In den Nachrichten



  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CHCHD2 antibody

70R-16380 50 ul
EUR 435.00
Description: Rabbit polyclonal CHCHD2 antibody

CHCHD2 Antibody

DF12066 200ul
EUR 304.00
Description: CHCHD2 antibody detects endogenous levels of CHCHD2.

CHCHD2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CHCHD2. Recognizes CHCHD2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF


PVT18548 2 ug
EUR 231.00

anti- CHCHD2 antibody

FNab01635 100µg
EUR 548.75
  • Immunogen: coiled-coil-helix-coiled-coil-helix domain containing 2
  • Uniprot ID: Q9Y6H1
  • Gene ID: 51142
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against CHCHD2

CHCHD2 Rabbit pAb

A3429-100ul 100 ul
EUR 308.00

CHCHD2 Rabbit pAb

A3429-200ul 200 ul
EUR 459.00

CHCHD2 Rabbit pAb

A3429-20ul 20 ul Ask for price

CHCHD2 Rabbit pAb

A3429-50ul 50 ul Ask for price

CHCHD2 Polyclonal Antibody

29923-100ul 100ul
EUR 252.00

CHCHD2 Polyclonal Antibody

29923-50ul 50ul
EUR 187.00

CHCHD2 Blocking Peptide

DF12066-BP 1mg
EUR 195.00

CHCHD2 cloning plasmid

CSB-CL897588HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atgccgcgtggaagccgaagccgcacctcccgcatggcccctccggccagccgggcccctcagatgagagctgcacccaggccagcaccagtcgctcagccaccagcagcggcacccccatctgcagttggctcttctgctgctgcgccccggcagccaggtctgatggcccagat
  • Show more
Description: A cloning plasmid for the CHCHD2 gene.

CHCHD2 cloning plasmid

CSB-CL897588HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atgccgcgtggaagccgaagccgcacctcccgcatggcccctccggccagccgggcccctcagatgagagctgcacccaggccagcaccagtcgctcagccaccagcagcggcacccccatctgcagttggctcttctgctgctgcgccccggcagccagttctgatggcccagat
  • Show more
Description: A cloning plasmid for the CHCHD2 gene.

Anti-CHCHD2 antibody

PAab01635 100 ug
EUR 386.00

Anti-CHCHD2 antibody

STJ11100883 100 µl
EUR 413.00
Description: The protein encoded by this gene belongs to a class of eukaryotic CX(9)C proteins characterized by four cysteine residues spaced ten amino acids apart from one another. These residues form disulfide linkages that define a CHCH fold. In response to stress, the protein translocates from the mitochondrial intermembrane space to the nucleus where it binds to a highly conserved 13 nucleotide oxygen responsive element in the promoter of cytochrome oxidase 4I2, a subunit of the terminal enzyme of the electron transport chain. In concert with recombination signal sequence-binding protein J, binding of this protein activates the oxygen responsive element at four percent oxygen. In addition, it has been shown that this protein is a negative regulator of mitochondria-mediated apoptosis. In response to apoptotic stimuli, mitochondrial levels of this protein decrease, allowing BCL2-associated X protein to oligomerize and activate the caspase cascade. Pseudogenes of this gene are found on multiple chromosomes. Alternative splicing results in multiple transcript variants.

Anti-CHCHD2 antibody

STJ111189 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to a class of eukaryotic CX(9)C proteins characterized by four cysteine residues spaced ten amino acids apart from one another. These residues form disulfide linkages that define a CHCH fold. In response to stress, the protein translocates from the mitochondrial intermembrane space to the nucleus where it binds to a highly conserved 13 nucleotide oxygen responsive element in the promoter of cytochrome oxidase 4I2, a subunit of the terminal enzyme of the electron transport chain. In concert with recombination signal sequence-binding protein J, binding of this protein activates the oxygen responsive element at four percent oxygen. In addition, it has been shown that this protein is a negative regulator of mitochondria-mediated apoptosis. In response to apoptotic stimuli, mitochondrial levels of this protein decrease, allowing BCL2-associated X protein to oligomerize and activate the caspase cascade. Pseudogenes of this gene are found on multiple chromosomes. Alternative splicing results in multiple transcript variants.

Anti-CHCHD2 antibody

STJ119079 100 µl
EUR 277.00

Polyclonal CHCHD2 Antibody (Center)

APR03413G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human CHCHD2 (Center). This antibody is tested and proven to work in the following applications:

CHCHD2 Polyclonal Conjugated Antibody

C29923 100ul
EUR 397.00


EF008625 96 Tests
EUR 689.00


ELI-50811h 96 Tests
EUR 824.00

Mouse Chchd2 ELISA KIT

ELI-50812m 96 Tests
EUR 865.00

Human CHCHD2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse CHCHD2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

CHCHD2 Recombinant Protein (Human)

RP006949 100 ug Ask for price

CHCHD2 Recombinant Protein (Human)

RP006952 100 ug Ask for price

CHCHD2 Recombinant Protein (Rat)

RP194777 100 ug Ask for price

CHCHD2 Recombinant Protein (Mouse)

