CCT6A

CCT6A siRNA
20-abx910908	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

CCT6A antibody
70R-21474	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal CCT6A antibody

CCT6A Antibody
ABD4562	Lifescience Market	100 ug	EUR 438.00

CCT6A Antibody
35092-100ul	SAB	100ul	EUR 252.00

CCT6A Antibody
35092-50ul	SAB	50ul	EUR 187.00

CCT6A Antibody
DF4562	Affbiotech	200ul	EUR 304.00
Description: CCT6A Antibody detects endogenous levels of total CCT6A.

CCT6A Antibody
1-CSB-PA004865EA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CCT6A Antibody
1-CSB-PA004865ESR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

CCT6A Antibody
1-CSB-PA004865GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCT6A Antibody
1-CSB-PA004250	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

CCT6A Antibody
CSB-PA796607-	Cusabio		EUR 335.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Antibody
CSB-PA796607-100ul	Cusabio	100ul	EUR 316.00
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Conjugated Antibody
C35092	SAB	100ul	EUR 397.00

CCT6A cloning plasmid
CSB-CL004865HU-10ug	Cusabio	10ug	EUR 376.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1596 Sequence: ATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTGGCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCCAAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAG Show more
Description: A cloning plasmid for the CCT6A gene.

CCT6A-Specific Antibody
abx231401-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Anti-CCT6A Antibody
A09373	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal CCT6A Antibody. Validated in IHC, WB and tested in Human.

CCT6A Rabbit pAb
A3589-100ul	Abclonal	100 ul	EUR 308.00

CCT6A Rabbit pAb
A3589-200ul	Abclonal	200 ul	EUR 459.00

CCT6A Rabbit pAb
A3589-20ul	Abclonal	20 ul	EUR 183.00

CCT6A Rabbit pAb
A3589-50ul	Abclonal	50 ul	EUR 223.00

CCT6A Blocking Peptide
DF4562-BP	Affbiotech	1mg	EUR 195.00

Anti-CCT6A antibody
STJ29904	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, several pseudogenes of this gene have been located.

CCT6A ELISA KIT|Human
EF008482	Lifescience Market	96 Tests	EUR 689.00

anti- CCT6A-Specific antibody
FNab01401	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:1000 Immunogen: chaperonin containing TCP1, subunit 6A(zeta 1) Uniprot ID: P40227 Research Area: Metabolism
Description: Antibody raised against CCT6A-Specific

Human CCT6A shRNA Plasmid
20-abx950637	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse CCT6A shRNA Plasmid
20-abx969540	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

CCT6A Antibody, HRP conjugated
1-CSB-PA004865EB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCT6A Antibody, FITC conjugated
1-CSB-PA004865EC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCT6A Antibody, Biotin conjugated
1-CSB-PA004865ED01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CCT6A-Specific antibody
PAab01401	Lifescience Market	100 ug	EUR 355.00

CCT6A Recombinant Protein (Human)
RP037876	ABM	100 ug	Ask for price

CCT6A Recombinant Protein (Rat)
RP193820	ABM	100 ug	Ask for price

CCT6A Recombinant Protein (Mouse)
RP122315	ABM	100 ug	Ask for price

Cct6a ORF Vector (Mouse) (pORF)
ORF040773	ABM	1.0 ug DNA	EUR 506.00

CCT6A ORF Vector (Human) (pORF)
ORF012626	ABM	1.0 ug DNA	EUR 354.00

Cct6a ORF Vector (Rat) (pORF)
ORF064608	ABM	1.0 ug DNA	EUR 506.00

CCT6A ELISA Kit (Human) (OKCA00835)
OKCA00835	Aviva Systems Biology	96 Wells	EUR 833.00
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. Known to play a role, in vitro, in the folding of actin and tubulin. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

CCT6A sgRNA CRISPR Lentivector set (Human)
K0397301	ABM	3 x 1.0 ug	EUR 339.00

Cct6a sgRNA CRISPR Lentivector set (Mouse)
K4782901	ABM	3 x 1.0 ug	EUR 339.00

Cct6a sgRNA CRISPR Lentivector set (Rat)
K7472001	ABM	3 x 1.0 ug	EUR 339.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 1)
K0397302	ABM	1.0 ug DNA	EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 2)
K0397303	ABM	1.0 ug DNA	EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 3)
K0397304	ABM	1.0 ug DNA	EUR 154.00

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
20-abx111566	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
20-abx328411	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
abx330610-100ul	Abbexa	100 ul	EUR 425.00
Shipped within 5-10 working days.

