD45RA

4F45RAPE2-50T 50 test
EUR 521.90

CD4/CD8/CD3

4F8PE13PP1-50T 50 test
EUR 521.90

CD45/CD14

45F114PE-50T 50 test
EUR 350.30

CD45RA/CD45RO/CD3/CD4

45RAF245ROPE3PP14A1-50T 50 test
EUR 609.00

CD45RA/CD45RO/CD3/CD8

45RAF245ROPE3PP18A3-50T 50 test
EUR 609.00

CD45RA/CD4

45RAF24PE1-50T 50 test
EUR 364.60

CD45RA/CD62L/CD3/CD4

45RAF262LPE3PP14A1-50T 50 test
EUR 609.00

CD45RA/CD62L/CD3/CD8

45RAF262LPE3PP18A3-50T 50 test
EUR 609.00

CD103/ CD22/ CD20

103F22PE20PP2-50T 50 test
EUR 700.00

CD157/ CD45/ CD64 (HPN)

157PE45PP264A-50T 50 test
EUR 953.50

CD15/CD117

15F117PE-50T 50 test
EUR 362.00

CD15/CD34

15F34PE-50T 50 test
EUR 436.10

CD16/CD56

16F256PE-50T 50 test
EUR 350.30

KAPPA/LAMBDA

1KF3LPE2-50T 50 test
EUR 672.05

CD5/CD19

5F19PE1-50T 50 test
EUR 350.30

CD5/CD20

5F20PE2-50T 50 test
EUR 350.30

MPO/CD22

MPOF22PE-50T 50 test
EUR 436.10

KAPPA/CD19

KAPPAF219PE1-50T 50 test
EUR 350.30

KAPPA/LAMBDA

KAPPAF2LAMBDAPE-50T 50 test
EUR 414.00

KAPPA/LAMBDA/CD19

KAPPAF2LAMBDAPE19PC2-50T 50 test
EUR 784.50

KAPPA/CD19

KF319PE4-50T 50 test
EUR 466.00

LAMBDA/CD19

LAMBDAF19PE1-50T 50 test
EUR 350.30

LAMBDA/CD19

LF219PE4-50T 50 test
EUR 466.00

LAMBDA/KAPPA

LF2KPE3-50T 50 test
EUR 615.50

StepCount Kit1

STPKIT1-50T 50 test
EUR 854.70

StepCount Kit2

STPKIT2-50T 50 test
EUR 999.00

StepCount Kit4

STPKIT4-50T 50 test
EUR 713.00

TDT

TDTF-50T 100 test
EUR 1220.00

RAB9B

RAB9B siRNA

20-abx930716
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB9B siRNA

20-abx930717
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB9B antibody

70R-9454 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB9B antibody

RAB9B Antibody

46193-100ul 100ul
EUR 252.00

RAB9B Antibody

46193-50ul 50ul
EUR 187.00

RAB9B antibody

70R-19727 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB9B antibody

RAB9B Antibody

DF9838 200ul
EUR 304.00
Description: RAB9B Antibody detects endogenous levels of total RAB9B.

RAB9B Antibody

1-CSB-PA019225GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB9B. Recognizes RAB9B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

anti-RAB9B

YF-PA18927 50 ul
EUR 363.00
Description: Mouse polyclonal to RAB9B

anti-RAB9B

YF-PA18928 50 ug
EUR 363.00
Description: Mouse polyclonal to RAB9B

RAB9B, Member RAS Oncogene Family (RAB9B) Antibody

20-abx218139
  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB9B, Member RAS Oncogene Family (RAB9B) Antibody

abx237050-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB9B Conjugated Antibody

C46193 100ul
EUR 397.00

anti- RAB9B antibody

FNab07050 100µg
EUR 505.25
  • Immunogen: RAB9B, member RAS oncogene family
  • Uniprot ID: Q9NP90
  • Gene ID: 51209
  • Research Area: Signal Transduction
Description: Antibody raised against RAB9B

RAB9B Polyclonal Antibody

ES10136-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against RAB9B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB9B Polyclonal Antibody

ES10136-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against RAB9B from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

RAB9B Polyclonal Antibody

ABP60074-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB9B protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB9B from Human, Mouse. This RAB9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9B protein at amino acid sequence of 80-160

RAB9B Polyclonal Antibody

ABP60074-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB9B protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB9B from Human, Mouse. This RAB9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9B protein at amino acid sequence of 80-160

RAB9B Polyclonal Antibody

ABP60074-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from part region of human RAB9B protein at amino acid sequence of 80-160
  • Applications tips:
Description: A polyclonal antibody for detection of RAB9B from Human, Mouse. This RAB9B antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RAB9B protein at amino acid sequence of 80-160

RAB9B Blocking Peptide

33R-4664 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB9B antibody, catalog no. 70R-9454

RAB9B Blocking Peptide

DF9838-BP 1mg
EUR 195.00

Anti-RAB9B antibody

PAab07050 100 ug
EUR 355.00

Anti-Rab9b antibody

STJ140066 100 µg
EUR 231.00
Description: Goat polyclonal antibody to mouse Rab9b. Rab9 belongs to the small GTPase superfamily, Rab family. This protein may be involved in endosome-to-Golgi transport.

