BIRC5

BIRC5 Antibody
32306-100ul	SAB	100ul	EUR 252.00

BIRC5 antibody
10R-3454	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody
10R-3455	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody
10R-3456	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 Antibody
1-CSB-PA002706GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Birc5 Antibody
1-CSB-PA002706HA01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC5 Antibody
1-CSB-PA07249A0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:500

BIRC5 Antibody
1-CSB-PA080180	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

BIRC5 Antibody
1-CSB-PA968757	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC5 Antibody
DF6452	Affbiotech	200ul	EUR 304.00
Description: BIRC5 Antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody
1-CSB-PA159155	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

BIRC5 Protein
20-abx261430	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	0 1 2
Shipped within 5-10 working days.

BIRC5 Antibody
BF0652	Affbiotech	200ul	EUR 376.00
Description: BIRC5 antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody
1-CSB-PA009320	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

BIRC5 Antibody
1-CSB-PA009326	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

BIRC5 siRNA
20-abx900639	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BIRC5 siRNA
20-abx909118	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BIRC5 siRNA
20-abx909119	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

BIRC5 Antibody
ABD6452	Lifescience Market	100 ug	EUR 438.00

anti-BIRC5
YF-PA27168	Abfrontier	100 ul	EUR 403.00
Description: Rabbit polyclonal to BIRC5

BIRC5 Blocking Peptide
DF6452-BP	Affbiotech	1mg	EUR 195.00

Survivin (BIRC5) Antibody
abx010443-100ul	Abbexa	100 ul	EUR 411.00
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx214437	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx214741	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx111181	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx125300	Abbexa	EUR 495.00 EUR 704.00 EUR 356.00	0 1 2
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx038170-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx133868	Abbexa	EUR 356.00 EUR 537.00 EUR 217.00	0 1 2
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx109262	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx011576	Abbexa	EUR 439.00 EUR 133.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx011577-100ug	Abbexa	100 ug	EUR 411.00
Shipped within 5-10 working days.

SURVIVIN (BIRC5) Antibody
abx238402-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

BIRC5 Conjugated Antibody
C32306	SAB	100ul	EUR 397.00

BIRC5 Blocking Peptide
BF0652-BP	Affbiotech	1mg	EUR 195.00

Survivin (BIRC5) Antibody
abx412141-01mg	Abbexa	0.1 mg	EUR 704.00
Shipped within 1 week.

Survivin (BIRC5) Antibody
abx412488-01mg	Abbexa	0.1 mg	EUR 509.00
Shipped within 1 week.

Survivin (BIRC5) Antibody
20-abx329628	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx326671	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
20-abx326820	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

BIRC5 (pT117) Antibody
abx333427-100ul	Abbexa	100 ul	EUR 467.00
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody
abx430862-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

BIRC5 cloning plasmid
CSB-CL002706HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 429 Sequence: atgggtgccccgacgttgccccctgcctggcagccctttctcaaggaccaccgcatctctacattcaagaactggcccttcttggagggctgcgcctgcaccccggagcggatggccgaggctggcttcatccactgccccactgagaacgagccagacttggcccagtgtttctt Show more
Description: A cloning plasmid for the BIRC5 gene.

Birc5 Polyclonal Antibody
A56487	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

Survivin (BIRC5) Antibody
20-abx001305	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

anti-BIRC5 (1H5)
LF-MA30666	Abfrontier	100 ul	EUR 527.00
Description: Mouse Monoclonal to BIRC5

Anti-BIRC5 antibody
STJ26172	St John's Laboratory	100 µl	EUR 277.00
Description: This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-BIRC5 Antibody
STJ503164	St John's Laboratory	100 µg	EUR 476.00

Human Survivin (BIRC5) Antibody
21115-05011	AssayPro	150 ug	EUR 217.00

Birc5 Antibody, HRP conjugated
1-CSB-PA002706HB01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Birc5 Antibody, FITC conjugated
1-CSB-PA002706HC01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Birc5 Antibody, Biotin conjugated
1-CSB-PA002706HD01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

