Human Asparagine Synthetase (ASNS) ELISA Kit

DLR-ASNS-Hu-96T 96T
EUR 673
  • Should the Human Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Asparagine Synthetase (ASNS) ELISA Kit

DLR-ASNS-Mu-48T 48T
EUR 527
  • Should the Mouse Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Asparagine Synthetase (ASNS) ELISA Kit

DLR-ASNS-Mu-96T 96T
EUR 688
  • Should the Mouse Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Asparagine Synthetase (ASNS) ELISA Kit

RDR-ASNS-Hu-48Tests 48 Tests
EUR 544

Human Asparagine Synthetase (ASNS) ELISA Kit

RDR-ASNS-Hu-96Tests 96 Tests
EUR 756

Mouse Asparagine Synthetase (ASNS) ELISA Kit

RDR-ASNS-Mu-48Tests 48 Tests
EUR 557

Mouse Asparagine Synthetase (ASNS) ELISA Kit

RDR-ASNS-Mu-96Tests 96 Tests
EUR 774

Human Asparagine Synthetase (ASNS) ELISA Kit

RD-ASNS-Hu-48Tests 48 Tests
EUR 521

Human Asparagine Synthetase (ASNS) ELISA Kit

RD-ASNS-Hu-96Tests 96 Tests
EUR 723

Mouse Asparagine Synthetase (ASNS) ELISA Kit

RD-ASNS-Mu-48Tests 48 Tests
EUR 533

Mouse Asparagine Synthetase (ASNS) ELISA Kit

RD-ASNS-Mu-96Tests 96 Tests
EUR 740

Asns/ Rat Asns ELISA Kit

ELI-48967r 96 Tests
EUR 886

ASNS antibody

70R-15870 50 ul
EUR 435
Description: Rabbit polyclonal ASNS antibody

ASNS Antibody

32909-100ul 100ul
EUR 252

ASNS antibody

10R-3387 100 ul
EUR 726
Description: Mouse monoclonal ASNS antibody

ASNS Antibody

1-CSB-PA002219GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ASNS Antibody

1-CSB-PA002219LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ASNS Antibody

1-CSB-PA596240
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

ASNS Antibody

DF7398 200ul
EUR 304
Description: ASNS Antibody detects endogenous levels of total ASNS.

ASNS Antibody

1-CSB-PA210142
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

ASNS siRNA

20-abx900484
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASNS siRNA

20-abx908359
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASNS siRNA

20-abx908360
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ASNS Antibody

ABD7398 100 ug
EUR 438

ASNS Rabbit mAb

A1030-100ul 100 ul
EUR 410

ASNS Rabbit mAb

A1030-200ul 200 ul
EUR 571

ASNS Rabbit mAb

A1030-20ul 20 ul
EUR 221

ASNS Rabbit mAb

A1030-50ul 50 ul
EUR 287

ASNS Rabbit pAb

A16035-100ul 100 ul
EUR 308

ASNS Rabbit pAb

A16035-200ul 200 ul
EUR 459

ASNS Rabbit pAb

A16035-20ul 20 ul
EUR 183

ASNS Rabbit pAb

A16035-50ul 50 ul
EUR 223

ASNS Blocking Peptide

DF7398-BP 1mg
EUR 195

ASNS cloning plasmid

CSB-CL002219HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1686
  • Sequence: atgtgtggcatttgggcgctgtttggcagtgatgattgcctttctgttcagtgtctgagtgctatgaagattgcacacagaggtccagatgcattccgttttgagaatgtcaatggatacaccaactgctgctttggatttcaccggttggcggtagttgacccgctgtttggaa
  • Show more
Description: A cloning plasmid for the ASNS gene.

ASNS cloning plasmid

CSB-CL002219HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1686
  • Sequence: atgtgtggcatttgggcgctgtttggcagtgatgattgcctttctgttcagtgtctgagtgctatgaagattgcacacagaggtccagatgcattccgttttgagaatgtcaatggatacaccaactgctgctttggatttcaccggttggcggtagttgacccgctgtttggaa
  • Show more
Description: A cloning plasmid for the ASNS gene.

ASNS Rabbit pAb

A5558-100ul 100 ul
EUR 308

ASNS Rabbit pAb

A5558-200ul 200 ul
EUR 459

ASNS Rabbit pAb

A5558-20ul 20 ul
EUR 183

ASNS Rabbit pAb

A5558-50ul 50 ul
EUR 223

anti- ASNS antibody

FNab00644 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • Immunogen: asparagine synthetase
  • Uniprot ID: P08243
  • Gene ID: 440
  • Research Area: Metabolism
Description: Antibody raised against ASNS

Anti-ASNS antibody

PAab00644 100 ug
EUR 355

Anti-ASNS antibody

STJ27504 100 µl
EUR 277
Description: The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene.

Anti-ASNS antibody

STJ118488 100 µl
EUR 277

ASNS Antibody, HRP conjugated

1-CSB-PA002219LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ASNS Antibody, FITC conjugated

1-CSB-PA002219LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ASNS Antibody, Biotin conjugated

1-CSB-PA002219LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Asparagine Synthetase (ASNS) Antibody

20-abx004257
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Asparagine Synthetase (ASNS) Antibody

20-abx214785
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Asparagine Synthetase (ASNS) Antibody

20-abx214786
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Asparagine Synthetase (ASNS) Antibody

20-abx175478
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.