EIF1AX Antibody

47437-100ul 100ul
EUR 252

EIF1AX Antibody

DF12973 200ul
EUR 304
Description: EIF1AX Antibody detects endogenous levels of EIF1AX.

EIF1AX antibody

70R-5014 50 ug
EUR 467
Description: Rabbit polyclonal EIF1AX antibody raised against the middle region of EIF1AX

EIF1AX Antibody

1-CSB-PA007506DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF1AX. Recognizes EIF1AX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF1AX Antibody

1-CSB-PA007506GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF1AX. Recognizes EIF1AX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EIF1AX siRNA

20-abx915122
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF1AX siRNA

20-abx915123
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EIF1AX Blocking Peptide

33R-4747 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF1AX antibody, catalog no. 70R-5014

EIF1AX Blocking Peptide

DF12973-BP 1mg
EUR 195

EIF1AX Conjugated Antibody

C47437 100ul
EUR 397

EIF1AX cloning plasmid

CSB-CL007506HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 435
  • Sequence: atgcccaagaataaaggtaaaggaggtaaaaacagacgcaggggtaagaatgagaatgaatctgaaaaaagagaactggtattcaaagaggatggtcaggagtatgctcaggtaatcaaaatgttgggaaatggacggctagaagcaatgtgtttcgatggtgtaaagaggttatg
  • Show more
Description: A cloning plasmid for the EIF1AX gene.

EIF1AX Rabbit pAb

A5917-100ul 100 ul
EUR 308

EIF1AX Rabbit pAb

A5917-200ul 200 ul
EUR 459

EIF1AX Rabbit pAb

A5917-20ul 20 ul
EUR 183

EIF1AX Rabbit pAb

A5917-50ul 50 ul
EUR 223

anti- EIF1AX antibody

FNab02685 100µg
EUR 548.75
  • Recommended dilution: WB: 1:200 - 1:2000
  • IHC: 1:100 - 1:200
  • Immunogen: eukaryotic translation initiation factor 1A, X-linked
  • Uniprot ID: P47813
  • Gene ID: 1964
  • Research Area: Metabolism
Description: Antibody raised against EIF1AX

anti- EIF1AX antibody

FNab02686 100µg
EUR 505.25
  • Immunogen: eukaryotic translation initiation factor 1A, X-linked
  • Uniprot ID: P47813
  • Gene ID: 1964
  • Research Area: Metabolism
Description: Antibody raised against EIF1AX

Anti-EIF1AX antibody

PAab02685 100 ug
EUR 386

Anti-EIF1AX antibody

PAab02686 100 ug
EUR 355

pCMV-SPORT6-EIF1AX

PVT14133 2 ug
EUR 391

Anti-EIF1AX antibody

STJ27713 100 µl
EUR 277
Description: This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA.

EIF1AX protein (His tag)

80R-1475 100 ug
EUR 305
Description: Purified recombinant Human EIF1AX protein

Human EIF1AX ELISA KIT

ELI-08423h 96 Tests
EUR 824

EIF1AX ELISA KIT|Human

EF009324 96 Tests
EUR 689

Mouse EIF1AX shRNA Plasmid

20-abx975488
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human EIF1AX shRNA Plasmid

20-abx951359
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

EIF1AX Recombinant Protein (Human)

RP010342 100 ug Ask for price

EIF1AX Recombinant Protein (Rat)

RP199280 100 ug Ask for price

EIF1AX Recombinant Protein (Mouse)

RP131189 100 ug Ask for price

Eif1ax ORF Vector (Rat) (pORF)

ORF066428 1.0 ug DNA
EUR 506

EIF1AX ORF Vector (Human) (pORF)

ORF003448 1.0 ug DNA
EUR 95

Eif1ax ORF Vector (Mouse) (pORF)

ORF043731 1.0 ug DNA
EUR 506

EIF1AX sgRNA CRISPR Lentivector set (Human)

K0664701 3 x 1.0 ug
EUR 339

Eif1ax sgRNA CRISPR Lentivector set (Rat)

K7575001 3 x 1.0 ug
EUR 339

Eif1ax sgRNA CRISPR Lentivector set (Mouse)

K4533601 3 x 1.0 ug
EUR 339

EIF1AX-AS1 ORF Vector (Human) (pORF)

ORF018775 1.0 ug DNA Ask for price

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 1)

K0664702 1.0 ug DNA
EUR 154

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 2)

K0664703 1.0 ug DNA
EUR 154

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 3)

K0664704 1.0 ug DNA
EUR 154

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 1)

K7575002 1.0 ug DNA
EUR 154

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 2)

K7575003 1.0 ug DNA
EUR 154

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 3)

