DNAJC19

DNAJC19 siRNA
20-abx914381
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DNAJC19 antibody
70R-9901 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal DNAJC19 antibody

DNAJC19 antibody
70R-16887 50 ul
EUR 435
Description: Rabbit polyclonal DNAJC19 antibody

DNAJC19 Antibody
DF12384 200ul
EUR 304
Description: DNAJC19 antibody detects endogenous levels of DNAJC19.

DNAJC19 Antibody
1-CSB-PA007026GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DNAJC19 Antibody
1-CSB-PA853400ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IP; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IP:1:200-1:2000

DNAJC19 Antibody
1-CSB-PA853400ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against DNAJC19. Recognizes DNAJC19 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-DNAJC19
YF-PA22195 50 ug
EUR 363
Description: Mouse polyclonal to DNAJC19

anti-DNAJC19
YF-PA26874 50 ul
EUR 334
Description: Mouse polyclonal to DNAJC19

anti- DNAJC19 antibody
FNab02462 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: DnaJ (Hsp40) homolog, subfamily C, member 19
  • Uniprot ID: Q96DA6
  • Gene ID: 131118
  • Research Area: Metabolism
Description: Antibody raised against DNAJC19

DNAJC19 Rabbit pAb
A5146-100ul 100 ul
EUR 308

DNAJC19 Rabbit pAb
A5146-200ul 200 ul
EUR 459

DNAJC19 Rabbit pAb
A5146-20ul 20 ul
EUR 183

DNAJC19 Rabbit pAb
A5146-50ul 50 ul
EUR 223

DNAJC19 Rabbit pAb
A14961-100ul 100 ul
EUR 308

DNAJC19 Rabbit pAb
A14961-200ul 200 ul
EUR 459

DNAJC19 Rabbit pAb
A14961-20ul 20 ul
EUR 183

DNAJC19 Rabbit pAb
A14961-50ul 50 ul
EUR 223

DNAJC19 Blocking Peptide
33R-5000 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DNAJC19 antibody, catalog no. 70R-9901

DNAJC19 Polyclonal Antibody
30639-100ul 100ul
EUR 252

DNAJC19 Polyclonal Antibody
30639-50ul 50ul
EUR 187

DNAJC19 Polyclonal Antibody
28780-100ul 100ul
EUR 252

DNAJC19 Polyclonal Antibody
28780-50ul 50ul
EUR 187

DNAJC19 Blocking Peptide
DF12384-BP 1mg
EUR 195

DNAJC19 cloning plasmid
CSB-CL853400HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 351
  • Sequence: atggccagtacagtggtagcagttggactgaccattgctgctgcaggatttgcaggccgttacgttttgcaagccatgaagcatatggagcctcaagtaaaacaagtttttcaaagcctaccaaaatctgccttcagtggtggctattatagaggtgggtttgaacccaaaatgac
  • Show more
Description: A cloning plasmid for the DNAJC19 gene.

Anti-DNAJC19 antibody
PAab02462 100 ug
EUR 355

pCMV-SPORT6-DNAJC19
PVT12875 2 ug
EUR 391

Anti-DNAJC19 antibody
STJ27128 100 µl
EUR 277
Description: The protein encoded by this gene is thought to be part of a complex involved in the ATP-dependent transport of transit peptide-containing proteins from the inner cell membrane to the mitochondrial matrix. Defects in this gene are a cause of 3-methylglutaconic aciduria type 5 (MGA5), also known as dilated cardiomyopathy with ataxia (DCMA). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 2, 6, 10, 14 and 19.

Anti-DNAJC19 antibody
STJ117160 100 µl
EUR 277
Description: The protein encoded by this gene is thought to be part of a complex involved in the ATP-dependent transport of transit peptide-containing proteins from the inner cell membrane to the mitochondrial matrix. Defects in this gene are a cause of 3-methylglutaconic aciduria type 5 (MGA5), also known as dilated cardiomyopathy with ataxia (DCMA). Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1, 2, 6, 10, 14 and 19.

