DNAJC19 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

DNAJC19 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

DNAJC19 Antibody

DF12384 200ul
EUR 304.00
Description: DNAJC19 antibody detects endogenous levels of DNAJC19.

DNAJC19 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DNAJC19 antibody

70R-9901 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal DNAJC19 antibody


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


YF-PA22195 50 ug
EUR 363.00
Description: Mouse polyclonal to DNAJC19


YF-PA26874 50 ul
EUR 334.00
Description: Mouse polyclonal to DNAJC19

DNAJC19 Polyclonal Antibody

30639-100ul 100ul
EUR 252.00

DNAJC19 Polyclonal Antibody

30639-50ul 50ul
EUR 187.00

DNAJC19 Polyclonal Antibody

28780-100ul 100ul
EUR 252.00

DNAJC19 Polyclonal Antibody

28780-50ul 50ul
EUR 187.00

DNAJC19 Blocking Peptide

33R-5000 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DNAJC19 antibody, catalog no. 70R-9901

DNAJC19 Blocking Peptide

DF12384-BP 1mg
EUR 195.00

DNAJC19 cloning plasmid

CSB-CL853400HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 351
  • Sequence: atggccagtacagtggtagcagttggactgaccattgctgctgcaggatttgcaggccgttacgttttgcaagccatgaagcatatggagcctcaagtaaaacaagtttttcaaagcctaccaaaatctgccttcagtggtggctattatagaggtgggtttgaacccaaaatgac
  • Show more
Description: A cloning plasmid for the DNAJC19 gene.

DNAJC19 Rabbit pAb

A5146-100ul 100 ul
EUR 308.00

DNAJC19 Rabbit pAb

A5146-200ul 200 ul
EUR 459.00

DNAJC19 Rabbit pAb

A5146-20ul 20 ul
EUR 183.00

DNAJC19 Rabbit pAb

A5146-50ul 50 ul
EUR 223.00

DNAJC19 Rabbit pAb

A14961-100ul 100 ul
EUR 308.00

DNAJC19 Rabbit pAb

A14961-200ul 200 ul
EUR 459.00

DNAJC19 Rabbit pAb

A14961-20ul 20 ul
EUR 183.00

DNAJC19 Rabbit pAb

A14961-50ul 50 ul
EUR 223.00

anti- DNAJC19 antibody

FNab02462 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: DnaJ (Hsp40) homolog, subfamily C, member 19
  • Uniprot ID: Q96DA6
  • Gene ID: 131118
  • Research Area: Metabolism
Description: Antibody raised against DNAJC19

Anti-DNAJC19 antibody

PAab02462 100 ug
EUR 355.00


PVT12875 2 ug
EUR 391.00

Anti-DNAJC19 antibody

STJ27128 100 µl
EUR 277.00
Description: The protein encoded by this gene is thought to be part of a complex involved in the ATP-dependent transport of transit peptide-containing proteins from the inner cell membrane to the mitochondrial matrix. Defects in this gene are a cause of 3-methylglutaconic aciduria type 5 (MGA5), also known as dilated cardiomyopathy with ataxia (DCMA). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 2, 6, 10, 14 and 19.

Anti-DNAJC19 antibody

STJ117160 100 µl
EUR 277.00
Description: The protein encoded by this gene is thought to be part of a complex involved in the ATP-dependent transport of transit peptide-containing proteins from the inner cell membrane to the mitochondrial matrix. Defects in this gene are a cause of 3-methylglutaconic aciduria type 5 (MGA5), also known as dilated cardiomyopathy with ataxia (DCMA). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 2, 6, 10, 14 and 19.

Anti-DNAJC19 (3H4)

YF-MA19842 100 ug
EUR 363.00
Description: Mouse monoclonal to DNAJC19

DNAJC19 protein (His tag)

80R-1669 100 ug
EUR 305.00
Description: Purified recombinant Human DNAJC19 protein


ELI-17157h 96 Tests
EUR 824.00


ELI-29215b 96 Tests
EUR 928.00


EF009170 96 Tests
EUR 689.00

Mouse Dnajc19 ELISA KIT

ELI-52049m 96 Tests
EUR 865.00

Mouse DNAJC19 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human DNAJC19 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

DNAJC19 Polyclonal Conjugated Antibody

C28780 100ul
EUR 397.00

DNAJC19 Polyclonal Conjugated Antibody

C30639 100ul
EUR 397.00

DNAJC19 Recombinant Protein (Human)

RP009589 100 ug Ask for price

DNAJC19 Recombinant Protein (Mouse)

RP129563 100 ug Ask for price

DNAJC19 Recombinant Protein (Mouse)

RP129566 100 ug Ask for price

DNAJC19 ORF Vector (Human) (pORF)

ORF003197 1.0 ug DNA
EUR 95.00

Dnajc19 ORF Vector (Mouse) (pORF)

ORF043189 1.0 ug DNA
EUR 506.00

Dnajc19 ORF Vector (Mouse) (pORF)

ORF043190 1.0 ug DNA
EUR 506.00

[One Step] DNAJC19 Antibody Kit

RK05644 50 ul
EUR 240.00

DNAJC19 ELISA Kit (Human) (OKCA00730)

OKCA00730 96 Wells
EUR 833.00
Description: Description of target: Probable component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner. May act as a co-chaperone that stimulate the ATP-dependent activity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL

Polyclonal Dnajc19 antibody - N-terminal region

APR11767G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dnajc19 - N-terminal region. This antibody is tested and proven to work in the following applications:

DNAJC19 sgRNA CRISPR Lentivector set (Human)

K0616701 3 x 1.0 ug
EUR 339.00

Dnajc19 sgRNA CRISPR Lentivector set (Mouse)

K4700601 3 x 1.0 ug
EUR 339.00

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 1)

K0616702 1.0 ug DNA
EUR 154.00

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 2)

K0616703 1.0 ug DNA
EUR 154.00

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 3)

K0616704 1.0 ug DNA
EUR 154.00

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4700602 1.0 ug DNA
EUR 154.00

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4700603 1.0 ug DNA
EUR 154.00

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4700604 1.0 ug DNA
EUR 154.00

DNAJC19 Protein Vector (Mouse) (pPB-C-His)

PV172754 500 ng
EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPB-N-His)

PV172755 500 ng
EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPM-C-HA)

PV172756 500 ng
EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPM-C-His)

PV172757 500 ng
EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPB-C-His)

PV172758 500 ng
EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPB-N-His)

PV172759 500 ng
EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPM-C-HA)

PV172760 500 ng
EUR 603.00

DNAJC19 Protein Vector (Mouse) (pPM-C-His)

PV172761 500 ng
EUR 603.00

DNAJC19 Protein Vector (Human) (pPB-C-His)

PV012785 500 ng
EUR 329.00

DNAJC19 Protein Vector (Human) (pPB-N-His)

PV012786 500 ng
EUR 329.00

DNAJC19 Protein Vector (Human) (pPM-C-HA)

PV012787 500 ng
EUR 329.00

DNAJC19 Protein Vector (Human) (pPM-C-His)

PV012788 500 ng
EUR 329.00

Dnajc19 3'UTR GFP Stable Cell Line

TU155269 1.0 ml Ask for price

Dnajc19 3'UTR Luciferase Stable Cell Line

TU105269 1.0 ml Ask for price