Anti-RAB9B antibody

STJ191294 200 µl
EUR 197.00
Description: Unconjugated Rabbit polyclonal to RAB9B

Anti-RAB9B (3C9)

YF-MA18445 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB9B

Mouse RAB9B shRNA Plasmid

20-abx983298
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB9B ELISA KIT|Human

EF002263 96 Tests
EUR 689.00

Human RAB9B shRNA Plasmid

20-abx959611
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB9B Recombinant Protein (Human)

RP085947 100 ug Ask for price

RAB9B Recombinant Protein (Rat)

RP223403 100 ug Ask for price

RAB9B Recombinant Protein (Mouse)

RP166385 100 ug Ask for price

RAB9B ORF Vector (Human) (pORF)

ORF028650 1.0 ug DNA
EUR 405.00

Rab9b ORF Vector (Rat) (pORF)

ORF074469 1.0 ug DNA
EUR 506.00

Rab9b ORF Vector (Mouse) (pORF)

ORF055463 1.0 ug DNA
EUR 506.00

Polyclonal RAB9B antibody - N-terminal region

AMM07499G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB9B - N-terminal region. This antibody is tested and proven to work in the following applications:

Rab9B, Member Ras Oncogene Family Antibody

20-abx115006
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB9B sgRNA CRISPR Lentivector set (Human)

K1770601 3 x 1.0 ug
EUR 339.00

Rab9b sgRNA CRISPR Lentivector set (Mouse)

K4150401 3 x 1.0 ug
EUR 339.00

Rab9b sgRNA CRISPR Lentivector set (Rat)

K6567901 3 x 1.0 ug
EUR 339.00

RAB9B sgRNA CRISPR Lentivector (Human) (Target 1)

K1770602 1.0 ug DNA
EUR 154.00

RAB9B sgRNA CRISPR Lentivector (Human) (Target 2)

K1770603 1.0 ug DNA
EUR 154.00

RAB9B sgRNA CRISPR Lentivector (Human) (Target 3)

K1770604 1.0 ug DNA
EUR 154.00

Rab9b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4150402 1.0 ug DNA
EUR 154.00

Rab9b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4150403 1.0 ug DNA
EUR 154.00

Rab9b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4150404 1.0 ug DNA
EUR 154.00

Rab9b sgRNA CRISPR Lentivector (Rat) (Target 1)

K6567902 1.0 ug DNA
EUR 154.00

Rab9b sgRNA CRISPR Lentivector (Rat) (Target 2)

K6567903 1.0 ug DNA
EUR 154.00

Rab9b sgRNA CRISPR Lentivector (Rat) (Target 3)

K6567904 1.0 ug DNA
EUR 154.00

RAB9B Protein Vector (Human) (pPB-C-His)

PV114598 500 ng
EUR 552.00

RAB9B Protein Vector (Human) (pPB-N-His)

PV114599 500 ng
EUR 552.00

RAB9B Protein Vector (Human) (pPM-C-HA)

PV114600 500 ng
EUR 552.00

RAB9B Protein Vector (Human) (pPM-C-His)

PV114601 500 ng
EUR 552.00

RAB9B Protein Vector (Rat) (pPB-C-His)

PV297874 500 ng
EUR 603.00

RAB9B Protein Vector (Rat) (pPB-N-His)

PV297875 500 ng
EUR 603.00

RAB9B Protein Vector (Rat) (pPM-C-HA)

PV297876 500 ng
EUR 603.00

RAB9B Protein Vector (Rat) (pPM-C-His)

PV297877 500 ng
EUR 603.00

RAB9B Protein Vector (Mouse) (pPB-C-His)

PV221850 500 ng
EUR 603.00

RAB9B Protein Vector (Mouse) (pPB-N-His)

PV221851 500 ng
EUR 603.00

RAB9B Protein Vector (Mouse) (pPM-C-HA)

PV221852 500 ng
EUR 603.00

RAB9B Protein Vector (Mouse) (pPM-C-His)

