In den Nachrichten

ASNS

Human Asparagine Synthetase (ASNS) ELISA Kit

DLR-ASNS-Hu-96T 96T
EUR 673.00
  • Should the Human Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Asparagine Synthetase (ASNS) ELISA Kit

DLR-ASNS-Mu-48T 48T
EUR 527.00
  • Should the Mouse Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Asparagine Synthetase (ASNS) ELISA Kit

DLR-ASNS-Mu-96T 96T
EUR 688.00
  • Should the Mouse Asparagine Synthetase (ASNS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Asparagine Synthetase (ASNS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Asparagine Synthetase (ASNS) ELISA Kit

RD-ASNS-Hu-48Tests 48 Tests
EUR 521.00

Human Asparagine Synthetase (ASNS) ELISA Kit

RD-ASNS-Hu-96Tests 96 Tests
EUR 723.00

Mouse Asparagine Synthetase (ASNS) ELISA Kit

RD-ASNS-Mu-48Tests 48 Tests
EUR 533.00

Mouse Asparagine Synthetase (ASNS) ELISA Kit

RD-ASNS-Mu-96Tests 96 Tests
EUR 740.00

Human Asparagine Synthetase (ASNS) ELISA Kit

RDR-ASNS-Hu-48Tests 48 Tests
EUR 544.00

Human Asparagine Synthetase (ASNS) ELISA Kit

RDR-ASNS-Hu-96Tests 96 Tests
EUR 756.00

Mouse Asparagine Synthetase (ASNS) ELISA Kit

RDR-ASNS-Mu-48Tests 48 Tests
EUR 557.00

Mouse Asparagine Synthetase (ASNS) ELISA Kit

RDR-ASNS-Mu-96Tests 96 Tests
EUR 774.00

Asns/ Rat Asns ELISA Kit

ELI-48967r 96 Tests
EUR 886.00

ASNS siRNA

20-abx900484
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ASNS siRNA

20-abx908359
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ASNS siRNA

20-abx908360
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

ASNS Antibody

ABD7398 100 ug
EUR 438.00

ASNS Antibody

32909-100ul 100ul
EUR 252.00

ASNS antibody

10R-3387 100 ul
EUR 726.00
Description: Mouse monoclonal ASNS antibody

ASNS antibody

70R-15870 50 ul
EUR 435.00
Description: Rabbit polyclonal ASNS antibody

ASNS Antibody

DF7398 200ul
EUR 304.00
Description: ASNS Antibody detects endogenous levels of total ASNS.

ASNS Antibody

1-CSB-PA002219GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ASNS Antibody

1-CSB-PA002219LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

ASNS Antibody

1-CSB-PA596240
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

ASNS Antibody

1-CSB-PA210142
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ASNS. Recognizes ASNS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

anti- ASNS antibody

FNab00644 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:2000
  • IP: 1:500-1:1000
  • Immunogen: asparagine synthetase
  • Uniprot ID: P08243
  • Gene ID: 440
  • Research Area: Metabolism
Description: Antibody raised against ASNS

ASNS Rabbit mAb

A1030-100ul 100 ul
EUR 410.00

ASNS Rabbit mAb

A1030-200ul 200 ul
EUR 571.00

ASNS Rabbit mAb

A1030-20ul 20 ul
EUR 221.00

ASNS Rabbit mAb

A1030-50ul 50 ul
EUR 287.00

ASNS Rabbit pAb

A5558-100ul 100 ul
EUR 308.00

ASNS Rabbit pAb

A5558-200ul 200 ul
EUR 459.00

ASNS Rabbit pAb

A5558-20ul 20 ul
EUR 183.00

ASNS Rabbit pAb

A5558-50ul 50 ul
EUR 223.00

ASNS Rabbit pAb

A16035-100ul 100 ul
EUR 308.00

ASNS Rabbit pAb

A16035-200ul 200 ul
EUR 459.00

ASNS Rabbit pAb

A16035-20ul 20 ul
EUR 183.00

ASNS Rabbit pAb

A16035-50ul 50 ul
EUR 223.00

ASNS Blocking Peptide

DF7398-BP 1mg
EUR 195.00

ASNS cloning plasmid

CSB-CL002219HU1-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1686
  • Sequence: atgtgtggcatttgggcgctgtttggcagtgatgattgcctttctgttcagtgtctgagtgctatgaagattgcacacagaggtccagatgcattccgttttgagaatgtcaatggatacaccaactgctgctttggatttcaccggttggcggtagttgacccgctgtttggaa
  • Show more
Description: A cloning plasmid for the ASNS gene.

ASNS cloning plasmid

CSB-CL002219HU2-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1686
  • Sequence: atgtgtggcatttgggcgctgtttggcagtgatgattgcctttctgttcagtgtctgagtgctatgaagattgcacacagaggtccagatgcattccgttttgagaatgtcaatggatacaccaactgctgctttggatttcaccggttggcggtagttgacccgctgtttggaa
  • Show more
Description: A cloning plasmid for the ASNS gene.

Anti-ASNS antibody

PAab00644 100 ug
EUR 355.00

Anti-ASNS antibody

STJ27504 100 µl
EUR 277.00
Description: The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene.

Anti-ASNS antibody

STJ118488 100 µl
EUR 277.00

Mouse ASNS shRNA Plasmid

20-abx973824
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat ASNS shRNA Plasmid

20-abx985161
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Asns ELISA KIT

ELI-11254m 96 Tests
EUR 865.00

Bovine ASNS ELISA KIT

ELI-11992b 96 Tests
EUR 928.00

ASNS ELISA KIT|Human

EF007946 96 Tests
EUR 689.00

Chicken ASNS ELISA KIT

ELI-34138c 96 Tests
EUR 928.00

Human ASNS ELISA KIT

ELI-49109h 96 Tests
EUR 824.00