CBX4

CBX4 siRNA
20-abx910432
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CBX4 antibody
38757-100ul 100ul
EUR 252

CBX4 Antibody
43446-100ul 100ul
EUR 252

CBX4 Antibody
25530-100ul 100ul
EUR 390

CBX4 Antibody
1-CSB-PA004600EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

CBX4 Antibody
1-CSB-PA004600ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CBX4 Antibody
1-CSB-PA324695
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

anti-CBX4
YF-PA15683 50 ul
EUR 363
Description: Mouse polyclonal to CBX4

anti-CBX4
YF-PA15684 50 ug
EUR 363
Description: Mouse polyclonal to CBX4

E3 SUMO-Protein Ligase CBX4 (CBX4) Antibody
abx231331-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CBX4 Conjugated Antibody
C38757 100ul
EUR 397

CBX4 Conjugated Antibody
C43446 100ul
EUR 397

CBX4 cloning plasmid
CSB-CL004600HU-10ug 10ug
EUR 355
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atggagctgccagctgttggcgagcacgtcttcgcggtggagagcatcgagaagaagcggatccgcaagggcagagtggagtatctggtgaaatggagaggctggtcgcccaaatataacacgtgggaaccggaggagaacatcctggaccccaggctgctgatcgccttccagaa
  • Show more
Description: A cloning plasmid for the CBX4 gene.

anti- CBX4 antibody
FNab01331 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IP : 1:50 - 1:200
  • Immunogen: chromobox homolog 4 (Pc class homolog, Drosophila)
  • Uniprot ID: O00257
  • Gene ID: 8535
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against CBX4

CBX4 Polyclonal Antibody
A-3016 100 µg
EUR 628.55
Description: fast delivery possible

CBX4 Rabbit pAb
A6221-100ul 100 ul
EUR 308

CBX4 Rabbit pAb
A6221-200ul 200 ul
EUR 459

CBX4 Rabbit pAb
A6221-20ul 20 ul
EUR 183

CBX4 Rabbit pAb
A6221-50ul 50 ul
EUR 223

CBX4 Rabbit pAb
A5532-100ul 100 ul
EUR 308

CBX4 Rabbit pAb
A5532-200ul 200 ul
EUR 459

CBX4 Rabbit pAb
A5532-20ul 20 ul
EUR 183

CBX4 Rabbit pAb
A5532-50ul 50 ul
EUR 223

Anti-CBX4 antibody
PAab01331 100 ug
EUR 355

Anti-CBX4 antibody
STJ27977 100 µl
EUR 277

Anti-CBX4 antibody
STJ27483 100 µl
EUR 277

Mouse E3 SUMO- protein ligase CBX4, Cbx4 ELISA KIT
ELI-10900m 96 Tests
EUR 865

Human E3 SUMO- protein ligase CBX4, CBX4 ELISA KIT
ELI-50926h 96 Tests
EUR 824

CBX4 ELISA KIT|Human
EF008423 96 Tests
EUR 689

Chromobox 4 (CBX4) Antibody
20-abx213527
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Human CBX4 shRNA Plasmid
20-abx955606
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse CBX4 shRNA Plasmid
20-abx969514
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

CBX4 Antibody, HRP conjugated
1-CSB-PA004600EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CBX4 Antibody, FITC conjugated
1-CSB-PA004600EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CBX4 Antibody, Biotin conjugated
1-CSB-PA004600ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CBX4 Recombinant Protein (Human)
RP005755 100 ug Ask for price

pcDNA6-Flag-CBX4 Plasmid
PVTB00736-2a 2 ug
EUR 356

CBX4 Recombinant Protein (Mouse)
RP121451 100 ug Ask for price

CBX4 ORF Vector (Human) (pORF)
ORF001919 1.0 ug DNA
EUR 95

Cbx4 ORF Vector (Mouse) (pORF)
ORF040485 1.0 ug DNA
EUR 506

CBX4 sgRNA CRISPR Lentivector set (Human)
K0370901 3 x 1.0 ug
EUR 339

Chromobox Protein Homolog 4 (CBX4) Antibody
20-abx141500
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 4 (CBX4) Antibody
abx038400-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 4 (CBX4) Antibody
20-abx004752
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 4 (CBX4) Antibody
20-abx320047
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 4 (CBX4) Antibody
abx224169-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Cbx4 sgRNA CRISPR Lentivector set (Mouse)
K4007801 3 x 1.0 ug
EUR 339

CBX4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0370902 1.0 ug DNA
EUR 154

CBX4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0370903 1.0 ug DNA
EUR 154

CBX4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0370904 1.0 ug DNA
EUR 154

Human Chromobox Homolog 4 (CBX4) ELISA Kit
20-abx386317
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Cbx4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4007802 1.0 ug DNA
EUR 154

Cbx4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4007803 1.0 ug DNA
EUR 154

Cbx4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4007804 1.0 ug DNA
EUR 154

CBX4 Protein Vector (Human) (pPB-C-His)
PV007673 500 ng
EUR 329

CBX4 Protein Vector (Human) (pPB-N-His)
PV007674 500 ng
EUR 329

CBX4 Protein Vector (Human) (pPM-C-HA)
PV007675 500 ng
EUR 329

CBX4 Protein Vector (Human) (pPM-C-His)
PV007676 500 ng
EUR 329

CBX4 Protein Vector (Mouse) (pPB-C-His)
PV161938 500 ng
EUR 603

CBX4 Protein Vector (Mouse) (pPB-N-His)
PV161939 500 ng
EUR 603

CBX4 Protein Vector (Mouse) (pPM-C-HA)
PV161940 500 ng
EUR 603

CBX4 Protein Vector (Mouse) (pPM-C-His)
PV161941 500 ng
EUR 603

Cbx4 3'UTR Luciferase Stable Cell Line
TU201723 1.0 ml Ask for price

Cbx4 3'UTR GFP Stable Cell Line
TU153202 1.0 ml Ask for price

CBX4 3'UTR Luciferase Stable Cell Line
TU003565 1.0 ml
EUR 1394

Cbx4 3'UTR Luciferase Stable Cell Line
TU103202 1.0 ml Ask for price

CBX4 3'UTR GFP Stable Cell Line
TU053565 1.0 ml
EUR 1394

Cbx4 3'UTR GFP Stable Cell Line
TU251723 1.0 ml Ask for price

CBX4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0370905 3 x 1.0 ug
EUR 376

Cbx4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4007805 3 x 1.0 ug
EUR 376

CBX4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0370906 1.0 ug DNA
EUR 167

CBX4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0370907 1.0 ug DNA
EUR 167

CBX4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0370908 1.0 ug DNA
EUR 167

Cbx4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4007806 1.0 ug DNA
EUR 167

Cbx4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4007807 1.0 ug DNA
EUR 167

Cbx4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4007808 1.0 ug DNA
EUR 167