PV221853 500 ng
EUR 603.00

Rab9b 3'UTR GFP Stable Cell Line

TU167446 1.0 ml Ask for price

RAB9B 3'UTR Luciferase Stable Cell Line

TU019356 1.0 ml
EUR 1521.00

Rab9b 3'UTR Luciferase Stable Cell Line

TU117446 1.0 ml Ask for price

RAB9B 3'UTR GFP Stable Cell Line

TU069356 1.0 ml
EUR 1521.00

Rab9b 3'UTR GFP Stable Cell Line

TU267227 1.0 ml Ask for price

Rab9b 3'UTR Luciferase Stable Cell Line

TU217227 1.0 ml Ask for price

Rabbit Anti-RAB9B monoclonal antibody, clone TS56-16

CABT-L583 100 ul
EUR 777.00

Mouse Ras- related protein Rab- 9B, Rab9b ELISA KIT

ELI-18195m 96 Tests
EUR 865.00

Human Ras- related protein Rab- 9B, RAB9B ELISA KIT

ELI-36024h 96 Tests
EUR 824.00

RAB9B sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1770605 3 x 1.0 ug
EUR 376.00

Rab9b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4150405 3 x 1.0 ug
EUR 376.00

Rab9b sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6567905 3 x 1.0 ug
EUR 376.00

RAB9B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1770606 1.0 ug DNA
EUR 167.00

RAB9B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1770607 1.0 ug DNA
EUR 167.00

RAB9B sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1770608 1.0 ug DNA
EUR 167.00

Rab9b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4150406 1.0 ug DNA
EUR 167.00

Rab9b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4150407 1.0 ug DNA
EUR 167.00

Rab9b sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4150408 1.0 ug DNA
EUR 167.00

Rab9b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6567906 1.0 ug DNA
EUR 167.00

Rab9b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6567907 1.0 ug DNA
EUR 167.00

Rab9b sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6567908 1.0 ug DNA
EUR 167.00

RENBP

RENBP siRNA

20-abx904531
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RENBP siRNA

20-abx931261
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RENBP siRNA

20-abx931262
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-RENBP

YF-PA24564 50 ul
EUR 334.00
Description: Mouse polyclonal to RENBP

RENBP Polyclonal Antibody

27252-100ul 100ul
EUR 252.00

RENBP Polyclonal Antibody

27252-50ul 50ul
EUR 187.00

RENBP Rabbit pAb

A10012-100ul 100 ul
EUR 308.00

RENBP Rabbit pAb

A10012-200ul 200 ul
EUR 459.00

RENBP Rabbit pAb

A10012-20ul 20 ul
EUR 183.00

RENBP Rabbit pAb

A10012-50ul 50 ul
EUR 223.00

RENBP cloning plasmid

CSB-CL019562HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1254
  • Sequence: atggagaaagagcgagagactctgcaggcctggaaggagcgcgtggggcaggagctggaccgcgtggtggctttctggatggagcactcccacgaccaggagcacgggggcttcttcacgtgccttggccgcgaggggcgggtgtatgatgacctcaagtatgtgtggctgcagg
  • Show more
Description: A cloning plasmid for the RENBP gene.

Anti-RENBP antibody

STJ112052 100 µl
EUR 277.00
Description: The gene product inhibits renin activity by forming a dimer with renin, a complex known as high molecular weight renin. The encoded protein contains a leucine zipper domain, which is essential for its dimerization with renin. The gene product can catalyze the interconversion of N-acetylglucosamine to N-acetylmannosamine, indicating that it is a GlcNAc 2-epimerase. Transcript variants utilizing alternative promoters have been described in the literature.

Canine RENBP ELISA KIT

ELI-18021d 96 Tests
EUR 928.00

Mouse RENBP shRNA Plasmid

20-abx972430
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RENBP shRNA Plasmid

20-abx986693
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RENBP Polyclonal Conjugated Antibody

C27252 100ul
EUR 397.00

Human RENBP shRNA Plasmid

20-abx954043
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RENBP Recombinant Protein (Human)

RP026185 100 ug Ask for price

RENBP Recombinant Protein (Mouse)

RP167597 100 ug Ask for price

RENBP Recombinant Protein (Mouse)

RP167600 100 ug Ask for price

RENBP Recombinant Protein (Rat)

RP224081 100 ug Ask for price

Renin Binding Protein (RENBP) Antibody

20-abx128850
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Renin Binding Protein (RENBP) Antibody

20-abx135930
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Renin Binding Protein (RENBP) Antibody

abx122297-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Renbp ORF Vector (Rat) (pORF)

ORF074695 1.0 ug DNA
EUR 506.00

RENBP ORF Vector (Human) (pORF)

ORF008729 1.0 ug DNA
EUR 95.00

Renbp ORF Vector (Mouse) (pORF)

ORF055867 1.0 ug DNA
EUR 506.00

Renbp ORF Vector (Mouse) (pORF)

ORF055868 1.0 ug DNA
EUR 506.00

Recombinant Renin Binding Protein (RENBP)

4-RPC764Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P51606
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.0kDa
  • Isoelectric Point: 6.5
Description: Recombinant Human Renin Binding Protein expressed in: E.coli

RENBP ELISA Kit (Pig) (OKCA01804)