RP123812 100 ug Ask for price

[KO Validated] CHCHD2 Rabbit pAb

A20007-100ul 100 ul
EUR 410.00

[KO Validated] CHCHD2 Rabbit pAb

A20007-200ul 200 ul
EUR 571.00

[KO Validated] CHCHD2 Rabbit pAb

A20007-20ul 20 ul
EUR 221.00

[KO Validated] CHCHD2 Rabbit pAb

A20007-50ul 50 ul
EUR 287.00

[KO Validated] CHCHD2 Rabbit pAb

A16645-100ul 100 ul
EUR 308.00

[KO Validated] CHCHD2 Rabbit pAb

A16645-200ul 200 ul
EUR 459.00

[KO Validated] CHCHD2 Rabbit pAb

A16645-20ul 20 ul
EUR 183.00

[KO Validated] CHCHD2 Rabbit pAb

A16645-50ul 50 ul
EUR 223.00

CHCHD2 ORF Vector (Human) (pORF)

ORF002317 1.0 ug DNA
EUR 95.00

CHCHD2 ORF Vector (Human) (pORF)

ORF002318 1.0 ug DNA
EUR 95.00

Chchd2 ORF Vector (Mouse) (pORF)

ORF041272 1.0 ug DNA
EUR 506.00

Chchd2 ORF Vector (Rat) (pORF)

ORF064927 1.0 ug DNA
EUR 506.00

CHCHD2 sgRNA CRISPR Lentivector set (Human)

K0441701 3 x 1.0 ug
EUR 339.00

Chchd2 sgRNA CRISPR Lentivector set (Rat)

K7229801 3 x 1.0 ug
EUR 339.00

Chchd2 sgRNA CRISPR Lentivector set (Mouse)

K3927401 3 x 1.0 ug
EUR 339.00

CHCHD2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0441702 1.0 ug DNA
EUR 154.00

CHCHD2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0441703 1.0 ug DNA
EUR 154.00

CHCHD2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0441704 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7229802 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7229803 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7229804 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3927402 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3927403 1.0 ug DNA
EUR 154.00

Chchd2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3927404 1.0 ug DNA
EUR 154.00

CHCHD2 Protein Vector (Human) (pPB-C-His)

PV009265 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPB-N-His)

PV009266 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPM-C-HA)

PV009267 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPM-C-His)

PV009268 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPB-C-His)

PV009269 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPB-N-His)

PV009270 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPM-C-HA)

PV009271 500 ng
EUR 329.00

CHCHD2 Protein Vector (Human) (pPM-C-His)

PV009272 500 ng
EUR 329.00

CHCHD2 Protein Vector (Rat) (pPB-C-His)

PV259706 500 ng
EUR 603.00

CHCHD2 Protein Vector (Rat) (pPB-N-His)

PV259707 500 ng
EUR 603.00

CHCHD2 Protein Vector (Rat) (pPM-C-HA)

PV259708 500 ng
EUR 603.00

CHCHD2 Protein Vector (Rat) (pPM-C-His)

PV259709 500 ng
EUR 603.00

CHCHD2 Protein Vector (Mouse) (pPB-C-His)

PV165086 500 ng
EUR 603.00

CHCHD2 Protein Vector (Mouse) (pPB-N-His)

PV165087 500 ng
EUR 603.00

CHCHD2 Protein Vector (Mouse) (pPM-C-HA)

PV165088 500 ng
EUR 603.00

CHCHD2 Protein Vector (Mouse) (pPM-C-His)

PV165089 500 ng
EUR 603.00

Chchd2 3'UTR Luciferase Stable Cell Line

TU202258 1.0 ml Ask for price

Chchd2 3'UTR GFP Stable Cell Line

TU153805 1.0 ml Ask for price

CHCHD2 3'UTR Luciferase Stable Cell Line

TU004318 1.0 ml
EUR 1394.00

Chchd2 3'UTR Luciferase Stable Cell Line

TU103805 1.0 ml Ask for price

CHCHD2 3'UTR GFP Stable Cell Line

TU054318 1.0 ml
EUR 1394.00

Chchd2 3'UTR GFP Stable Cell Line

TU252258 1.0 ml Ask for price

CHCHD2 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV629947 1.0 ug DNA
EUR 514.00

CHCHD2 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV629951 1.0 ug DNA
EUR 514.00

CHCHD2 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV629952 1.0 ug DNA
EUR 514.00

CHCHD2 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV708693 1.0 ug DNA
EUR 316.00

CHCHD2 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV708697 1.0 ug DNA
EUR 316.00

CHCHD2 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV708698 1.0 ug DNA
EUR 316.00

CHCHD2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0441705 3 x 1.0 ug
EUR 376.00

Chchd2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7229805 3 x 1.0 ug
EUR 376.00

Chchd2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3927405 3 x 1.0 ug
EUR 376.00

CHCHD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0441706 1.0 ug DNA
EUR 167.00

CHCHD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0441707 1.0 ug DNA
EUR 167.00

CHCHD2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0441708 1.0 ug DNA
EUR 167.00

Chchd2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7229806 1.0 ug DNA
EUR 167.00

Chchd2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7229807 1.0 ug DNA
EUR 167.00