In den Nachrichten


DHPS antibody

38852-100ul 100ul
EUR 252.00

DHPS antibody

10R-3834 100 ul
EUR 726.00
Description: Mouse monoclonal DHPS antibody

DHPS Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

DHPS Antibody

DF3987 200ul
EUR 304.00
Description: DHPS Antibody detects endogenous levels of total DHPS.

DHPS Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

DHPS antibody

70R-35966 100 ug
EUR 327.00
Description: Rabbit polyclonal DHPS antibody

DHPS antibody

70R-49659 100 ul
EUR 244.00
Description: Purified Polyclonal DHPS antibody


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

DHPS Antibody

ABD13069 100 ug
EUR 438.00

DHPS Antibody

ABD3987 100 ug
EUR 438.00


YF-PA11350 50 ul
EUR 363.00
Description: Mouse polyclonal to DHPS


YF-PA11351 50 ug
EUR 363.00
Description: Mouse polyclonal to DHPS

Human DHPS Antibody

33066-05111 150 ug
EUR 261.00

DHPS Blocking Peptide

DF3987-BP 1mg
EUR 195.00

DHPS Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

DHPS Conjugated Antibody

C38852 100ul
EUR 397.00

DHPS cloning plasmid

CSB-CL006854HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atggaaggttccctggaacgggaggcgccagcgggggcgctggccgccgtgctaaagcacagctcgacgttgccgcccgaaagcacccaggtccggggctacgacttcaaccgcggtgtgaattaccgcgcactgctggaggccttcggcaccaccggcttccaagcaaccaact
  • Show more
Description: A cloning plasmid for the DHPS gene.

DHPS cloning plasmid

CSB-CL006854HU2-10ug 10ug
EUR 420.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1110
  • Sequence: atggaaggttccctggaacgggaggcgccagcgggggcgctggccgccgtgctaaagcacagctcgacgttgccgcccgaaagcacccaggtccggggctacgacttcaaccgcggtgtgaattaccgcgcactgctggaggccttcggcaccaccggcttccaagcaaccaact
  • Show more
Description: A cloning plasmid for the DHPS gene.

DHPS Rabbit pAb

A6367-100ul 100 ul
EUR 308.00

DHPS Rabbit pAb

A6367-200ul 200 ul
EUR 459.00

DHPS Rabbit pAb

A6367-20ul 20 ul
EUR 183.00

DHPS Rabbit pAb

A6367-50ul 50 ul
EUR 223.00

anti- DHPS antibody

FNab02368 100µg
EUR 505.25
  • Immunogen: deoxyhypusine synthase
  • Uniprot ID: P49366
  • Gene ID: 1725
  • Research Area: Metabolism
Description: Antibody raised against DHPS

Anti-DHPS antibody

PAab02368 100 ug
EUR 355.00

Anti-DHPS antibody

STJ28450 100 µl
EUR 277.00
Description: This gene encodes a protein that is required for the formation of hypusine, a unique amino acid formed by the posttranslational modification of only one protein, eukaryotic translation initiation factor 5A. The encoded protein catalyzes the first step in hypusine formation by transferring the butylamine moiety of spermidine to a specific lysine residue of the eukaryotic translation initiation factor 5A precursor, forming an intermediate deoxyhypusine residue. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

DHPS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

DHPS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

DHPS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DHPS. Recognizes DHPS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

DHPS protein (His tag)

80R-1271 100 ug
EUR 268.00
Description: Purified recombinant Human DHPS protein

Deoxyhypusine Synthase (DHPS) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Deoxyhypusine Synthase (DHPS) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Deoxyhypusine Synthase (DHPS) Antibody

abx029248-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody

abx029248-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Rat DHPS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Deoxyhypusine Synthase (DHPS) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody

abx232368-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Mouse DHPS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human DHPS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Anti-DHPS/Dhs Antibody

A30637 100ul
EUR 397.00
Description: Rabbit Polyclonal DHPS/Dhs Antibody. Validated in WB and tested in Human.

Recombinant Deoxyhypusine Synthase (DHPS)

  • EUR 350.88
  • EUR 197.00
  • EUR 1040.80
  • EUR 413.60
  • EUR 727.20
  • EUR 298.00
  • EUR 2452.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: P49366
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Deoxyhypusine Synthase expressed in: E.coli

Recombinant Deoxyhypusine Synthase (DHPS)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • 5
  • 6
  • Uniprot ID: Q3TXU5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Deoxyhypusine Synthase expressed in: E.coli

DHPS Recombinant Protein (Human)

RP009247 100 ug Ask for price

DHPS Recombinant Protein (Human)

RP009250 100 ug Ask for price

DHPS Recombinant Protein (Rat)

RP197978 100 ug Ask for price

DHPS Recombinant Protein (Mouse)

RP128924 100 ug Ask for price

Human DHPS Antibody (Biotin Conjugate)

33066-05121 150 ug
EUR 369.00

Polyclonal DHPS Antibody (aa51-100)

APR03327G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS (aa51-100). This antibody is tested and proven to work in the following applications:

Polyclonal DHPS Antibody (N-term)

APR04168G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS (N-term). This antibody is tested and proven to work in the following applications:

Deoxyhypusine Synthase (DHPS) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Deoxyhypusine Synthase (DHPS) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Human Deoxyhypusine Synthase (DHPS) Protein

  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Mouse Deoxyhypusine Synthase (DHPS) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Dhps ORF Vector (Rat) (pORF)

ORF065994 1.0 ug DNA
EUR 506.00

DHPS ORF Vector (Human) (pORF)

ORF003083 1.0 ug DNA
EUR 95.00

DHPS ORF Vector (Human) (pORF)

ORF003084 1.0 ug DNA
EUR 95.00

Dhps ORF Vector (Mouse) (pORF)

ORF042976 1.0 ug DNA
EUR 506.00

DHPS ELISA Kit (Human) (OKWB00169)

OKWB00169 96 Wells
EUR 572.00
Description: Description of target: Catalyzes the NAD-dependent oxidative cleavage of spermidine and the subsequent transfer of the butylamine moiety of spermidine to the epsilon-amino group of a specific lysine residue of the eIF-5A precursor protein to form the intermediate deoxyhypusine residue. ;Species reactivity: Human;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Human DHPS AssayLite Antibody (FITC Conjugate)

33066-05141 150 ug
EUR 428.00

Human DHPS AssayLite Antibody (RPE Conjugate)

33066-05151 150 ug
EUR 428.00

Human DHPS AssayLite Antibody (APC Conjugate)

33066-05161 150 ug
EUR 428.00

Human DHPS AssayLite Antibody (PerCP Conjugate)

33066-05171 150 ug
EUR 471.00

Polyclonal DHPS antibody - N-terminal region

APR01465G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DHPS - N-terminal region. This antibody is tested and proven to work in the following applications:

Human Deoxyhypusine synthase, DHPS ELISA KIT

ELI-08955h 96 Tests
EUR 824.00