OKCA01804 96 Wells
EUR 930.00
Description: Description of target: Catalyzes the interconversion of N-acetylglucosamine to N-acetylmannosamine. Binds to renin forming a protein complex called high molecular weight (HMW) renin and inhibits renin activity. Involved in the N-glycolylneuraminic acid (Neu5Gc) degradation pathway.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 15.6 pg/mL

Polyclonal RENBP antibody - C-terminal region

APR01579G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RENBP - C-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal RENBP antibody - N-terminal region

APR01580G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RENBP - N-terminal region. This antibody is tested and proven to work in the following applications:

Human Renin Binding Protein (RENBP) Protein

20-abx167848
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Renbp sgRNA CRISPR Lentivector set (Rat)

K7013801 3 x 1.0 ug
EUR 339.00

RENBP sgRNA CRISPR Lentivector set (Human)

K1808701 3 x 1.0 ug
EUR 339.00

Renbp sgRNA CRISPR Lentivector set (Mouse)

K4463401 3 x 1.0 ug
EUR 339.00

Renbp sgRNA CRISPR Lentivector (Rat) (Target 1)

K7013802 1.0 ug DNA
EUR 154.00

Renbp sgRNA CRISPR Lentivector (Rat) (Target 2)

K7013803 1.0 ug DNA
EUR 154.00

Renbp sgRNA CRISPR Lentivector (Rat) (Target 3)

K7013804 1.0 ug DNA
EUR 154.00

RENBP sgRNA CRISPR Lentivector (Human) (Target 1)

K1808702 1.0 ug DNA
EUR 154.00

RENBP sgRNA CRISPR Lentivector (Human) (Target 2)

K1808703 1.0 ug DNA
EUR 154.00

RENBP sgRNA CRISPR Lentivector (Human) (Target 3)

K1808704 1.0 ug DNA
EUR 154.00

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4463402 1.0 ug DNA
EUR 154.00

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4463403 1.0 ug DNA
EUR 154.00

Renbp sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4463404 1.0 ug DNA
EUR 154.00

Renin Binding Protein (RENBP) Polyclonal Antibody (Human)

4-PAC764Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: RENBP (Met1~Gln254)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Renin Binding Protein (RENBP)

RENBP Protein Vector (Rat) (pPB-C-His)

PV298778 500 ng
EUR 603.00

RENBP Protein Vector (Rat) (pPB-N-His)

PV298779 500 ng
EUR 603.00

RENBP Protein Vector (Rat) (pPM-C-HA)

PV298780 500 ng
EUR 603.00

RENBP Protein Vector (Rat) (pPM-C-His)

PV298781 500 ng
EUR 603.00

RENBP Protein Vector (Human) (pPB-C-His)

PV034913 500 ng
EUR 329.00

RENBP Protein Vector (Human) (pPB-N-His)

PV034914 500 ng
EUR 329.00

RENBP Protein Vector (Human) (pPM-C-HA)

PV034915 500 ng
EUR 329.00

RENBP Protein Vector (Human) (pPM-C-His)

PV034916 500 ng
EUR 329.00

RENBP Protein Vector (Mouse) (pPB-C-His)

PV223466 500 ng
EUR 603.00

RENBP Protein Vector (Mouse) (pPB-N-His)

PV223467 500 ng
EUR 603.00

RENBP Protein Vector (Mouse) (pPM-C-HA)

PV223468 500 ng
EUR 603.00

RENBP Protein Vector (Mouse) (pPM-C-His)

PV223469 500 ng
EUR 603.00

RENBP Protein Vector (Mouse) (pPB-C-His)

PV223470 500 ng
EUR 603.00

RENBP Protein Vector (Mouse) (pPB-N-His)

PV223471 500 ng
EUR 603.00

RENBP Protein Vector (Mouse) (pPM-C-HA)

PV223472 500 ng
EUR 603.00

RENBP Protein Vector (Mouse) (pPM-C-His)

PV223473 500 ng
EUR 603.00

Renbp 3'UTR Luciferase Stable Cell Line

TU117724 1.0 ml Ask for price

Renbp 3'UTR GFP Stable Cell Line

TU167724 1.0 ml Ask for price

Renbp 3'UTR Luciferase Stable Cell Line

TU217474 1.0 ml Ask for price

Renbp 3'UTR GFP Stable Cell Line

TU267474 1.0 ml Ask for price

RENBP 3'UTR GFP Stable Cell Line

TU069751 1.0 ml
EUR 2333.00

RENBP 3'UTR Luciferase Stable Cell Line

TU019751 1.0 ml
EUR 2333.00

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E02N0571-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E02N0571-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E02N0571-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human N acylglucosamine 2 epimerase(RENBP) ELISA kit

E01N0571-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit

E04N0571-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit

E04N0571-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit N acylglucosamine 2 epimerase(RENBP) ELISA kit

