ASNS

Human Asparagine Synthetase (ASNS) ELISA Kit
DLR-ASNS-Hu-96T	DL Develop	96T	EUR 673.00
Should the Human Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Asparagine Synthetase (ASNS) ELISA Kit
DLR-ASNS-Mu-48T	DL Develop	48T	EUR 527.00
Should the Mouse Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Asparagine Synthetase (ASNS) ELISA Kit
DLR-ASNS-Mu-96T	DL Develop	96T	EUR 688.00
Should the Mouse Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Asparagine Synthetase (ASNS) ELISA Kit
RD-ASNS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521.00

Human Asparagine Synthetase (ASNS) ELISA Kit
RD-ASNS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723.00

Mouse Asparagine Synthetase (ASNS) ELISA Kit
RD-ASNS-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533.00

Mouse Asparagine Synthetase (ASNS) ELISA Kit
RD-ASNS-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740.00

Human Asparagine Synthetase (ASNS) ELISA Kit
RDR-ASNS-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544.00

Human Asparagine Synthetase (ASNS) ELISA Kit
RDR-ASNS-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756.00

Mouse Asparagine Synthetase (ASNS) ELISA Kit
RDR-ASNS-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557.00

Mouse Asparagine Synthetase (ASNS) ELISA Kit
RDR-ASNS-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774.00

Asns/ Rat Asns ELISA Kit
ELI-48967r	Lifescience Market	96 Tests	EUR 886.00

ASNS siRNA
20-abx900484	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

ASNS siRNA
20-abx908359	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

ASNS siRNA
20-abx908360	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

ASNS Antibody
ABD7398	Lifescience Market	100 ug	EUR 438.00

ASNS Antibody
32909-100ul	SAB	100ul	EUR 252.00

ASNS antibody
10R-3387	Fitzgerald	100 ul	EUR 726.00
Description: Mouse monoclonal ASNS antibody

ASNS antibody
70R-15870	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal ASNS antibody

ASNS Antibody
DF7398	Affbiotech	200ul	EUR 304.00
Description: ASNS Antibody detects endogenous levels of total ASNS.

ASNS Antibody
1-CSB-PA002219GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ASNS Antibody
1-CSB-PA002219LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ASNS Antibody
1-CSB-PA596240	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

ASNS Antibody
1-CSB-PA210142	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

anti- ASNS antibody
FNab00644	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:2000 IP: 1:500-1:1000 Immunogen: asparagine synthetase Uniprot ID: P08243 Gene ID: 440 Research Area: Metabolism
Description: Antibody raised against ASNS

ASNS Rabbit mAb
A1030-100ul	Abclonal	100 ul	EUR 410.00

ASNS Rabbit mAb
A1030-200ul	Abclonal	200 ul	EUR 571.00

ASNS Rabbit mAb
A1030-20ul	Abclonal	20 ul	EUR 221.00

ASNS Rabbit mAb
A1030-50ul	Abclonal	50 ul	EUR 287.00

ASNS Rabbit pAb
A5558-100ul	Abclonal	100 ul	EUR 308.00

ASNS Rabbit pAb
A5558-200ul	Abclonal	200 ul	EUR 459.00

ASNS Rabbit pAb
A5558-20ul	Abclonal	20 ul	EUR 183.00

ASNS Rabbit pAb
A5558-50ul	Abclonal	50 ul	EUR 223.00

ASNS Rabbit pAb
A16035-100ul	Abclonal	100 ul	EUR 308.00

ASNS Rabbit pAb
A16035-200ul	Abclonal	200 ul	EUR 459.00

ASNS Rabbit pAb
A16035-20ul	Abclonal	20 ul	EUR 183.00

ASNS Rabbit pAb
A16035-50ul	Abclonal	50 ul	EUR 223.00

ASNS Blocking Peptide
DF7398-BP	Affbiotech	1mg	EUR 195.00

ASNS cloning plasmid
CSB-CL002219HU1-10ug	Cusabio	10ug	EUR 376.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1686 Sequence: atgtgtggcatttgggcgctgtttggcagtgatgattgcctttctgttcagtgtctgagtgctatgaagattgcacacagaggtccagatgcattccgttttgagaatgtcaatggatacaccaactgctgctttggatttcaccggttggcggtagttgacccgctgtttggaa Show more
Description: A cloning plasmid for the ASNS gene.

ASNS cloning plasmid
CSB-CL002219HU2-10ug	Cusabio	10ug	EUR 376.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1686 Sequence: atgtgtggcatttgggcgctgtttggcagtgatgattgcctttctgttcagtgtctgagtgctatgaagattgcacacagaggtccagatgcattccgttttgagaatgtcaatggatacaccaactgctgctttggatttcaccggttggcggtagttgacccgctgtttggaa Show more
Description: A cloning plasmid for the ASNS gene.

Anti-ASNS antibody
PAab00644	Lifescience Market	100 ug	EUR 355.00

Anti-ASNS antibody
STJ27504	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene.

Anti-ASNS antibody
STJ118488	St John's Laboratory	100 µl	EUR 277.00

Mouse ASNS shRNA Plasmid
20-abx973824	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat ASNS shRNA Plasmid
20-abx985161	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse Asns ELISA KIT
ELI-11254m	Lifescience Market	96 Tests	EUR 865.00

Bovine ASNS ELISA KIT
ELI-11992b	Lifescience Market	96 Tests	EUR 928.00

ASNS ELISA KIT|Human
EF007946	Lifescience Market	96 Tests	EUR 689.00

Chicken ASNS ELISA KIT
ELI-34138c	Lifescience Market	96 Tests	EUR 928.00

Human ASNS ELISA KIT
ELI-49109h	Lifescience Market	96 Tests	EUR 824.00