CCT6A

CCT6A siRNA

20-abx910908
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CCT6A antibody

70R-21474 50 ul
EUR 435.00
Description: Rabbit polyclonal CCT6A antibody

CCT6A Antibody

ABD4562 100 ug
EUR 438.00

CCT6A Antibody

35092-100ul 100ul
EUR 252.00

CCT6A Antibody

35092-50ul 50ul
EUR 187.00

CCT6A Antibody

DF4562 200ul
EUR 304.00
Description: CCT6A Antibody detects endogenous levels of total CCT6A.

CCT6A Antibody

1-CSB-PA004865EA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

CCT6A Antibody

1-CSB-PA004865ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IP; Recommended dilution: IHC:1:20-1:200, IP:1:200-1:2000

CCT6A Antibody

1-CSB-PA004865GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CCT6A Antibody

1-CSB-PA004250
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

CCT6A Antibody

CSB-PA796607-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Antibody

CSB-PA796607-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

CCT6A Conjugated Antibody

C35092 100ul
EUR 397.00

CCT6A cloning plasmid

CSB-CL004865HU-10ug 10ug
EUR 376.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1596
  • Sequence: ATGGCGGCGGTGAAGACCCTGAACCCCAAGGCCGAGGTGGCCCGAGCGCAGGCGGCGCTGGCGGTCAACATCAGCGCAGCGCGGGGTCTGCAGGACGTGCTAAGGACCAACCTGGGGCCCAAGGGCACCATGAAGATGCTCGTTTCTGGCGCTGGAGACATCAAACTTACTAAAG
  • Show more
Description: A cloning plasmid for the CCT6A gene.

CCT6A-Specific Antibody

abx231401-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Anti-CCT6A Antibody

A09373 100ul
EUR 397.00
Description: Rabbit Polyclonal CCT6A Antibody. Validated in IHC, WB and tested in Human.

CCT6A Rabbit pAb

A3589-100ul 100 ul
EUR 308.00

CCT6A Rabbit pAb

A3589-200ul 200 ul
EUR 459.00

CCT6A Rabbit pAb

A3589-20ul 20 ul
EUR 183.00

CCT6A Rabbit pAb

A3589-50ul 50 ul
EUR 223.00

CCT6A Blocking Peptide

DF4562-BP 1mg
EUR 195.00

Anti-CCT6A antibody

STJ29904 100 µl
EUR 277.00
Description: The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, several pseudogenes of this gene have been located.

CCT6A ELISA KIT|Human

EF008482 96 Tests
EUR 689.00

anti- CCT6A-Specific antibody

FNab01401 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: chaperonin containing TCP1, subunit 6A(zeta 1)
  • Uniprot ID: P40227
  • Research Area: Metabolism
Description: Antibody raised against CCT6A-Specific

Human CCT6A shRNA Plasmid

20-abx950637
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse CCT6A shRNA Plasmid

20-abx969540
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

CCT6A Antibody, HRP conjugated

1-CSB-PA004865EB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CCT6A Antibody, FITC conjugated

1-CSB-PA004865EC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

CCT6A Antibody, Biotin conjugated

1-CSB-PA004865ED01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CCT6A. Recognizes CCT6A from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-CCT6A-Specific antibody

PAab01401 100 ug
EUR 355.00

CCT6A Recombinant Protein (Human)

RP037876 100 ug Ask for price

CCT6A Recombinant Protein (Rat)

RP193820 100 ug Ask for price

CCT6A Recombinant Protein (Mouse)

RP122315 100 ug Ask for price

Cct6a ORF Vector (Mouse) (pORF)

ORF040773 1.0 ug DNA
EUR 506.00

CCT6A ORF Vector (Human) (pORF)

ORF012626 1.0 ug DNA
EUR 354.00

Cct6a ORF Vector (Rat) (pORF)

ORF064608 1.0 ug DNA
EUR 506.00

CCT6A ELISA Kit (Human) (OKCA00835)

OKCA00835 96 Wells
EUR 833.00
Description: Description of target: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. Known to play a role, in vitro, in the folding of actin and tubulin. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

CCT6A sgRNA CRISPR Lentivector set (Human)

K0397301 3 x 1.0 ug
EUR 339.00

Cct6a sgRNA CRISPR Lentivector set (Mouse)

K4782901 3 x 1.0 ug
EUR 339.00

Cct6a sgRNA CRISPR Lentivector set (Rat)

K7472001 3 x 1.0 ug
EUR 339.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 1)