E04N0571-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit

E03N0571-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit

E03N0571-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse N acylglucosamine 2 epimerase(RENBP) ELISA kit

E03N0571-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E06N0571-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E06N0571-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat N acylglucosamine 2 epimerase(RENBP) ELISA kit

E06N0571-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acylglucosamine 2 epimerase(RENBP) ELISA kit

E08N0571-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog N acylglucosamine 2 epimerase(RENBP) ELISA kit

E08N0571-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine N acylglucosamine 2 epimerase(RENBP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

RPL21

RPL21 antibody

70R-19970 50 ul
EUR 435.00
Description: Rabbit polyclonal RPL21 antibody

RPL21 siRNA

20-abx931931
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL21 siRNA

20-abx931932
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RPL21 Antibody

1-CSB-PA020163GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RPL21. Recognizes RPL21 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

anti-RPL21

YF-PA24606 50 ul
EUR 334.00
Description: Mouse polyclonal to RPL21

anti- RPL21 antibody

FNab07420 100µg
EUR 548.75
  • Immunogen: ribosomal protein L21
  • Uniprot ID: P46778
  • Gene ID: 6144
  • Research Area: Metabolism
Description: Antibody raised against RPL21

RPL21 Rabbit pAb

A14254-100ul 100 ul
EUR 308.00

RPL21 Rabbit pAb

A14254-200ul 200 ul
EUR 459.00

RPL21 Rabbit pAb

A14254-20ul 20 ul
EUR 183.00

RPL21 Rabbit pAb

A14254-50ul 50 ul
EUR 223.00

RPL21 Polyclonal Antibody

28470-100ul 100ul
EUR 252.00

RPL21 Polyclonal Antibody

28470-50ul 50ul
EUR 187.00

Anti-RPL21 antibody

PAab07420 100 ug
EUR 386.00

Anti-RPL21 antibody

STJ116467 100 µl
EUR 277.00
Description: Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L21E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.

Anti-RPL21 (2D8)

YF-MA15243 100 ug
EUR 363.00
Description: Mouse monoclonal to RPL21

RPL21 Polyclonal Conjugated Antibody

C28470 100ul
EUR 397.00

Rat RPL21 shRNA Plasmid

20-abx986555
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RPL21 ELISA KIT|Human

EF002577 96 Tests
EUR 689.00

Human RPL21 shRNA Plasmid

20-abx954134
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RPL21 Recombinant Protein (Human)

RP090501 100 ug Ask for price

RPL21 Recombinant Protein (Rat)

RP226628 100 ug Ask for price

RPL21 Recombinant Protein (Mouse)

RP168992 100 ug Ask for price

Ribosomal Protein L21 (RPL21) Antibody

20-abx115231
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ribosomal Protein L21 (RPL21) Antibody

abx237420-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

RPL21 ORF Vector (Human) (pORF)

ORF030168 1.0 ug DNA
EUR 405.00

Rpl21 ORF Vector (Mouse) (pORF)

ORF056332 1.0 ug DNA
EUR 506.00

Rpl21 ORF Vector (Rat) (pORF)

ORF075544 1.0 ug DNA
EUR 506.00

RPL21 sgRNA CRISPR Lentivector set (Human)

K1922501 3 x 1.0 ug
EUR 339.00

Rpl21 sgRNA CRISPR Lentivector set (Mouse)

K4873401 3 x 1.0 ug
EUR 339.00

Rpl21 sgRNA CRISPR Lentivector set (Rat)

K7047101 3 x 1.0 ug
EUR 339.00

Human Ribosomal Protein L21 (RPL21) ELISA Kit

abx382905-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

RPL21 sgRNA CRISPR Lentivector (Human) (Target 1)

K1922502 1.0 ug DNA
EUR 154.00

RPL21 sgRNA CRISPR Lentivector (Human) (Target 2)

K1922503 1.0 ug DNA
EUR 154.00

RPL21 sgRNA CRISPR Lentivector (Human) (Target 3)

K1922504 1.0 ug DNA
EUR 154.00

Rpl21 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4873402 1.0 ug DNA
EUR 154.00

Rpl21 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4873403 1.0 ug DNA
EUR 154.00

Rpl21 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4873404 1.0 ug DNA
EUR 154.00

Rpl21 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7047102 1.0 ug DNA
EUR 154.00

Rpl21 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7047103 1.0 ug DNA
EUR 154.00

Rpl21 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7047104 1.0 ug DNA
EUR 154.00

RPL21 Protein Vector (Human) (pPB-C-His)

PV120670 500 ng
EUR 552.00

RPL21 Protein Vector (Human) (pPB-N-His)

PV120671 500 ng
EUR 552.00

RPL21 Protein Vector (Human) (pPM-C-HA)

PV120672 500 ng
EUR 552.00

RPL21 Protein Vector (Human) (pPM-C-His)

