In den Nachrichten


BIRC5 Antibody

32306-100ul 100ul
EUR 252.00

BIRC5 antibody

10R-3454 100 ul
EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody

10R-3455 100 ul
EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 antibody

10R-3456 100 ul
EUR 691.00
Description: Mouse monoclonal BIRC5 antibody

BIRC5 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Birc5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

BIRC5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:500

BIRC5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1:200-500.ELISA:1/10000

BIRC5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

BIRC5 Antibody

DF6452 200ul
EUR 304.00
Description: BIRC5 Antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

BIRC5 Protein

  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

BIRC5 Antibody

BF0652 200ul
EUR 376.00
Description: BIRC5 antibody detects endogenous levels of total BIRC5.

BIRC5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

BIRC5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BIRC5 Antibody

ABD6452 100 ug
EUR 438.00


YF-PA27168 100 ul
EUR 403.00
Description: Rabbit polyclonal to BIRC5

BIRC5 Blocking Peptide

DF6452-BP 1mg
EUR 195.00

Survivin (BIRC5) Antibody

abx010443-100ul 100 ul
EUR 411.00
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 495.00
  • EUR 704.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

abx038170-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 356.00
  • EUR 537.00
  • EUR 217.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 439.00
  • EUR 133.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

abx011577-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.


abx238402-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

BIRC5 Conjugated Antibody

C32306 100ul
EUR 397.00

BIRC5 Blocking Peptide

BF0652-BP 1mg
EUR 195.00

Survivin (BIRC5) Antibody

abx412141-01mg 0.1 mg
EUR 704.00
  • Shipped within 1 week.

Survivin (BIRC5) Antibody

abx412488-01mg 0.1 mg
EUR 509.00
  • Shipped within 1 week.

Survivin (BIRC5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

BIRC5 (pT117) Antibody

abx333427-100ul 100 ul
EUR 467.00
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody

abx430862-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

BIRC5 cloning plasmid

CSB-CL002706HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atgggtgccccgacgttgccccctgcctggcagccctttctcaaggaccaccgcatctctacattcaagaactggcccttcttggagggctgcgcctgcaccccggagcggatggccgaggctggcttcatccactgccccactgagaacgagccagacttggcccagtgtttctt
  • Show more
Description: A cloning plasmid for the BIRC5 gene.

Birc5 Polyclonal Antibody

A56487 100 µg
EUR 570.55
Description: fast delivery possible

Survivin (BIRC5) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

anti-BIRC5 (1H5)

LF-MA30666 100 ul
EUR 527.00
Description: Mouse Monoclonal to BIRC5

Anti-BIRC5 antibody

STJ26172 100 µl
EUR 277.00
Description: This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-BIRC5 Antibody

STJ503164 100 µg
EUR 476.00

Human Survivin (BIRC5) Antibody

21115-05011 150 ug
EUR 217.00

Birc5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Birc5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Birc5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Birc5. Recognizes Birc5 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

BIRC5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

BIRC5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

BIRC5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against BIRC5. Recognizes BIRC5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-BIRC5 (Thr117) Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Phospho-BIRC5 (Thr117) Antibody

CSB-PA644556-100ul 100ul
EUR 362.00
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic phosphopeptide and KLH conjugates.
  • Show more
Description: A polyclonal antibody against Phospho-BIRC5 (Thr117). Recognizes Phospho-BIRC5 (Thr117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Polyclonal BIRC5 / Survivin Antibody

APR03084G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BIRC5 / Survivin . This antibody is tested and proven to work in the following applications:

Anti-Survivin/BIRC5 Antibody

A00379 100ug/vial
EUR 334.00

Survivin (BIRC5) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Survivin (BIRC5) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.


ELA-E2045h 96 Tests
EUR 824.00


ELI-06567d 96 Tests
EUR 928.00

Mouse Birc5 ELISA KIT

ELI-06568m 96 Tests
EUR 865.00


ELI-06569b 96 Tests
EUR 928.00


ELI-06570h 96 Tests
EUR 824.00

Rat BIRC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Phospho-BIRC5 (T34) Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T34). Recognizes Phospho-BIRC5 (T34) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/5000

Phospho-BIRC5 (T117) Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against Phospho-BIRC5 (T117). Recognizes Phospho-BIRC5 (T117) from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, IF, ELISA;IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/5000

Mouse BIRC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human BIRC5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Anti-survivin/BIRC5 Antibody

PA1474 100ug/vial
EUR 294.00

BIRC5 Recombinant Protein (Human)

RP003064 100 ug Ask for price

Anti-survivin/BIRC5 Antibody

RP1026 100ug/vial
EUR 334.00

Anti-Survivin/BIRC5 Antibody

RP1052 100ug/vial
EUR 294.00

BIRC5 Recombinant Protein (Rat)

RP192209 100 ug Ask for price

BIRC5 Recombinant Protein (Mouse)

RP119597 100 ug Ask for price

BIRC5 Recombinant Protein (Mouse)

RP119600 100 ug Ask for price

Anti-Survivin / BIRC5 antibody

STJ70580 100 µg
EUR 359.00

Anti-BIRC5 Antibody (Biotin)

STJ503165 100 µg
EUR 586.00

Anti-BIRC5 Antibody (FITC)

STJ503166 100 µg
EUR 586.00

Human Survivin (BIRC5) ELISA Kit

abx050206-96tests 96 tests
EUR 668.00
  • Shipped within 5-10 working days.

Mouse Survivin (BIRC5) ELISA Kit

abx255062-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Human Survivin (BIRC5) ELISA Kit

abx253587-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Cow Survivin (BIRC5) ELISA Kit

abx519228-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Dog Survivin (BIRC5) ELISA Kit

abx519229-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Pig Survivin (BIRC5) ELISA Kit

abx519232-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Rat Survivin (BIRC5) ELISA Kit

abx519233-96tests 96 tests
EUR 668.00
  • Shipped within 5-12 working days.

Birc5 Polyclonal Antibody, HRP Conjugated

A56488 100 µg
EUR 570.55
Description: reagents widely cited

Birc5 Polyclonal Antibody, FITC Conjugated

A56489 100 µg
EUR 570.55
Description: Ask the seller for details