CCT6A

CCT6A Antibody
35092-100ul 100ul
EUR 252

CCT6A Antibody
35092-50ul 50ul
EUR 187

CCT6A Antibody
1-CSB-PA004865EA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CCT6A Antibody
1-CSB-PA004865ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

CCT6A Antibody
1-CSB-PA004865GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCT6A Antibody
1-CSB-PA004250
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

CCT6A Antibody
CSB-PA796607-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Antibody
CSB-PA796607-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Antibody
DF4562 200ul
EUR 304
Description: CCT6A Antibody detects endogenous levels of total CCT6A.

CCT6A siRNA
20-abx910907
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT6A siRNA
20-abx910908
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CCT6A Antibody
ABD4562 100 ug
EUR 438

Anti-CCT6A Antibody
A09373 100ul
EUR 397
Description: Rabbit Polyclonal CCT6A Antibody. Validated in IHC, WB and tested in Human.

CCT6A Blocking Peptide
DF4562-BP 1mg
EUR 195

CCT6A Conjugated Antibody
C35092 100ul
EUR 397

CCT6A-Specific Antibody
abx231401-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

CCT6A cloning plasmid
CSB-CL004865HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1596
  • Sequence: ATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTGGCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCCAAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAG
  • Show more
Description: A cloning plasmid for the CCT6A gene.

CCT6A Rabbit pAb
A3589-100ul 100 ul
EUR 308

CCT6A Rabbit pAb
A3589-200ul 200 ul
EUR 459

CCT6A Rabbit pAb
A3589-20ul 20 ul
EUR 183

CCT6A Rabbit pAb
A3589-50ul 50 ul
EUR 223

Anti-CCT6A antibody
STJ29904 100 µl
EUR 277
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, several pseudogenes of this gene have been located.

CCT6A Antibody, HRP conjugated
1-CSB-PA004865EB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCT6A Antibody, FITC conjugated
1-CSB-PA004865EC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCT6A Antibody, Biotin conjugated
1-CSB-PA004865ED01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

CCT6A ELISA KIT|Human
EF008482 96 Tests
EUR 689

Mouse CCT6A shRNA Plasmid
20-abx969540
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human CCT6A shRNA Plasmid
20-abx950637
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

anti- CCT6A-Specific antibody
FNab01401 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: chaperonin containing TCP1, subunit 6A(zeta 1)
  • Uniprot ID: P40227
  • Research Area: Metabolism
Description: Antibody raised against CCT6A-Specific

Anti-CCT6A-Specific antibody
PAab01401 100 ug
EUR 355

CCT6A Recombinant Protein (Human)
RP037876 100 ug Ask for price

CCT6A Recombinant Protein (Rat)
RP193820 100 ug Ask for price

CCT6A Recombinant Protein (Mouse)
RP122315 100 ug Ask for price

Cct6a ORF Vector (Rat) (pORF)
ORF064608 1.0 ug DNA
EUR 506

CCT6A ORF Vector (Human) (pORF)
ORF012626 1.0 ug DNA
EUR 354

Cct6a ORF Vector (Mouse) (pORF)
ORF040773 1.0 ug DNA
EUR 506

CCT6A ELISA Kit (Human) (OKCA00835)
OKCA00835 96 Wells
EUR 833
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. Known to play a role, in vitro, in the folding of actin and tubulin. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

Cct6a sgRNA CRISPR Lentivector set (Mouse)
K4782901 3 x 1.0 ug
EUR 339

CCT6A sgRNA CRISPR Lentivector set (Human)
K0397301 3 x 1.0 ug
EUR 339

Cct6a sgRNA CRISPR Lentivector set (Rat)
K7472001 3 x 1.0 ug
EUR 339

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
20-abx111566
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
abx330610-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody
20-abx328411
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4782902 1.0 ug DNA
EUR 154

