BIRC5

BIRC5 siRNA
20-abx900639
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BIRC5 siRNA
20-abx909118
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BIRC5 siRNA
20-abx909119
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

BIRC5 Antibody
BF0652 200ul
EUR 376
Description: BIRC5 antibody detects endogenous levels of total BIRC5.

BIRC5 Protein
20-abx261430
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

BIRC5 Antibody
ABD6452 100 ug
EUR 438

BIRC5 Antibody
32306-100ul 100ul
EUR 252

BIRC5 antibody
10R-3454 100 ul
EUR 691
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody
10R-3455 100 ul
EUR 691
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody
10R-3456 100 ul
EUR 691
Description: Mouse monoclonal BIRC5 antibody

BIRC5 Antibody
DF6452 200ul
EUR 304
Description: BIRC5 Antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody
1-CSB-PA968757
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC5 Antibody
1-CSB-PA002706GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Birc5 Antibody
1-CSB-PA002706HA01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC5 Antibody
1-CSB-PA009320
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

BIRC5 Antibody
1-CSB-PA009326
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

BIRC5 Antibody
1-CSB-PA159155
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

BIRC5 Antibody
1-CSB-PA07249A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:500

BIRC5 Antibody
1-CSB-PA080180
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

anti-BIRC5
YF-PA27168 100 ul
EUR 403
Description: Rabbit polyclonal to BIRC5

BIRC5 Blocking Peptide
BF0652-BP 1mg
EUR 195

BIRC5 Conjugated Antibody
C32306 100ul
EUR 397

BIRC5 cloning plasmid
CSB-CL002706HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atgggtgccccgacgttgccccctgcctggcagccctttctcaaggaccaccgcatctctacattcaagaactggcccttcttggagggctgcgcctgcaccccggagcggatggccgaggctggcttcatccactgccccactgagaacgagccagacttggcccagtgtttctt
  • Show more
Description: A cloning plasmid for the BIRC5 gene.

Survivin (BIRC5) Antibody
20-abx125300
  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx111181
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx109262
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx001305
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx133868
  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx038170-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx010443-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx011576
  • EUR 439.00
  • EUR 133.00
  • 100 ug
  • 20 ug
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx011577-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx326671
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx326820
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx214437
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx214741
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx329628
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

BIRC5 (pT117) Antibody
abx333427-100ul 100 ul
EUR 467
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx412141-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

Survivin (BIRC5) Antibody
abx412488-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Survivin (BIRC5) Antibody
abx430862-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

SURVIVIN (BIRC5) Antibody
abx238402-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Birc5 Polyclonal Antibody
A56487 100 µg
EUR 570.55
Description: fast delivery possible

BIRC5 Blocking Peptide
DF6452-BP 1mg
EUR 195

anti-BIRC5 (1H5)
LF-MA30666 100 ul
EUR 527
Description: Mouse Monoclonal to BIRC5

Anti-BIRC5 Antibody
STJ503164 100 µg
EUR 476

Anti-BIRC5 antibody
STJ26172 100 µl
EUR 277
Description: This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Polyclonal BIRC5 / Survivin Antibody
APR03084G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIRC5 / Survivin . This antibody is tested and proven to work in the following applications:

Rat BIRC5 shRNA Plasmid
20-abx986146
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human BIRC5 ELISA Kit
ELA-E2045h 96 Tests
EUR 824

Canine BIRC5 ELISA KIT
ELI-06567d 96 Tests
EUR 928

Mouse Birc5 ELISA KIT
ELI-06568m 96 Tests
EUR 865

Bovine BIRC5 ELISA KIT
ELI-06569b 96 Tests
EUR 928

Human BIRC5 ELISA KIT
ELI-06570h 96 Tests
EUR 824

Survivin (BIRC5) Antibody (Biotin)
20-abx105174
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (FITC)
20-abx106591
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (HRP)
20-abx108008
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human BIRC5 shRNA Plasmid
20-abx950233
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Anti-Survivin/BIRC5 Antibody
A00379 100ug/vial
EUR 334

Human Survivin (BIRC5) Antibody
21115-05011 150 ug
EUR 217

Mouse BIRC5 shRNA Plasmid
20-abx969184
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Birc5 Antibody, HRP conjugated
1-CSB-PA002706HB01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Birc5 Antibody, FITC conjugated
1-CSB-PA002706HC01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Birc5 Antibody, Biotin conjugated
1-CSB-PA002706HD01MO
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-BIRC5 (Thr117) Antibody
CSB-PA644556-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-BIRC5 (Thr117) Antibody
CSB-PA644556-100ul 100ul
EUR 362
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-BIRC5 (T34) Antibody
1-CSB-PA009313
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T34). Recognizes Phospho-BIRC5 (T34) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Phospho-BIRC5 (T117) Antibody
1-CSB-PA009314
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T117). Recognizes Phospho-BIRC5 (T117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

BIRC5 Antibody, HRP conjugated
1-CSB-PA07249B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC5 Antibody, FITC conjugated
1-CSB-PA07249C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC5 Antibody, Biotin conjugated
1-CSB-PA07249D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-survivin/BIRC5 Antibody
PA1474 100ug/vial
EUR 294

BIRC5 Recombinant Protein (Human)
RP003064 100 ug Ask for price

Anti-survivin/BIRC5 Antibody
RP1026 100ug/vial
EUR 334

Anti-Survivin/BIRC5 Antibody
RP1052 100ug/vial
EUR 294

BIRC5 Recombinant Protein (Rat)
RP192209 100 ug Ask for price

BIRC5 Recombinant Protein (Mouse)
RP119597 100 ug Ask for price

BIRC5 Recombinant Protein (Mouse)
RP119600 100 ug Ask for price

Anti-BIRC5 Antibody (Biotin)
STJ503165 100 µg
EUR 586

Anti-BIRC5 Antibody (FITC)
STJ503166 100 µg
EUR 586

Anti-Survivin / BIRC5 antibody
STJ70580 100 µg
EUR 359

Cow Survivin (BIRC5) ELISA Kit
abx519228-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Dog Survivin (BIRC5) ELISA Kit
abx519229-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Pig Survivin (BIRC5) ELISA Kit
abx519232-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Survivin (BIRC5) ELISA Kit
abx519233-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Survivin (BIRC5) ELISA Kit
abx050206-96tests 96 tests
EUR 668
  • Shipped within 5-10 working days.

Mouse Survivin (BIRC5) ELISA Kit
abx255062-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Survivin (BIRC5) ELISA Kit
abx253587-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Birc5 Polyclonal Antibody, HRP Conjugated
A56488 100 µg
EUR 570.55
Description: reagents widely cited

Birc5 Polyclonal Antibody, FITC Conjugated
A56489 100 µg
EUR 570.55
Description: Ask the seller for details