DHPS

DHPS antibody
38852-100ul	SAB	100ul	EUR 252.00

DHPS antibody
10R-3834	Fitzgerald	100 ul	EUR 726.00
Description: Mouse monoclonal DHPS antibody

DHPS Antibody
1-CSB-PA002145	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

DHPS Antibody
DF3987	Affbiotech	200ul	EUR 304.00
Description: DHPS Antibody detects endogenous levels of total DHPS.

DHPS Antibody
1-CSB-PA006854LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DHPS antibody
70R-35966	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal DHPS antibody

DHPS antibody
70R-49659	Fitzgerald	100 ul	EUR 244.00
Description: Purified Polyclonal DHPS antibody

DHPS siRNA
20-abx901487	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

DHPS siRNA
20-abx914093	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

DHPS siRNA
20-abx914094	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

DHPS Antibody
ABD13069	Lifescience Market	100 ug	EUR 438.00

DHPS Antibody
ABD3987	Lifescience Market	100 ug	EUR 438.00

anti-DHPS
YF-PA11350	Abfrontier	50 ul	EUR 363.00
Description: Mouse polyclonal to DHPS

anti-DHPS
YF-PA11351	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to DHPS

Human DHPS Antibody
33066-05111	AssayPro	150 ug	EUR 261.00

DHPS Blocking Peptide
DF3987-BP	Affbiotech	1mg	EUR 195.00

DHPS Blocking Peptide
20-abx062534	Abbexa	EUR 272.00 EUR 411.00	0 1
Shipped within 5-10 working days.

DHPS Conjugated Antibody
C38852	SAB	100ul	EUR 397.00

DHPS cloning plasmid
CSB-CL006854HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1110 Sequence: atggaaggttccctggaacgggaggcgccagcgggggcgctggccgccgtgctaaagcacagctcgacgttgccgcccgaaagcacccaggtccggggctacgacttcaaccgcggtgtgaattaccgcgcactgctggaggccttcggcaccaccggcttccaagcaaccaact Show more
Description: A cloning plasmid for the DHPS gene.

DHPS cloning plasmid
CSB-CL006854HU2-10ug	Cusabio	10ug	EUR 420.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1110 Sequence: atggaaggttccctggaacgggaggcgccagcgggggcgctggccgccgtgctaaagcacagctcgacgttgccgcccgaaagcacccaggtccggggctacgacttcaaccgcggtgtgaattaccgcgcactgctggaggccttcggcaccaccggcttccaagcaaccaact Show more
Description: A cloning plasmid for the DHPS gene.

DHPS Rabbit pAb
A6367-100ul	Abclonal	100 ul	EUR 308.00

DHPS Rabbit pAb
A6367-200ul	Abclonal	200 ul	EUR 459.00

DHPS Rabbit pAb
A6367-20ul	Abclonal	20 ul	EUR 183.00

DHPS Rabbit pAb
A6367-50ul	Abclonal	50 ul	EUR 223.00

anti- DHPS antibody
FNab02368	FN Test	100µg	EUR 505.25
Immunogen: deoxyhypusine synthase Uniprot ID: P49366 Gene ID: 1725 Research Area: Metabolism
Description: Antibody raised against DHPS

Anti-DHPS antibody
PAab02368	Lifescience Market	100 ug	EUR 355.00

Anti-DHPS antibody
STJ28450	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a protein that is required for the formation of hypusine, a unique amino acid formed by the posttranslational modification of only one protein, eukaryotic translation initiation factor 5A. The encoded protein catalyzes the first step in hypusine formation by transferring the butylamine moiety of spermidine to a specific lysine residue of the eukaryotic translation initiation factor 5A precursor, forming an intermediate deoxyhypusine residue. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

DHPS Antibody, HRP conjugated
1-CSB-PA006854LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DHPS Antibody, FITC conjugated
1-CSB-PA006854LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DHPS Antibody, Biotin conjugated
1-CSB-PA006854LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DHPS protein (His tag)
80R-1271	Fitzgerald	100 ug	EUR 268.00
Description: Purified recombinant Human DHPS protein

Deoxyhypusine Synthase (DHPS) Antibody
20-abx009336	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx004867	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx119594	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx131328	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx131329	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Deoxyhypusine Synthase (DHPS) Antibody
abx029248-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
abx029248-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Rat DHPS shRNA Plasmid
20-abx988357	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx323696	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
20-abx333996	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody
abx232368-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Mouse DHPS shRNA Plasmid
20-abx983635	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human DHPS shRNA Plasmid
20-abx951195	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Anti-DHPS/Dhs Antibody
A30637	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal DHPS/Dhs Antibody. Validated in WB and tested in Human.

