DNAJC19

DNAJC19 siRNA
20-abx914381	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

DNAJC19 antibody
70R-9901	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal DNAJC19 antibody

DNAJC19 antibody
70R-16887	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal DNAJC19 antibody

DNAJC19 Antibody
DF12384	Affbiotech	200ul	EUR 304.00
Description: DNAJC19 antibody detects endogenous levels of DNAJC19.

DNAJC19 Antibody
1-CSB-PA007026GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DNAJC19 Antibody
1-CSB-PA853400ESR1HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

DNAJC19 Antibody
1-CSB-PA853400ESR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-DNAJC19
YF-PA22195	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to DNAJC19

anti-DNAJC19
YF-PA26874	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to DNAJC19

anti- DNAJC19 antibody
FNab02462	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: DnaJ (Hsp40) homolog, subfamily C, member 19 Uniprot ID: Q96DA6 Gene ID: 131118 Research Area: Metabolism
Description: Antibody raised against DNAJC19

DNAJC19 Rabbit pAb
A5146-100ul	Abclonal	100 ul	EUR 308.00

DNAJC19 Rabbit pAb
A5146-200ul	Abclonal	200 ul	EUR 459.00

DNAJC19 Rabbit pAb
A5146-20ul	Abclonal	20 ul	EUR 183.00

DNAJC19 Rabbit pAb
A5146-50ul	Abclonal	50 ul	EUR 223.00

DNAJC19 Rabbit pAb
A14961-100ul	Abclonal	100 ul	EUR 308.00

DNAJC19 Rabbit pAb
A14961-200ul	Abclonal	200 ul	EUR 459.00

DNAJC19 Rabbit pAb
A14961-20ul	Abclonal	20 ul	EUR 183.00

DNAJC19 Rabbit pAb
A14961-50ul	Abclonal	50 ul	EUR 223.00

DNAJC19 Blocking Peptide
33R-5000	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DNAJC19 antibody, catalog no. 70R-9901

DNAJC19 Polyclonal Antibody
30639-100ul	SAB	100ul	EUR 252.00

DNAJC19 Polyclonal Antibody
30639-50ul	SAB	50ul	EUR 187.00

DNAJC19 Polyclonal Antibody
28780-100ul	SAB	100ul	EUR 252.00

DNAJC19 Polyclonal Antibody
28780-50ul	SAB	50ul	EUR 187.00

DNAJC19 Blocking Peptide
DF12384-BP	Affbiotech	1mg	EUR 195.00

DNAJC19 cloning plasmid
CSB-CL853400HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 351 Sequence: atggccagtacagtggtagcagttggactgaccattgctgctgcaggatttgcaggccgttacgttttgcaagccatgaagcatatggagcctcaagtaaaacaagtttttcaaagcctaccaaaatctgccttcagtggtggctattatagaggtgggtttgaacccaaaatgac Show more
Description: A cloning plasmid for the DNAJC19 gene.

Anti-DNAJC19 antibody
PAab02462	Lifescience Market	100 ug	EUR 355.00

pCMV-SPORT6-DNAJC19
PVT12875	Lifescience Market	2 ug	EUR 391.00

Anti-DNAJC19 antibody
STJ27128	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is thought to be part of a complex involved in the ATP-dependent transport of transit peptide-containing proteins from the inner cell membrane to the mitochondrial matrix. Defects in this gene are a cause of 3-methylglutaconic aciduria type 5 (MGA5), also known as dilated cardiomyopathy with ataxia (DCMA). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 2, 6, 10, 14 and 19.

Anti-DNAJC19 antibody
STJ117160	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is thought to be part of a complex involved in the ATP-dependent transport of transit peptide-containing proteins from the inner cell membrane to the mitochondrial matrix. Defects in this gene are a cause of 3-methylglutaconic aciduria type 5 (MGA5), also known as dilated cardiomyopathy with ataxia (DCMA). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 2, 6, 10, 14 and 19.