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4782902	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4782903	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4782904	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7472002	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7472003	ABM	1.0 ug DNA	EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7472004	ABM	1.0 ug DNA	EUR 154.00

CCT6A Protein Vector (Human) (pPB-C-His)
PV050501	ABM	500 ng	EUR 481.00

CCT6A Protein Vector (Human) (pPB-N-His)
PV050502	ABM	500 ng	EUR 481.00

CCT6A Protein Vector (Human) (pPM-C-HA)
PV050503	ABM	500 ng	EUR 481.00

CCT6A Protein Vector (Human) (pPM-C-His)
PV050504	ABM	500 ng	EUR 481.00

CCT6A Protein Vector (Rat) (pPB-C-His)
PV258430	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Rat) (pPB-N-His)
PV258431	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Rat) (pPM-C-HA)
PV258432	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Rat) (pPM-C-His)
PV258433	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Mouse) (pPB-C-His)
PV163090	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Mouse) (pPB-N-His)
PV163091	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Mouse) (pPM-C-HA)
PV163092	ABM	500 ng	EUR 603.00

CCT6A Protein Vector (Mouse) (pPM-C-His)
PV163093	ABM	500 ng	EUR 603.00

Cct6a 3'UTR Luciferase Stable Cell Line
TU201926	ABM	1.0 ml	Ask for price

Cct6a 3'UTR GFP Stable Cell Line
TU153440	ABM	1.0 ml	Ask for price

CCT6A 3'UTR Luciferase Stable Cell Line
TU003839	ABM	1.0 ml	EUR 1394.00

Cct6a 3'UTR Luciferase Stable Cell Line
TU103440	ABM	1.0 ml	Ask for price

CCT6A 3'UTR GFP Stable Cell Line
TU053839	ABM	1.0 ml	EUR 1394.00

Cct6a 3'UTR GFP Stable Cell Line
TU251926	ABM	1.0 ml	Ask for price

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
abx146199-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx005625	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx014943	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx320500	Abbexa	EUR 300.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Human T-complex protein 1 subunit zeta (CCT6A)
1-CSB-EP004865HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	0 1 2 3 4 5
MW: 61.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit zeta(CCT6A) expressed in E.coli

CCT6A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV637585	ABM	1.0 ug DNA	EUR 682.00

CCT6A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV637589	ABM	1.0 ug DNA	EUR 682.00

CCT6A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV637590	ABM	1.0 ug DNA	EUR 682.00

CCT6A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702555	ABM	1.0 ug DNA	EUR 450.00

CCT6A Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702559	ABM	1.0 ug DNA	EUR 450.00

CCT6A Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702560	ABM	1.0 ug DNA	EUR 450.00

Bovine T- complex protein 1 subunit zeta, CCT6A ELISA KIT
ELI-18866b	Lifescience Market	96 Tests	EUR 928.00

Human T- complex protein 1 subunit zeta, CCT6A ELISA KIT
ELI-18867h	Lifescience Market	96 Tests	EUR 824.00

Mouse T- complex protein 1 subunit zeta, Cct6a ELISA KIT
ELI-46486m	Lifescience Market	96 Tests	EUR 865.00

CCT6A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0397305	ABM	3 x 1.0 ug	EUR 376.00

Human T-Complex Protein 1 Subunit Zeta (CCT6A) ELISA Kit
abx352113-96tests	Abbexa	96 tests	EUR 786.00
Shipped within 5-12 working days.

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4782905	ABM	3 x 1.0 ug	EUR 376.00

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit
CSB-EL004865HU-24T	Cusabio	1 plate of 24 wells	EUR 165.00
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta (CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit
1-CSB-EL004865HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	0 1 2
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta(CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7472005	ABM	3 x 1.0 ug	EUR 376.00