PV120673 500 ng
EUR 552.00

RPL21 Protein Vector (Rat) (pPB-C-His)

PV302174 500 ng
EUR 603.00

RPL21 Protein Vector (Rat) (pPB-N-His)

PV302175 500 ng
EUR 603.00

RPL21 Protein Vector (Rat) (pPM-C-HA)

PV302176 500 ng
EUR 603.00

RPL21 Protein Vector (Rat) (pPM-C-His)

PV302177 500 ng
EUR 603.00

RPL21 Protein Vector (Mouse) (pPB-C-His)

PV225326 500 ng
EUR 603.00

RPL21 Protein Vector (Mouse) (pPB-N-His)

PV225327 500 ng
EUR 603.00

RPL21 Protein Vector (Mouse) (pPM-C-HA)

PV225328 500 ng
EUR 603.00

RPL21 Protein Vector (Mouse) (pPM-C-His)

PV225329 500 ng
EUR 603.00

Rpl21 3'UTR GFP Stable Cell Line

TU168082 1.0 ml Ask for price

RPL21 3'UTR Luciferase Stable Cell Line

TU020906 1.0 ml
EUR 1394.00

Rpl21 3'UTR Luciferase Stable Cell Line

TU118082 1.0 ml Ask for price

RPL21 3'UTR GFP Stable Cell Line

TU070906 1.0 ml
EUR 1394.00

Rpl21 3'UTR Luciferase Stable Cell Line

TU219625 1.0 ml Ask for price

Rpl21 3'UTR GFP Stable Cell Line

TU269625 1.0 ml Ask for price

Mouse 60S ribosomal protein L21, Rpl21 ELISA KIT

ELI-14428m 96 Tests
EUR 865.00

Human 60S ribosomal protein L21, RPL21 ELISA KIT

ELI-52517h 96 Tests
EUR 824.00

Porcine 60S ribosomal protein L21, RPL21 ELISA KIT

ELI-38896p 96 Tests
EUR 928.00

RPL21 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV693019 1.0 ug DNA
EUR 514.00

RPL21 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV693023 1.0 ug DNA
EUR 514.00

RPL21 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV693024 1.0 ug DNA
EUR 514.00

RPL21 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1922505 3 x 1.0 ug
EUR 376.00

Rpl21 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4873405 3 x 1.0 ug
EUR 376.00

Rpl21 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7047105 3 x 1.0 ug
EUR 376.00

RPL21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1922506 1.0 ug DNA
EUR 167.00

RPL21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1922507 1.0 ug DNA
EUR 167.00

RPL21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1922508 1.0 ug DNA
EUR 167.00

Rpl21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4873406 1.0 ug DNA
EUR 167.00

Rpl21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4873407 1.0 ug DNA
EUR 167.00

Rpl21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4873408 1.0 ug DNA
EUR 167.00

RPL21 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV693020 1.0 ug DNA
EUR 514.00

RPL21 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV693021 1.0 ug DNA
EUR 572.00

RPL21 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV693022 1.0 ug DNA
EUR 572.00

Rpl21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7047106 1.0 ug DNA
EUR 167.00

Rpl21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7047107 1.0 ug DNA
EUR 167.00

Rpl21 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7047108 1.0 ug DNA
EUR 167.00

RAB29

RAB29 Antibody

CSB-PA970360-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RAB29. Recognizes RAB29 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RAB29 Antibody

CSB-PA970360-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RAB29. Recognizes RAB29 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

pOTB7-RAB29

PVT18661 2 ug
EUR 231.00

RAB29, Member RAS Oncogene Family (RAB29) Antibody

abx331840-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

RAB29, Member RAS Oncogene Family (RAB29) Antibody

20-abx327650
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

DLR-RAB7A-Hu-96T 96T
EUR 673.00
  • Should the Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RD-RAB7A-Hu-48Tests 48 Tests
EUR 521.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RD-RAB7A-Hu-96Tests 96 Tests
EUR 723.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RDR-RAB7A-Hu-48Tests 48 Tests
EUR 544.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

RDR-RAB7A-Hu-96Tests 96 Tests
EUR 756.00

Rab7a/ Rat Rab7a ELISA Kit

ELI-44430r 96 Tests
EUR 886.00

RAB7A siRNA

20-abx904434
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A siRNA

20-abx930704
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A siRNA

20-abx930705
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A Antibody

ABD6288 100 ug
EUR 438.00

RAB7A antibody

38205-100ul 100ul
EUR 252.00

RAB7A Antibody

DF6288 200ul
EUR 304.00
Description: RAB7A Antibody detects endogenous levels of total RAB7A.