BIRC5 Antibody, HRP conjugated
1-CSB-PA07249B0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC5 Antibody, FITC conjugated
1-CSB-PA07249C0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC5 Antibody, Biotin conjugated
1-CSB-PA07249D0Rb	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-BIRC5 (Thr117) Antibody
CSB-PA644556-	Cusabio		EUR 335.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-BIRC5 (Thr117) Antibody
CSB-PA644556-100ul	Cusabio	100ul	EUR 362.00
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates. Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Polyclonal BIRC5 / Survivin Antibody
APR03084G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIRC5 / Survivin . This antibody is tested and proven to work in the following applications:

Anti-Survivin/BIRC5 Antibody
A00379	BosterBio	100ug/vial	EUR 334.00

Survivin (BIRC5) Antibody (Biotin)
20-abx105174	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (FITC)
20-abx106591	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (HRP)
20-abx108008	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Human BIRC5 ELISA Kit
ELA-E2045h	Lifescience Market	96 Tests	EUR 824.00

Canine BIRC5 ELISA KIT
ELI-06567d	Lifescience Market	96 Tests	EUR 928.00

Mouse Birc5 ELISA KIT
ELI-06568m	Lifescience Market	96 Tests	EUR 865.00

Bovine BIRC5 ELISA KIT
ELI-06569b	Lifescience Market	96 Tests	EUR 928.00

Human BIRC5 ELISA KIT
ELI-06570h	Lifescience Market	96 Tests	EUR 824.00

Rat BIRC5 shRNA Plasmid
20-abx986146	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Phospho-BIRC5 (T34) Antibody
1-CSB-PA009313	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T34). Recognizes Phospho-BIRC5 (T34) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Phospho-BIRC5 (T117) Antibody
1-CSB-PA009314	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T117). Recognizes Phospho-BIRC5 (T117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Mouse BIRC5 shRNA Plasmid
20-abx969184	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human BIRC5 shRNA Plasmid
20-abx950233	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Anti-survivin/BIRC5 Antibody
PA1474	BosterBio	100ug/vial	EUR 294.00

BIRC5 Recombinant Protein (Human)
RP003064	ABM	100 ug	Ask for price

Anti-survivin/BIRC5 Antibody
RP1026	BosterBio	100ug/vial	EUR 334.00

Anti-Survivin/BIRC5 Antibody
RP1052	BosterBio	100ug/vial	EUR 294.00

BIRC5 Recombinant Protein (Rat)
RP192209	ABM	100 ug	Ask for price

BIRC5 Recombinant Protein (Mouse)
RP119597	ABM	100 ug	Ask for price

BIRC5 Recombinant Protein (Mouse)
RP119600	ABM	100 ug	Ask for price

Anti-Survivin / BIRC5 antibody
STJ70580	St John's Laboratory	100 µg	EUR 359.00

Anti-BIRC5 Antibody (Biotin)
STJ503165	St John's Laboratory	100 µg	EUR 586.00

Anti-BIRC5 Antibody (FITC)
STJ503166	St John's Laboratory	100 µg	EUR 586.00

Human Survivin (BIRC5) ELISA Kit
abx050206-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-10 working days.

Mouse Survivin (BIRC5) ELISA Kit
abx255062-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Human Survivin (BIRC5) ELISA Kit
abx253587-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Cow Survivin (BIRC5) ELISA Kit
abx519228-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Dog Survivin (BIRC5) ELISA Kit
abx519229-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Pig Survivin (BIRC5) ELISA Kit
abx519232-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Rat Survivin (BIRC5) ELISA Kit
abx519233-96tests	Abbexa	96 tests	EUR 668.00
Shipped within 5-12 working days.

Birc5 Polyclonal Antibody, HRP Conjugated
A56488	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Birc5 Polyclonal Antibody, FITC Conjugated
A56489	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details