  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CBX4 antibody

38757-100ul 100ul
EUR 252.00

CBX4 Antibody

43446-100ul 100ul
EUR 252.00

CBX4 Antibody

25530-100ul 100ul
EUR 390.00

CBX4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

CBX4 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

CBX4 Antibody

  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000


YF-PA15683 50 ul
EUR 363.00
Description: Mouse polyclonal to CBX4


YF-PA15684 50 ug
EUR 363.00
Description: Mouse polyclonal to CBX4

E3 SUMO-Protein Ligase CBX4 (CBX4) Antibody

abx231331-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

CBX4 Conjugated Antibody

C38757 100ul
EUR 397.00

CBX4 Conjugated Antibody

C43446 100ul
EUR 397.00

CBX4 cloning plasmid

CSB-CL004600HU-10ug 10ug
EUR 355.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 873
  • Sequence: atggagctgccagctgttggcgagcacgtcttcgcggtggagagcatcgagaagaagcggatccgcaagggcagagtggagtatctggtgaaatggagaggctggtcgcccaaatataacacgtgggaaccggaggagaacatcctggaccccaggctgctgatcgccttccagaa
  • Show more
Description: A cloning plasmid for the CBX4 gene.

anti- CBX4 antibody

FNab01331 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IP : 1:50 - 1:200
  • Immunogen: chromobox homolog 4 (Pc class homolog, Drosophila)
  • Uniprot ID: O00257
  • Gene ID: 8535
  • Research Area: Metabolism, Developmental biology
Description: Antibody raised against CBX4

CBX4 Polyclonal Antibody

A-3016 100 µg
EUR 628.55
Description: fast delivery possible

CBX4 Rabbit pAb

A6221-100ul 100 ul
EUR 308.00

CBX4 Rabbit pAb

A6221-200ul 200 ul
EUR 459.00

CBX4 Rabbit pAb

A6221-20ul 20 ul
EUR 183.00

CBX4 Rabbit pAb

A6221-50ul 50 ul
EUR 223.00

CBX4 Rabbit pAb

A5532-100ul 100 ul
EUR 308.00

CBX4 Rabbit pAb

A5532-200ul 200 ul
EUR 459.00

CBX4 Rabbit pAb

A5532-20ul 20 ul
EUR 183.00

CBX4 Rabbit pAb

A5532-50ul 50 ul
EUR 223.00

Anti-CBX4 antibody

PAab01331 100 ug
EUR 355.00

Anti-CBX4 antibody

STJ27977 100 µl
EUR 277.00

Anti-CBX4 antibody

STJ27483 100 µl
EUR 277.00

Mouse E3 SUMO- protein ligase CBX4, Cbx4 ELISA KIT

ELI-10900m 96 Tests
EUR 865.00

Human E3 SUMO- protein ligase CBX4, CBX4 ELISA KIT

ELI-50926h 96 Tests
EUR 824.00


EF008423 96 Tests
EUR 689.00

Chromobox 4 (CBX4) Antibody

  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Human CBX4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse CBX4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

CBX4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CBX4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CBX4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CBX4. Recognizes CBX4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CBX4 Recombinant Protein (Human)

RP005755 100 ug Ask for price

pcDNA6-Flag-CBX4 Plasmid

PVTB00736-2a 2 ug
EUR 356.00

CBX4 Recombinant Protein (Mouse)

RP121451 100 ug Ask for price

CBX4 ORF Vector (Human) (pORF)

ORF001919 1.0 ug DNA
EUR 95.00

Cbx4 ORF Vector (Mouse) (pORF)

ORF040485 1.0 ug DNA
EUR 506.00

CBX4 sgRNA CRISPR Lentivector set (Human)

K0370901 3 x 1.0 ug
EUR 339.00

Chromobox Protein Homolog 4 (CBX4) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 4 (CBX4) Antibody

abx038400-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 4 (CBX4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 4 (CBX4) Antibody

  • EUR 300.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Chromobox Protein Homolog 4 (CBX4) Antibody

abx224169-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

Cbx4 sgRNA CRISPR Lentivector set (Mouse)

K4007801 3 x 1.0 ug
EUR 339.00

CBX4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0370902 1.0 ug DNA
EUR 154.00

CBX4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0370903 1.0 ug DNA
EUR 154.00

CBX4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0370904 1.0 ug DNA
EUR 154.00

Human Chromobox Homolog 4 (CBX4) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 0
  • 1
  • 2
  • Shipped within 5-12 working days.

Cbx4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4007802 1.0 ug DNA
EUR 154.00

Cbx4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4007803 1.0 ug DNA
EUR 154.00

Cbx4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4007804 1.0 ug DNA
EUR 154.00

CBX4 Protein Vector (Human) (pPB-C-His)

PV007673 500 ng
EUR 329.00

CBX4 Protein Vector (Human) (pPB-N-His)

PV007674 500 ng
EUR 329.00

CBX4 Protein Vector (Human) (pPM-C-HA)

PV007675 500 ng
EUR 329.00

CBX4 Protein Vector (Human) (pPM-C-His)

PV007676 500 ng
EUR 329.00

CBX4 Protein Vector (Mouse) (pPB-C-His)

PV161938 500 ng
EUR 603.00

CBX4 Protein Vector (Mouse) (pPB-N-His)

PV161939 500 ng
EUR 603.00

CBX4 Protein Vector (Mouse) (pPM-C-HA)

PV161940 500 ng
EUR 603.00

CBX4 Protein Vector (Mouse) (pPM-C-His)

PV161941 500 ng
EUR 603.00

Cbx4 3'UTR Luciferase Stable Cell Line

TU201723 1.0 ml Ask for price

Cbx4 3'UTR GFP Stable Cell Line

TU153202 1.0 ml Ask for price

CBX4 3'UTR Luciferase Stable Cell Line

TU003565 1.0 ml
EUR 1394.00

Cbx4 3'UTR Luciferase Stable Cell Line

TU103202 1.0 ml Ask for price

CBX4 3'UTR GFP Stable Cell Line

TU053565 1.0 ml
EUR 1394.00

Cbx4 3'UTR GFP Stable Cell Line

TU251723 1.0 ml Ask for price

CBX4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0370905 3 x 1.0 ug
EUR 376.00

Cbx4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4007805 3 x 1.0 ug
EUR 376.00

CBX4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0370906 1.0 ug DNA
EUR 167.00

CBX4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0370907 1.0 ug DNA
EUR 167.00

CBX4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0370908 1.0 ug DNA
EUR 167.00

Cbx4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4007806 1.0 ug DNA
EUR 167.00

Cbx4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4007807 1.0 ug DNA
EUR 167.00

Cbx4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4007808 1.0 ug DNA
EUR 167.00