K0397302 1.0 ug DNA
EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 2)

K0397303 1.0 ug DNA
EUR 154.00

CCT6A sgRNA CRISPR Lentivector (Human) (Target 3)

K0397304 1.0 ug DNA
EUR 154.00

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

20-abx111566
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

20-abx328411
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Chaperonin Containing TCP1, Subunit 6A (CCT6A) Antibody

abx330610-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4782902 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4782903 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4782904 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 1)

K7472002 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 2)

K7472003 1.0 ug DNA
EUR 154.00

Cct6a sgRNA CRISPR Lentivector (Rat) (Target 3)

K7472004 1.0 ug DNA
EUR 154.00

CCT6A Protein Vector (Human) (pPB-C-His)

PV050501 500 ng
EUR 481.00

CCT6A Protein Vector (Human) (pPB-N-His)

PV050502 500 ng
EUR 481.00

CCT6A Protein Vector (Human) (pPM-C-HA)

PV050503 500 ng
EUR 481.00

CCT6A Protein Vector (Human) (pPM-C-His)

PV050504 500 ng
EUR 481.00

CCT6A Protein Vector (Rat) (pPB-C-His)

PV258430 500 ng
EUR 603.00

CCT6A Protein Vector (Rat) (pPB-N-His)

PV258431 500 ng
EUR 603.00

CCT6A Protein Vector (Rat) (pPM-C-HA)

PV258432 500 ng
EUR 603.00

CCT6A Protein Vector (Rat) (pPM-C-His)

PV258433 500 ng
EUR 603.00

CCT6A Protein Vector (Mouse) (pPB-C-His)

PV163090 500 ng
EUR 603.00

CCT6A Protein Vector (Mouse) (pPB-N-His)

PV163091 500 ng
EUR 603.00

CCT6A Protein Vector (Mouse) (pPM-C-HA)

PV163092 500 ng
EUR 603.00

CCT6A Protein Vector (Mouse) (pPM-C-His)

PV163093 500 ng
EUR 603.00

Cct6a 3'UTR Luciferase Stable Cell Line

TU201926 1.0 ml Ask for price

Cct6a 3'UTR GFP Stable Cell Line

TU153440 1.0 ml Ask for price

CCT6A 3'UTR Luciferase Stable Cell Line

TU003839 1.0 ml
EUR 1394.00

Cct6a 3'UTR Luciferase Stable Cell Line

TU103440 1.0 ml Ask for price

CCT6A 3'UTR GFP Stable Cell Line

TU053839 1.0 ml
EUR 1394.00

Cct6a 3'UTR GFP Stable Cell Line

TU251926 1.0 ml Ask for price

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody

abx146199-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody

20-abx005625
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody

20-abx014943
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

T-Complex 1 Protein Subunit Zeta (CCT6A) Antibody

20-abx320500
  • EUR 300.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Human T-complex protein 1 subunit zeta (CCT6A)

1-CSB-EP004865HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • MW: 61.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human T-complex protein 1 subunit zeta(CCT6A) expressed in E.coli

CCT6A Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV637585 1.0 ug DNA
EUR 682.00

CCT6A Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV637589 1.0 ug DNA
EUR 682.00

CCT6A Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV637590 1.0 ug DNA
EUR 682.00

CCT6A Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702555 1.0 ug DNA
EUR 450.00

CCT6A Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702559 1.0 ug DNA
EUR 450.00

CCT6A Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702560 1.0 ug DNA
EUR 450.00

Bovine T- complex protein 1 subunit zeta, CCT6A ELISA KIT

ELI-18866b 96 Tests
EUR 928.00

Human T- complex protein 1 subunit zeta, CCT6A ELISA KIT

ELI-18867h 96 Tests
EUR 824.00

Mouse T- complex protein 1 subunit zeta, Cct6a ELISA KIT

ELI-46486m 96 Tests
EUR 865.00

CCT6A sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0397305 3 x 1.0 ug
EUR 376.00

Human T-Complex Protein 1 Subunit Zeta (CCT6A) ELISA Kit

abx352113-96tests 96 tests
EUR 786.00
  • Shipped within 5-12 working days.

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4782905 3 x 1.0 ug
EUR 376.00

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit

CSB-EL004865HU-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta (CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human T-complex protein 1 subunit zeta(CCT6A) ELISA kit

1-CSB-EL004865HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human T-complex protein 1 subunit zeta(CCT6A) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Cct6a sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7472005 3 x 1.0 ug
EUR 376.00