RAB7A Antibody

CSB-PA019219KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RAB7A Antibody

CSB-PA019219KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

RAB7A Antibody

1-CSB-PA019219LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EGFP- Rab7A

PVT10344 2 ug
EUR 266.00

anti-RAB7A

YF-PA15488 100 ug
EUR 403.00
Description: Rabbit polyclonal to RAB7A

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

20-abx127026
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx117042-100ug 100 ug
EUR 467.00
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx122528-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

20-abx000788
  • EUR 495.00
  • EUR 356.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

20-abx001068
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

abx237043-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody

20-abx302116
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (HRP)

20-abx314287
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (FITC)

20-abx314288
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB7A, Member RAS Oncogene Family (RAB7A) Antibody (Biotin)

20-abx314289
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

RAB7A Conjugated Antibody

C38205 100ul
EUR 397.00

RAB7A cloning plasmid

CSB-CL019219HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 696
  • Sequence: atgagtttctcatccaggccagtccccgagatcctgaaaacttcccatttgttgtgttgggaaacaagattgacctcgaaaacagacaagtggccacaaagcgggcacaggcctggtgctacagcaaaaacaacattccctactttgagaccagtgccaaggaggccatcaacgtg
  • Show more
Description: A cloning plasmid for the RAB7A gene.

anti- RAB7A antibody

FNab07043 100µg
EUR 505.25
  • Immunogen: RAB7A, member RAS oncogene family
  • Uniprot ID: P51149
  • Gene ID: 7879
  • Research Area: Signal Transduction
Description: Antibody raised against RAB7A

RAB7A Rabbit pAb

A1154-100ul 100 ul
EUR 308.00

RAB7A Rabbit pAb

A1154-200ul 200 ul
EUR 459.00

RAB7A Rabbit pAb

A1154-20ul 20 ul
EUR 183.00

RAB7A Rabbit pAb

A1154-50ul 50 ul
EUR 223.00

RAB7A Rabbit pAb

A12344-100ul 100 ul
EUR 308.00

RAB7A Rabbit pAb

A12344-200ul 200 ul
EUR 459.00

RAB7A Rabbit pAb

A12344-20ul 20 ul Ask for price

RAB7A Rabbit pAb

A12344-50ul 50 ul Ask for price

RAB7A Rabbit pAb

A12784-100ul 100 ul
EUR 308.00

RAB7A Rabbit pAb

A12784-200ul 200 ul
EUR 459.00

RAB7A Rabbit pAb

A12784-20ul 20 ul
EUR 183.00

RAB7A Rabbit pAb

A12784-50ul 50 ul
EUR 223.00

RAB7A Blocking Peptide

DF6288-BP 1mg
EUR 195.00

Anti-RAB7A antibody

PAab07043 100 ug
EUR 355.00

pENTR223- RAB7A- T8G

PVT11507 2 ug
EUR 273.00

pCMV-SPORT6-RAB7A

PVT13684 2 ug
EUR 391.00

EGFP-Rab7A Q67L

PVT17461 2 ug
EUR 300.00

Anti-RAB7A antibody

STJ25267 100 µl
EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-RAB7A antibody

STJ114224 100 µl
EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-RAB7A antibody

STJ114654 100 µl
EUR 277.00
Description: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.

Anti-Rab7a antibody

STJ140063 150 µg
EUR 231.00
Description: Goat polyclonal antibody to mouse Rab7. Rab7 belongs to the small GTPase superfamily, Rab family. It has been localized to late endosomes, regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. Rab7 also contributes to the maturation of phagosomes (acidification).

Human RAB7A, Member RAS Oncogene Family (RAB7A) CLIA Kit

20-abx495849
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 0
  • 1
  • 2
  • Please enquire.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

20-abx156866
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-7 working days.

Human RAB7A, Member RAS Oncogene Family ELISA Kit (RAB7A)

RK02178 96 Tests
EUR 521.00

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.30
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-1x96wellstestplate 1x96-wells test plate
EUR 639.00
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

SEK300Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.50
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human RAB7A, Member RAS Oncogene Family (RAB7A) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-A
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in tissue homogenates, cell lysates and other biological fluids.

Human RAB7A, Member RAS Oncogene Family (RAB7A) ELISA Kit

4-SEK300Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 0
  • 1
  • 2
  • Known also as RAB7A, Member RAS Oncogene Family elisa. Alternative names of the recognized antigen: RAB7
  • Ras-related protein Rab-7a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human RAB7A, Member RAS Oncogene Family (RAB7A) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human RAB7A (RAB7A, Member RAS Oncogene Family)

ELK5152 1 plate of 96 wells
EUR 432.00
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to RAB7A, Member RAS Oncogene Family (RAB7A). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody spec
  • Show more
Description: A sandwich ELISA kit for detection of RAB7A, Member RAS Oncogene Family from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat RAB7A shRNA Plasmid

20-abx985507
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB7A ELISA KIT|Human

EF002258 96 Tests
EUR 689.00

Canine RAB7A ELISA KIT

ELI-44429d 96 Tests
EUR 928.00

Human RAB7A shRNA Plasmid

20-abx955306
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB7A protein (His tag)

