EIF1AX

EIF1AX siRNA

20-abx915123
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EIF1AX antibody

70R-5014 50 ug
EUR 467.00
Description: Rabbit polyclonal EIF1AX antibody raised against the middle region of EIF1AX

EIF1AX Antibody

47437-100ul 100ul
EUR 252.00

EIF1AX antibody

70R-17031 50 ul
EUR 435.00
Description: Rabbit polyclonal EIF1AX antibody

EIF1AX Antibody

DF12973 200ul
EUR 304.00
Description: EIF1AX Antibody detects endogenous levels of EIF1AX.

EIF1AX Antibody

1-CSB-PA007506DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF1AX. Recognizes EIF1AX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF1AX Antibody

1-CSB-PA007506GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF1AX. Recognizes EIF1AX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EIF1AX Conjugated Antibody

C47437 100ul
EUR 397.00

EIF1AX cloning plasmid

CSB-CL007506HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 435
  • Sequence: atgcccaagaataaaggtaaaggaggtaaaaacagacgcaggggtaagaatgagaatgaatctgaaaaaagagaactggtattcaaagaggatggtcaggagtatgctcaggtaatcaaaatgttgggaaatggacggctagaagcaatgtgtttcgatggtgtaaagaggttatg
  • Show more
Description: A cloning plasmid for the EIF1AX gene.

anti- EIF1AX antibody

FNab02685 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: eukaryotic translation initiation factor 1A, X-linked
  • Uniprot ID: P47813
  • Gene ID: 1964
  • Research Area: Metabolism
Description: Antibody raised against EIF1AX

anti- EIF1AX antibody

FNab02686 100µg
EUR 505.25
  • Immunogen: eukaryotic translation initiation factor 1A, X-linked
  • Uniprot ID: P47813
  • Gene ID: 1964
  • Research Area: Metabolism
Description: Antibody raised against EIF1AX

EIF1AX Rabbit pAb

A5917-100ul 100 ul
EUR 308.00

EIF1AX Rabbit pAb

A5917-200ul 200 ul
EUR 459.00

EIF1AX Rabbit pAb

A5917-20ul 20 ul
EUR 183.00

EIF1AX Rabbit pAb

A5917-50ul 50 ul
EUR 223.00

EIF1AX Blocking Peptide

33R-4747 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF1AX antibody, catalog no. 70R-5014

EIF1AX Blocking Peptide

DF12973-BP 1mg
EUR 195.00

Anti-EIF1AX antibody

PAab02685 100 ug
EUR 386.00

Anti-EIF1AX antibody

PAab02686 100 ug
EUR 355.00

pCMV-SPORT6-EIF1AX

PVT14133 2 ug
EUR 391.00

Anti-EIF1AX antibody

STJ27713 100 µl
EUR 277.00
Description: This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA.

Mouse EIF1AX shRNA Plasmid

20-abx975488
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human EIF1AX ELISA KIT

ELI-08423h 96 Tests
EUR 824.00

EIF1AX ELISA KIT|Human

EF009324 96 Tests
EUR 689.00

Human EIF1AX shRNA Plasmid

20-abx951359
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EIF1AX protein (His tag)

80R-1475 100 ug
EUR 305.00
Description: Purified recombinant Human EIF1AX protein

EIF1AX Recombinant Protein (Human)

RP010342 100 ug Ask for price

EIF1AX Recombinant Protein (Rat)

RP199280 100 ug Ask for price

EIF1AX Recombinant Protein (Mouse)

RP131189 100 ug Ask for price

EIF1AX ORF Vector (Human) (pORF)

ORF003448 1.0 ug DNA
EUR 95.00

Eif1ax ORF Vector (Rat) (pORF)

ORF066428 1.0 ug DNA
EUR 506.00

Eif1ax ORF Vector (Mouse) (pORF)

ORF043731 1.0 ug DNA
EUR 506.00

EIF1AX sgRNA CRISPR Lentivector set (Human)

K0664701 3 x 1.0 ug
EUR 339.00

Eif1ax sgRNA CRISPR Lentivector set (Mouse)

K4533601 3 x 1.0 ug
EUR 339.00

Eif1ax sgRNA CRISPR Lentivector set (Rat)

K7575001 3 x 1.0 ug
EUR 339.00

EIF1AX-AS1 ORF Vector (Human) (pORF)

ORF018775 1.0 ug DNA Ask for price

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 1)

K0664702 1.0 ug DNA
EUR 154.00

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 2)

K0664703 1.0 ug DNA
EUR 154.00

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 3)

K0664704 1.0 ug DNA
EUR 154.00

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4533602 1.0 ug DNA
EUR 154.00

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4533603 1.0 ug DNA
EUR 154.00

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4533604 1.0 ug DNA
EUR 154.00

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 1)

K7575002 1.0 ug DNA
EUR 154.00

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 2)

K7575003 1.0 ug DNA
EUR 154.00

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 3)

K7575004 1.0 ug DNA
EUR 154.00

EIF1AX Protein Vector (Mouse) (pPB-C-His)

PV174922 500 ng
EUR 603.00

EIF1AX Protein Vector (Mouse) (pPB-N-His)

PV174923 500 ng
EUR 603.00

EIF1AX Protein Vector (Mouse) (pPM-C-HA)

PV174924 500 ng
EUR 603.00

EIF1AX Protein Vector (Mouse) (pPM-C-His)

PV174925 500 ng
EUR 603.00

Recombinant Human EIF1AX Protein, His, E.coli-1mg

QP11763-1mg 1mg
EUR 2757.00

Recombinant Human EIF1AX Protein, His, E.coli-20ug

QP11763-20ug 20ug
EUR 201.00

Recombinant Human EIF1AX Protein, His, E.coli-5ug

QP11763-5ug 5ug
EUR 155.00

EIF1AX Protein Vector (Human) (pPB-C-His)

PV013789 500 ng
EUR 329.00

EIF1AX Protein Vector (Human) (pPB-N-His)

PV013790 500 ng
EUR 329.00

EIF1AX Protein Vector (Human) (pPM-C-HA)

PV013791 500 ng
EUR 329.00

EIF1AX Protein Vector (Human) (pPM-C-His)

PV013792 500 ng
EUR 329.00

EIF1AX Protein Vector (Rat) (pPB-C-His)

PV265710 500 ng
EUR 603.00

EIF1AX Protein Vector (Rat) (pPB-N-His)

PV265711 500 ng
EUR 603.00

EIF1AX Protein Vector (Rat) (pPM-C-HA)

PV265712 500 ng
EUR 603.00

EIF1AX Protein Vector (Rat) (pPM-C-His)

PV265713 500 ng
EUR 603.00

Eif1ax 3'UTR Luciferase Stable Cell Line

TU203860 1.0 ml Ask for price

Eif1ax 3'UTR GFP Stable Cell Line

TU155692 1.0 ml Ask for price

EIF1AX 3'UTR Luciferase Stable Cell Line

TU006700 1.0 ml
EUR 2333.00

Eif1ax 3'UTR Luciferase Stable Cell Line

TU105692 1.0 ml Ask for price

EIF1AX 3'UTR GFP Stable Cell Line

TU056700 1.0 ml
EUR 2333.00

Eif1ax 3'UTR GFP Stable Cell Line

TU253860 1.0 ml Ask for price

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV639421 1.0 ug DNA
EUR 514.00

EIF1AX Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV639425 1.0 ug DNA
EUR 514.00

EIF1AX Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV639426 1.0 ug DNA
EUR 514.00

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody

20-abx112356
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.