Anti-DNAJC19 (3H4)
YF-MA19842 100 ug
EUR 363
Description: Mouse monoclonal to DNAJC19

DNAJC19 Polyclonal Conjugated Antibody
C30639 100ul
EUR 397

DNAJC19 Polyclonal Conjugated Antibody
C28780 100ul
EUR 397

Mouse DNAJC19 shRNA Plasmid
20-abx976284
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DNAJC19 shRNA Plasmid
20-abx965055
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human DNAJC19 ELISA KIT
ELI-17157h 96 Tests
EUR 824

DNAJC19 ELISA KIT|Human
EF009170 96 Tests
EUR 689

Mouse Dnajc19 ELISA KIT
ELI-52049m 96 Tests
EUR 865

Bovine DNAJC19 ELISA KIT
ELI-29215b 96 Tests
EUR 928

DNAJC19 protein (His tag)
80R-1669 100 ug
EUR 305
Description: Purified recombinant Human DNAJC19 protein

DNAJC19 Recombinant Protein (Human)
RP009589 100 ug Ask for price

DNAJC19 Recombinant Protein (Mouse)
RP129563 100 ug Ask for price

DNAJC19 Recombinant Protein (Mouse)
RP129566 100 ug Ask for price

DNAJC19 ORF Vector (Human) (pORF)
ORF003197 1.0 ug DNA
EUR 95

Dnajc19 ORF Vector (Mouse) (pORF)
ORF043189 1.0 ug DNA
EUR 506

Dnajc19 ORF Vector (Mouse) (pORF)
ORF043190 1.0 ug DNA
EUR 506

[One Step] DNAJC19 Antibody Kit
RK05644 50 ul
EUR 240

DNAJC19 ELISA Kit (Human) (OKCA00730)
OKCA00730 96 Wells
EUR 833
Description: Description of target: Probable component of the PAM complex, a complex required for the translocation of transit peptide-containing proteins from the inner membrane into the mitochondrial matrix in an ATP-dependent manner. May act as a co-chaperone that stimulate the ATP-dependent activity.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 7 pg/mL

Polyclonal Dnajc19 antibody - N-terminal region
APR11767G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Dnajc19 - N-terminal region. This antibody is tested and proven to work in the following applications:

DNAJC19 sgRNA CRISPR Lentivector set (Human)
K0616701 3 x 1.0 ug
EUR 339

Dnajc19 sgRNA CRISPR Lentivector set (Mouse)
K4700601 3 x 1.0 ug
EUR 339

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 1)
K0616702 1.0 ug DNA
EUR 154

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 2)
K0616703 1.0 ug DNA
EUR 154

DNAJC19 sgRNA CRISPR Lentivector (Human) (Target 3)
K0616704 1.0 ug DNA
EUR 154

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4700602 1.0 ug DNA
EUR 154

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4700603 1.0 ug DNA
EUR 154

Dnajc19 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4700604 1.0 ug DNA
EUR 154

DNAJC19 Protein Vector (Mouse) (pPB-C-His)
PV172754 500 ng
EUR 603

DNAJC19 Protein Vector (Mouse) (pPB-N-His)
PV172755 500 ng
EUR 603

DNAJC19 Protein Vector (Mouse) (pPM-C-HA)
PV172756 500 ng
EUR 603

DNAJC19 Protein Vector (Mouse) (pPM-C-His)
PV172757 500 ng
EUR 603

DNAJC19 Protein Vector (Mouse) (pPB-C-His)
PV172758 500 ng
EUR 603

DNAJC19 Protein Vector (Mouse) (pPB-N-His)
PV172759 500 ng
EUR 603

DNAJC19 Protein Vector (Mouse) (pPM-C-HA)
PV172760 500 ng
EUR 603

DNAJC19 Protein Vector (Mouse) (pPM-C-His)
PV172761 500 ng
EUR 603

DNAJC19 Protein Vector (Human) (pPB-C-His)
PV012785 500 ng
EUR 329

DNAJC19 Protein Vector (Human) (pPB-N-His)
PV012786 500 ng
EUR 329

DNAJC19 Protein Vector (Human) (pPM-C-HA)
PV012787 500 ng
EUR 329

DNAJC19 Protein Vector (Human) (pPM-C-His)
PV012788 500 ng
EUR 329

Dnajc19 3'UTR GFP Stable Cell Line
TU155269 1.0 ml Ask for price

DNAJC19 3'UTR Luciferase Stable Cell Line
TU006160 1.0 ml
EUR 1394