Anti-DNAJC19 (3H4)
YF-MA19842	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to DNAJC19

DNAJC19 Polyclonal Conjugated Antibody
C30639	SAB	100ul	EUR 397.00

DNAJC19 Polyclonal Conjugated Antibody
C28780	SAB	100ul	EUR 397.00

Mouse DNAJC19 shRNA Plasmid
20-abx976284	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human DNAJC19 shRNA Plasmid
20-abx965055	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human DNAJC19 ELISA KIT
ELI-17157h	Lifescience Market	96 Tests	EUR 824.00

DNAJC19 ELISA KIT|Human
EF009170	Lifescience Market	96 Tests	EUR 689.00

Mouse Dnajc19 ELISA KIT
ELI-52049m	Lifescience Market	96 Tests	EUR 865.00

Bovine DNAJC19 ELISA KIT
ELI-29215b	Lifescience Market	96 Tests	EUR 928.00

DNAJC19 protein (His tag)
80R-1669	Fitzgerald	100 ug	EUR 305.00
Description: Purified recombinant Human DNAJC19 protein

DNAJC19 Recombinant Protein (Human)
RP009589	ABM	100 ug	Ask for price

DNAJC19 Recombinant Protein (Mouse)
RP129563	ABM	100 ug	Ask for price

DNAJC19 Recombinant Protein (Mouse)
RP129566	ABM	100 ug	Ask for price

DNAJC19 ORF Vector (Human) (pORF)
ORF003197	ABM	1.0 ug DNA	EUR 95.00

Dnajc19 ORF Vector (Mouse) (pORF)
ORF043189	ABM	1.0 ug DNA	EUR 506.00

Dnajc19 ORF Vector (Mouse) (pORF)
ORF043190	ABM	1.0 ug DNA	EUR 506.00

[One Step] DNAJC19 Antibody Kit
RK05644	Abclonal	50 ul	EUR 240.00

DNAJC19 ELISA Kit (Human) (OKCA00730)
OKCA00730	Aviva Systems Biology	96 Wells	EUR 833.00
Description: Description of target: Probable component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner. May act as a co-chaperone that stimulate the ATP-dependent activity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL

Polyclonal Dnajc19 antibody - N-terminal region
APR11767G	Leading Biology	0.05mg	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dnajc19 - N-terminal region. This antibody is tested and proven to work in the following applications:

DNAJC19 sgRNA CRISPR Lentivector set (Human)
K0616701	ABM	3 x 1.0 ug	EUR 339.00

Dnajc19 sgRNA CRISPR Lentivector set (Mouse)
K4700601	ABM	3 x 1.0 ug	EUR 339.00

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 1)
K0616702	ABM	1.0 ug DNA	EUR 154.00

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 2)
K0616703	ABM	1.0 ug DNA	EUR 154.00

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 3)
K0616704	ABM	1.0 ug DNA	EUR 154.00

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4700602	ABM	1.0 ug DNA	EUR 154.00

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4700603	ABM	1.0 ug DNA	EUR 154.00

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4700604	ABM	1.0 ug DNA	EUR 154.00

DNAJC19 Protein Vector (Mouse) (pPB-C-His)
PV172754	ABM	500 ng	EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPB-N-His)
PV172755	ABM	500 ng	EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPM-C-HA)
PV172756	ABM	500 ng	EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPM-C-His)
PV172757	ABM	500 ng	EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPB-C-His)
PV172758	ABM	500 ng	EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPB-N-His)
PV172759	ABM	500 ng	EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPM-C-HA)
PV172760	ABM	500 ng	EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPM-C-His)
PV172761	ABM	500 ng	EUR 603.00

DNAJC19 Protein Vector (Human) (pPB-C-His)
PV012785	ABM	500 ng	EUR 329.00

DNAJC19 Protein Vector (Human) (pPB-N-His)
PV012786	ABM	500 ng	EUR 329.00

DNAJC19 Protein Vector (Human) (pPM-C-HA)
PV012787	ABM	500 ng	EUR 329.00

DNAJC19 Protein Vector (Human) (pPM-C-His)
PV012788	ABM	500 ng	EUR 329.00

Dnajc19 3'UTR GFP Stable Cell Line
TU155269	ABM	1.0 ml	Ask for price

DNAJC19 3'UTR Luciferase Stable Cell Line
TU006160	ABM	1.0 ml	EUR 1394.00