In den Nachrichten

RAB31

RAB31 siRNA

20-abx904422
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB31 siRNA

20-abx930640
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB31 siRNA

20-abx930641
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB31 antibody

70R-50847 100 ul
EUR 244.00
Description: Purified Polyclonal RAB31 antibody

RAB31 Antibody

ABD4401 100 ug
EUR 438.00

RAB31 Antibody

34968-100ul 100ul
EUR 252.00

RAB31 Antibody

34968-50ul 50ul
EUR 187.00

RAB31 antibody

70R-19700 50 ul
EUR 435.00
Description: Rabbit polyclonal RAB31 antibody

RAB31 antibody

70R-10405 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal RAB31 antibody

RAB31 Antibody

DF4401 200ul
EUR 304.00
Description: RAB31 Antibody detects endogenous levels of total RAB31.

RAB31 Antibody

1-CSB-PA006759
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against RAB31. Recognizes RAB31 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

RAB31 Antibody

1-CSB-PA614438ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB31. Recognizes RAB31 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB31 Antibody

1-CSB-PA614438ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RAB31. Recognizes RAB31 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RAB31 Antibody

CSB-PA139202-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RAB31. Recognizes RAB31 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RAB31 Antibody

CSB-PA139202-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against RAB31. Recognizes RAB31 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

RAB31 Antibody

1-CSB-PA019183GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against RAB31. Recognizes RAB31 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-RAB31

YF-PA17375 50 ul
EUR 363.00
Description: Mouse polyclonal to RAB31

anti-RAB31

YF-PA17376 50 ug
EUR 363.00
Description: Mouse polyclonal to RAB31

anti-RAB31

YF-PA17377 100 ug
EUR 403.00
Description: Rabbit polyclonal to RAB31

RAB31, Member RAS Oncogene Family (RAB31) Antibody

20-abx123241
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Rab31, Member Ras Oncogene Family (RAB31) Antibody

20-abx114979
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

abx036066-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

20-abx007002
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

20-abx008289
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

20-abx014795
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

20-abx320908
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

20-abx320909
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

20-abx327646
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

abx332712-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

RAB31, Member RAS Oncogene Family (RAB31) Antibody

abx237014-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

RAB31 Conjugated Antibody

C34968 100ul
EUR 397.00

RAB31 cloning plasmid

CSB-CL614438HU-10ug 10ug
EUR 275.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atgatggcgatacgggagctcaaagtgtgccttctcggggacactggggttgggaaatcaagcatcgtgtgtcgatttgtccaggatcactttgaccacaacatcagccctactattggggcatcttttatgaccaaaactgtgccttgtggaaatgaacttcacaagttcctcat
  • Show more
Description: A cloning plasmid for the RAB31 gene.

anti- RAB31 antibody

FNab07014 100µg
EUR 548.75
  • Immunogen: RAB31, member RAS oncogene family
  • Uniprot ID: Q13636
  • Gene ID: 11031
  • Research Area: Signal Transduction
Description: Antibody raised against RAB31

RAB31 Blocking Peptide

20-abx063722
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

RAB31-specific Antibody

abx237015-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Anti-RAB31 Antibody

A05883 100ul
EUR 397.00
Description: Rabbit Polyclonal RAB31 Antibody. Validated in WB and tested in Human, Mouse, Rat.

RAB31 Rabbit pAb

A3667-100ul 100 ul
EUR 308.00

RAB31 Rabbit pAb

A3667-200ul 200 ul
EUR 459.00

RAB31 Rabbit pAb

A3667-20ul 20 ul
EUR 183.00

RAB31 Rabbit pAb

A3667-50ul 50 ul
EUR 223.00

RAB31 Rabbit pAb

A7506-100ul 100 ul
EUR 308.00

RAB31 Rabbit pAb

A7506-200ul 200 ul
EUR 459.00

RAB31 Rabbit pAb

A7506-20ul 20 ul
EUR 183.00

RAB31 Rabbit pAb

A7506-50ul 50 ul
EUR 223.00

RAB31 Blocking Peptide

33R-2805 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RAB31 antibody, catalog no. 70R-10405

RAB31 Blocking Peptide

DF4401-BP 1mg
EUR 195.00

Anti-RAB31 antibody

PAab07014 100 ug
EUR 386.00

Anti-RAB31 antibody

STJ29642 100 µl
EUR 277.00

Anti-Rab31 antibody

STJ140116 150 µg
EUR 231.00
Description: RAB31 belongs to the large RAB family of low molecular weight GTPases that are involved in intracellular membrane trafficking. This protein is required for the normal function and integrity of the Golgi apparatus and the trans-Golgi network. Moreover, Rab31 plays a role in the transport from Golgi to endosomes (M6PR), internalization from cell membrane into endosomes (EGFR), insulin-stimulated translocation to cell membrane (GLUT4), etc.