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4782903 1.0 ug DNA
EUR 154

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4782904 1.0 ug DNA
EUR 154

CCT6A sgRNA CRISPR Lentivector (Human) (Target 1)
K0397302 1.0 ug DNA
EUR 154

CCT6A sgRNA CRISPR Lentivector (Human) (Target 2)
K0397303 1.0 ug DNA
EUR 154

CCT6A sgRNA CRISPR Lentivector (Human) (Target 3)
K0397304 1.0 ug DNA
EUR 154

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 1)
K7472002 1.0 ug DNA
EUR 154

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 2)
K7472003 1.0 ug DNA
EUR 154

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 3)
K7472004 1.0 ug DNA
EUR 154

CCT6A Protein Vector (Mouse) (pPB-C-His)
PV163090 500 ng
EUR 603

CCT6A Protein Vector (Mouse) (pPB-N-His)
PV163091 500 ng
EUR 603

CCT6A Protein Vector (Mouse) (pPM-C-HA)
PV163092 500 ng
EUR 603

CCT6A Protein Vector (Mouse) (pPM-C-His)
PV163093 500 ng
EUR 603

CCT6A Protein Vector (Rat) (pPB-C-His)
PV258430 500 ng
EUR 603

CCT6A Protein Vector (Rat) (pPB-N-His)
PV258431 500 ng
EUR 603

CCT6A Protein Vector (Rat) (pPM-C-HA)
PV258432 500 ng
EUR 603

CCT6A Protein Vector (Rat) (pPM-C-His)
PV258433 500 ng
EUR 603

CCT6A Protein Vector (Human) (pPB-C-His)
PV050501 500 ng
EUR 481

CCT6A Protein Vector (Human) (pPB-N-His)
PV050502 500 ng
EUR 481

CCT6A Protein Vector (Human) (pPM-C-HA)
PV050503 500 ng
EUR 481

CCT6A Protein Vector (Human) (pPM-C-His)
PV050504 500 ng
EUR 481

Cct6a 3'UTR GFP Stable Cell Line
TU153440 1.0 ml Ask for price

Cct6a 3'UTR Luciferase Stable Cell Line
TU103440 1.0 ml Ask for price

Cct6a 3'UTR Luciferase Stable Cell Line
TU201926 1.0 ml Ask for price

Cct6a 3'UTR GFP Stable Cell Line
TU251926 1.0 ml Ask for price

CCT6A 3'UTR GFP Stable Cell Line
TU053839 1.0 ml
EUR 1394

CCT6A 3'UTR Luciferase Stable Cell Line
TU003839 1.0 ml
EUR 1394

Human T-complex protein 1 subunit zeta (CCT6A)
1-CSB-EP004865HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 61.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit zeta(CCT6A) expressed in E.coli

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx005625
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx014943
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
abx146199-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody
20-abx320500
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

CCT6A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV702555 1.0 ug DNA
EUR 450

CCT6A Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV702559 1.0 ug DNA
EUR 450

CCT6A Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV702560 1.0 ug DNA
EUR 450

CCT6A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV637585 1.0 ug DNA
EUR 682

CCT6A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV637589 1.0 ug DNA
EUR 682

CCT6A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV637590 1.0 ug DNA
EUR 682

Bovine T- complex protein 1 subunit zeta, CCT6A ELISA KIT
ELI-18866b 96 Tests
EUR 928

Human T- complex protein 1 subunit zeta, CCT6A ELISA KIT
ELI-18867h 96 Tests
EUR 824

Mouse T- complex protein 1 subunit zeta, Cct6a ELISA KIT
ELI-46486m 96 Tests
EUR 865

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit
CSB-EL004865HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta (CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit
1-CSB-EL004865HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta(CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human T-Complex Protein 1 Subunit Zeta (CCT6A) ELISA Kit
abx352113-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4782905 3 x 1.0 ug
EUR 376

CCT6A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0397305 3 x 1.0 ug
EUR 376

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7472005 3 x 1.0 ug
EUR 376