K7575004 1.0 ug DNA
EUR 154

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4533602 1.0 ug DNA
EUR 154

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4533603 1.0 ug DNA
EUR 154

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4533604 1.0 ug DNA
EUR 154

EIF1AX Protein Vector (Mouse) (pPB-C-His)

PV174922 500 ng
EUR 603

EIF1AX Protein Vector (Mouse) (pPB-N-His)

PV174923 500 ng
EUR 603

EIF1AX Protein Vector (Mouse) (pPM-C-HA)

PV174924 500 ng
EUR 603

EIF1AX Protein Vector (Mouse) (pPM-C-His)

PV174925 500 ng
EUR 603

EIF1AX Protein Vector (Rat) (pPB-C-His)

PV265710 500 ng
EUR 603

EIF1AX Protein Vector (Rat) (pPB-N-His)

PV265711 500 ng
EUR 603

EIF1AX Protein Vector (Rat) (pPM-C-HA)

PV265712 500 ng
EUR 603

EIF1AX Protein Vector (Rat) (pPM-C-His)

PV265713 500 ng
EUR 603

EIF1AX Protein Vector (Human) (pPB-C-His)

PV013789 500 ng
EUR 329

EIF1AX Protein Vector (Human) (pPB-N-His)

PV013790 500 ng
EUR 329

EIF1AX Protein Vector (Human) (pPM-C-HA)

PV013791 500 ng
EUR 329

EIF1AX Protein Vector (Human) (pPM-C-His)

PV013792 500 ng
EUR 329

Recombinant Human EIF1AX Protein, His, E.coli-1mg

QP11763-1mg 1mg
EUR 2757

Recombinant Human EIF1AX Protein, His, E.coli-20ug

QP11763-20ug 20ug
EUR 201

Recombinant Human EIF1AX Protein, His, E.coli-5ug

QP11763-5ug 5ug
EUR 155

Eif1ax 3'UTR GFP Stable Cell Line

TU155692 1.0 ml Ask for price

Eif1ax 3'UTR Luciferase Stable Cell Line

TU105692 1.0 ml Ask for price

Eif1ax 3'UTR Luciferase Stable Cell Line

TU203860 1.0 ml Ask for price

Eif1ax 3'UTR GFP Stable Cell Line

TU253860 1.0 ml Ask for price

EIF1AX 3'UTR GFP Stable Cell Line

TU056700 1.0 ml
EUR 2333

EIF1AX 3'UTR Luciferase Stable Cell Line

TU006700 1.0 ml
EUR 2333

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV639421 1.0 ug DNA
EUR 514

EIF1AX Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV639425 1.0 ug DNA
EUR 514

EIF1AX Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV639426 1.0 ug DNA
EUR 514

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody

20-abx004534
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody

20-abx112356
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody

20-abx320527
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody

abx232685-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody

abx232686-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV723941 1.0 ug DNA Ask for price

EIF1AX-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV723945 1.0 ug DNA Ask for price

EIF1AX-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV723946 1.0 ug DNA Ask for price

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) Antibody

30196-05111 150 ug
EUR 276

EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0664705 3 x 1.0 ug
EUR 376

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7575005 3 x 1.0 ug
EUR 376

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4533605 3 x 1.0 ug
EUR 376

Human Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) ELISA Kit

abx387079-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0664706 1.0 ug DNA
EUR 167

EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0664707 1.0 ug DNA
EUR 167

EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0664708 1.0 ug DNA
EUR 167

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV639422 1.0 ug DNA
EUR 514

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV639423 1.0 ug DNA
EUR 572

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV639424 1.0 ug DNA
EUR 572

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7575006 1.0 ug DNA
EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7575007 1.0 ug DNA
EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7575008 1.0 ug DNA
EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4533606 1.0 ug DNA
EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4533607 1.0 ug DNA
EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4533608 1.0 ug DNA
EUR 167

EIF1AX Eukaryotic Translation Initiation Factor 1 X-linked Human Recombinant Protein

PROTP47813 Regular: 20ug
EUR 317
Description: EIF1AX Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 150 amino acids (1-144a.a.) and having a molecular wieght of 18.6kDa. EIF1AX is fused to 20a.a. His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) Antibody (Biotin Conjugate)

30196-05121 150 ug
EUR 369

EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV723942 1.0 ug DNA Ask for price

EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV723943 1.0 ug DNA Ask for price

EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV723944 1.0 ug DNA Ask for price

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (FITC Conjugate)

30196-05141 150 ug
EUR 428

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (RPE Conjugate)

30196-05151 150 ug
EUR 428

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (APC Conjugate)

30196-05161 150 ug
EUR 428

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (PerCP Conjugate)

30196-05171 150 ug
EUR 471