Recombinant Deoxyhypusine Synthase (DHPS)
4-RPC900Hu01	Cloud-Clone	EUR 350.88 EUR 197.00 EUR 1040.80 EUR 413.60 EUR 727.20 EUR 298.00 EUR 2452.00	0 1 2 3 4 5 6
Uniprot ID: P49366 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 44.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Deoxyhypusine Synthase expressed in: E.coli

Recombinant Deoxyhypusine Synthase (DHPS)
4-RPC900Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	0 1 2 3 4 5 6
Uniprot ID: Q3TXU5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 44.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Deoxyhypusine Synthase expressed in: E.coli

DHPS Recombinant Protein (Human)
RP009247	ABM	100 ug	Ask for price

DHPS Recombinant Protein (Human)
RP009250	ABM	100 ug	Ask for price

DHPS Recombinant Protein (Rat)
RP197978	ABM	100 ug	Ask for price

DHPS Recombinant Protein (Mouse)
RP128924	ABM	100 ug	Ask for price

Human DHPS Antibody (Biotin Conjugate)
33066-05121	AssayPro	150 ug	EUR 369.00

Polyclonal DHPS Antibody (aa51-100)
APR03327G	Leading Biology	0.05ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS (aa51-100). This antibody is tested and proven to work in the following applications:

Polyclonal DHPS Antibody (N-term)
APR04168G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS (N-term). This antibody is tested and proven to work in the following applications:

Deoxyhypusine Synthase (DHPS) Antibody (HRP)
20-abx335304	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody (FITC)
20-abx335305	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody (Biotin)
20-abx335306	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Human Deoxyhypusine Synthase (DHPS) Protein
20-abx650234	Abbexa	EUR 495.00 EUR 244.00 EUR 1414.00 EUR 578.00 EUR 356.00	0 1 2 3 4
Shipped within 5-7 working days.

Mouse Deoxyhypusine Synthase (DHPS) Protein
20-abx650235	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	0 1 2 3 4
Shipped within 5-7 working days.

Dhps ORF Vector (Rat) (pORF)
ORF065994	ABM	1.0 ug DNA	EUR 506.00

DHPS ORF Vector (Human) (pORF)
ORF003083	ABM	1.0 ug DNA	EUR 95.00

DHPS ORF Vector (Human) (pORF)
ORF003084	ABM	1.0 ug DNA	EUR 95.00

Dhps ORF Vector (Mouse) (pORF)
ORF042976	ABM	1.0 ug DNA	EUR 506.00

DHPS ELISA Kit (Human) (OKWB00169)
OKWB00169	Aviva Systems Biology	96 Wells	EUR 572.00
Description: Description of target: Catalyzes the NAD-dependent oxidative cleavage of spermidine and the subsequent transfer of the butylamine moiety of spermidine to the epsilon-amino group of a specific lysine residue of the eIF-5A precursor protein to form the intermediate deoxyhypusine residue. ;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Human DHPS AssayLite Antibody (FITC Conjugate)
33066-05141	AssayPro	150 ug	EUR 428.00

Human DHPS AssayLite Antibody (RPE Conjugate)
33066-05151	AssayPro	150 ug	EUR 428.00

Human DHPS AssayLite Antibody (APC Conjugate)
33066-05161	AssayPro	150 ug	EUR 428.00

Human DHPS AssayLite Antibody (PerCP Conjugate)
33066-05171	AssayPro	150 ug	EUR 471.00

Polyclonal DHPS antibody - N-terminal region
APR01465G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS - N-terminal region. This antibody is tested and proven to work in the following applications:

Human Deoxyhypusine synthase, DHPS ELISA KIT
ELI-08955h	Lifescience Market	96 Tests	EUR 824.00