80R-1636 100 ug
EUR 305.00
Description: Purified recombinant Human RAB7A protein

Mouse RAB7A shRNA Plasmid

20-abx972354
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB7A Antibody, HRP conjugated

1-CSB-PA019219LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RAB7A Antibody, FITC conjugated

1-CSB-PA019219LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RAB7A Antibody, Biotin conjugated

1-CSB-PA019219LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RAB7A. Recognizes RAB7A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-RAB7/RAB7A Antibody

PB9883 100ug/vial
EUR 294.00

RAB7A Recombinant Protein (Human)

RP025543 100 ug Ask for price

RAB7A Recombinant Protein (Rat)

RP223385 100 ug Ask for price

RAB7A ORF Vector (Human) (pORF)

ORF008515 1.0 ug DNA
EUR 95.00

Rab7a ORF Vector (Rat) (pORF)

ORF074463 1.0 ug DNA
EUR 506.00

[One Step] RAB7A antibody Kit

RK05740 50 ul
EUR 240.00

RAB7A ELISA Kit (Human) (OKCD02032)

OKCD02032 96 Wells
EUR 831.00
Description: Description of target: Key regulator in endo-lysosomal trafficking. Governs early-to-late endosomal maturation, microtubule minus-end as well as plus-end directed endosomal migration and positioning, and endosome-lysosome transport through different protein-protein interaction cascades. Plays a central role, not only in endosomal traffic, but also in many other cellular and physiological events, such as growth-factor-mediated cell signaling, nutrient-transportor mediated nutrient uptake, neurotrophin transport in the axons of neurons and lipid metabolism. Also involved in regulation of some specialized endosomal membrane trafficking, such as maturation of melanosomes, pathogen-induced phagosomes (or vacuoles) and autophagosomes. Plays a role in the maturation and acidification of phagosomes that engulf pathogens, such as S.aureus and M.tuberculosis. Plays a role in the fusion of phagosomes with lysosomes. Plays important roles in microbial pathogen infection and survival, as well as in participating in the life cycle of viruses. Microbial pathogens possess survival strategies governed by RAB7A, sometimes by employing RAB7A function (e.g. Salmonella) and sometimes by excluding RAB7A function (e.g. Mycobacterium). In concert with RAC1, plays a role in regulating the formation of RBs (ruffled borders) in osteoclasts. Controls the endosomal trafficking and neurite outgrowth signaling of NTRK1/TRKA.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.113 ng/mL

RAB7A ELISA Kit (Human) (OKEH08041)

OKEH08041 96 Wells
EUR 896.00
Description: Description of target: RAB family members are small, RAS-related GTP-binding proteins that are important regulators of vesicular transport. Each RAB protein targets multiple proteins that act in exocytic / endocytic pathways. This gene encodes a RAB family member that regulates vesicle traffic in the late endosomes and also from late endosomes to lysosomes. This encoded protein is also involved in the cellular vacuolation of the VacA cytotoxin of Helicobacter pylori. Mutations at highly conserved amino acid residues in this gene have caused some forms of Charcot-Marie-Tooth (CMT) type 2 neuropathies.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.23ng/mL

Polyclonal RAB7A / RAB7 Antibody (aa90-140)

AMM07488G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RAB7A / RAB7 (aa90-140). This antibody is tested and proven to work in the following applications:

RAB7A, Member RAS Oncogene Family Protein

20-abx260842
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

RAB7A sgRNA CRISPR Lentivector set (Human)

K1770001 3 x 1.0 ug
EUR 339.00

Rab7a sgRNA CRISPR Lentivector set (Rat)

K6895601 3 x 1.0 ug
EUR 339.00

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06004 5µg Ask for price

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06005 20µg Ask for price

Recombinant Human RAB7A, Member RAS Oncogene Family

7-06006 1mg Ask for price

RAB7A sgRNA CRISPR Lentivector (Human) (Target 1)

K1770002 1.0 ug DNA
EUR 154.00

RAB8B

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

DLR-RAB8B-Hu-96T 96T
EUR 673.00
  • Should the Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human RAB8B, Member RAS Oncogene Family (RAB8B) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RDR-RAB8B-Hu-48Tests 48 Tests
EUR 544.00

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RDR-RAB8B-Hu-96Tests 96 Tests
EUR 756.00

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RD-RAB8B-Hu-48Tests 48 Tests
EUR 521.00

Human RAB8B, Member RAS Oncogene Family (RAB8B) ELISA Kit

RD-RAB8B-Hu-96Tests 96 Tests
EUR 723.00

Rab8b/ Rat Rab8b ELISA Kit

ELI-52483r 96 Tests
EUR 886.00

RAB8B antibody

70R-19725 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB8B antibody

RAB8B Antibody

37853-100ul