Anti-RAB31 antibody

STJ116210 100 µl
EUR 277.00

Anti-RAB31 (1C6)

YF-MA17562 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB31

Anti-RAB31 (4D12)

YF-MA17563 100 ug
EUR 363.00
Description: Mouse monoclonal to RAB31

Mouse RAB31 shRNA Plasmid

20-abx979750
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat RAB31 shRNA Plasmid

20-abx987990
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB31 ELISA KIT|Human

EF002230 96 Tests
EUR 689.00

anti- RAB31-specific antibody

FNab07015 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • IHC: 1:50-1:500
  • Immunogen: RAB31, member RAS oncogene family
  • Uniprot ID: Q13636
  • Research Area: Signal Transduction
Description: Antibody raised against RAB31-specific

Human RAB31 shRNA Plasmid

20-abx957538
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

RAB31 protein (His tag)

80R-2258 100 ug
EUR 322.00
Description: Purified recombinant Human RAB31 Protein (His tag)

Anti-RAB31-specific antibody

PAab07015 100 ug
EUR 355.00

RAB31 Recombinant Protein (Human)

RP025471 100 ug Ask for price

RAB31 Recombinant Protein (Rat)

RP223307 100 ug Ask for price

RAB31 Recombinant Protein (Mouse)

RP166262 100 ug Ask for price

RAB31 ORF Vector (Human) (pORF)

ORF008491 1.0 ug DNA
EUR 95.00

Rab31 ORF Vector (Rat) (pORF)

ORF074437 1.0 ug DNA
EUR 506.00

Rab31 ORF Vector (Mouse) (pORF)

ORF055422 1.0 ug DNA
EUR 506.00

Rabbit Anti-Human RAB31 polyclonal antibody

CABT-BL068 100 ul
EUR 585.00

RAB31, Member RAS Oncogene Family Protein

20-abx260886
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

RAB31 sgRNA CRISPR Lentivector set (Human)

K1773301 3 x 1.0 ug
EUR 339.00

Rab31 sgRNA CRISPR Lentivector set (Mouse)

K4969801 3 x 1.0 ug
EUR 339.00

Rab31 sgRNA CRISPR Lentivector set (Rat)

K7192401 3 x 1.0 ug
EUR 339.00

RAB31 sgRNA CRISPR Lentivector (Human) (Target 1)

K1773302 1.0 ug DNA
EUR 154.00

RAB31 sgRNA CRISPR Lentivector (Human) (Target 2)

K1773303 1.0 ug DNA
EUR 154.00

RAB31 sgRNA CRISPR Lentivector (Human) (Target 3)

K1773304 1.0 ug DNA
EUR 154.00

Human Ras-related protein Rab-31 (RAB31)

1-CSB-EP614438HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 48.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Ras-related protein Rab-31(RAB31) expressed in E.coli

Rab31 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4969802 1.0 ug DNA
EUR 154.00

Rab31 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4969803 1.0 ug DNA
EUR 154.00

Rab31 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4969804 1.0 ug DNA
EUR 154.00

Rab31 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7192402 1.0 ug DNA
EUR 154.00

Rab31 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7192403 1.0 ug DNA
EUR 154.00

Rab31 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7192404 1.0 ug DNA
EUR 154.00

RAB31 Protein Vector (Human) (pPB-C-His)

PV033961 500 ng
EUR 329.00

RAB31 Protein Vector (Human) (pPB-N-His)

PV033962 500 ng
EUR 329.00

RAB31 Protein Vector (Human) (pPM-C-HA)

PV033963 500 ng
EUR 329.00

RAB31 Protein Vector (Human) (pPM-C-His)

PV033964 500 ng
EUR 329.00

RAB31 Protein Vector (Rat) (pPB-C-His)

PV297746 500 ng
EUR 603.00