EIF1AX

EIF1AX Antibody
47437-100ul	SAB	100ul	EUR 252

EIF1AX Antibody
DF12973	Affbiotech	200ul	EUR 304
Description: EIF1AX Antibody detects endogenous levels of EIF1AX.

EIF1AX antibody
70R-5014	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal EIF1AX antibody raised against the middle region of EIF1AX

EIF1AX Antibody
1-CSB-PA007506DSR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF1AX. Recognizes EIF1AX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

EIF1AX Antibody
1-CSB-PA007506GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EIF1AX. Recognizes EIF1AX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EIF1AX siRNA
20-abx915122	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF1AX siRNA
20-abx915123	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EIF1AX Blocking Peptide
33R-4747	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF1AX antibody, catalog no. 70R-5014

EIF1AX Blocking Peptide
DF12973-BP	Affbiotech	1mg	EUR 195

EIF1AX Conjugated Antibody
C47437	SAB	100ul	EUR 397

EIF1AX cloning plasmid
CSB-CL007506HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 435 Sequence: atgcccaagaataaaggtaaaggaggtaaaaacagacgcaggggtaagaatgagaatgaatctgaaaaaagagaactggtattcaaagaggatggtcaggagtatgctcaggtaatcaaaatgttgggaaatggacggctagaagcaatgtgtttcgatggtgtaaagaggttatg Show more
Description: A cloning plasmid for the EIF1AX gene.

EIF1AX Rabbit pAb
A5917-100ul	Abclonal	100 ul	EUR 308

EIF1AX Rabbit pAb
A5917-200ul	Abclonal	200 ul	EUR 459

EIF1AX Rabbit pAb
A5917-20ul	Abclonal	20 ul	EUR 183

EIF1AX Rabbit pAb
A5917-50ul	Abclonal	50 ul	EUR 223

anti- EIF1AX antibody
FNab02685	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:200 - 1:2000 IHC: 1:100 - 1:200 Immunogen: eukaryotic translation initiation factor 1A, X-linked Uniprot ID: P47813 Gene ID: 1964 Research Area: Metabolism
Description: Antibody raised against EIF1AX

anti- EIF1AX antibody
FNab02686	FN Test	100µg	EUR 505.25
Immunogen: eukaryotic translation initiation factor 1A, X-linked Uniprot ID: P47813 Gene ID: 1964 Research Area: Metabolism
Description: Antibody raised against EIF1AX

Anti-EIF1AX antibody
PAab02685	Lifescience Market	100 ug	EUR 386

Anti-EIF1AX antibody
PAab02686	Lifescience Market	100 ug	EUR 355

pCMV-SPORT6-EIF1AX
PVT14133	Lifescience Market	2 ug	EUR 391

Anti-EIF1AX antibody
STJ27713	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA.

EIF1AX protein (His tag)
80R-1475	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human EIF1AX protein

Human EIF1AX ELISA KIT
ELI-08423h	Lifescience Market	96 Tests	EUR 824

EIF1AX ELISA KIT|Human
EF009324	Lifescience Market	96 Tests	EUR 689

Mouse EIF1AX shRNA Plasmid
20-abx975488	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EIF1AX shRNA Plasmid
20-abx951359	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EIF1AX Recombinant Protein (Human)
RP010342	ABM	100 ug	Ask for price

EIF1AX Recombinant Protein (Rat)
RP199280	ABM	100 ug	Ask for price

EIF1AX Recombinant Protein (Mouse)
RP131189	ABM	100 ug	Ask for price

Eif1ax ORF Vector (Rat) (pORF)
ORF066428	ABM	1.0 ug DNA	EUR 506

EIF1AX ORF Vector (Human) (pORF)
ORF003448	ABM	1.0 ug DNA	EUR 95

Eif1ax ORF Vector (Mouse) (pORF)
ORF043731	ABM	1.0 ug DNA	EUR 506

EIF1AX sgRNA CRISPR Lentivector set (Human)
K0664701	ABM	3 x 1.0 ug	EUR 339

Eif1ax sgRNA CRISPR Lentivector set (Rat)
K7575001	ABM	3 x 1.0 ug	EUR 339

Eif1ax sgRNA CRISPR Lentivector set (Mouse)
K4533601	ABM	3 x 1.0 ug	EUR 339

EIF1AX-AS1 ORF Vector (Human) (pORF)
ORF018775	ABM	1.0 ug DNA	Ask for price

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 1)
K0664702	ABM	1.0 ug DNA	EUR 154

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 2)
K0664703	ABM	1.0 ug DNA	EUR 154

EIF1AX sgRNA CRISPR Lentivector (Human) (Target 3)
K0664704	ABM	1.0 ug DNA	EUR 154

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 1)
K7575002	ABM	1.0 ug DNA	EUR 154

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 2)
K7575003	ABM	1.0 ug DNA	EUR 154

Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 3)
K7575004	ABM	1.0 ug DNA	EUR 154

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4533602	ABM	1.0 ug DNA	EUR 154

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4533603	ABM	1.0 ug DNA	EUR 154

Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4533604	ABM	1.0 ug DNA	EUR 154

EIF1AX Protein Vector (Mouse) (pPB-C-His)
PV174922	ABM	500 ng	EUR 603

EIF1AX Protein Vector (Mouse) (pPB-N-His)
PV174923	ABM	500 ng	EUR 603

EIF1AX Protein Vector (Mouse) (pPM-C-HA)
PV174924	ABM	500 ng	EUR 603

EIF1AX Protein Vector (Mouse) (pPM-C-His)
PV174925	ABM	500 ng	EUR 603

EIF1AX Protein Vector (Rat) (pPB-C-His)
PV265710	ABM	500 ng	EUR 603

EIF1AX Protein Vector (Rat) (pPB-N-His)
PV265711	ABM	500 ng	EUR 603

EIF1AX Protein Vector (Rat) (pPM-C-HA)
PV265712	ABM	500 ng	EUR 603

EIF1AX Protein Vector (Rat) (pPM-C-His)
PV265713	ABM	500 ng	EUR 603

EIF1AX Protein Vector (Human) (pPB-C-His)
PV013789	ABM	500 ng	EUR 329

EIF1AX Protein Vector (Human) (pPB-N-His)
PV013790	ABM	500 ng	EUR 329

EIF1AX Protein Vector (Human) (pPM-C-HA)
PV013791	ABM	500 ng	EUR 329

EIF1AX Protein Vector (Human) (pPM-C-His)
PV013792	ABM	500 ng	EUR 329

Recombinant Human EIF1AX Protein, His, E.coli-1mg
QP11763-1mg	EnQuireBio	1mg	EUR 2757

Recombinant Human EIF1AX Protein, His, E.coli-20ug
QP11763-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human EIF1AX Protein, His, E.coli-5ug
QP11763-5ug	EnQuireBio	5ug	EUR 155

Eif1ax 3'UTR GFP Stable Cell Line
TU155692	ABM	1.0 ml	Ask for price

Eif1ax 3'UTR Luciferase Stable Cell Line
TU105692	ABM	1.0 ml	Ask for price

Eif1ax 3'UTR Luciferase Stable Cell Line
TU203860	ABM	1.0 ml	Ask for price

Eif1ax 3'UTR GFP Stable Cell Line
TU253860	ABM	1.0 ml	Ask for price

EIF1AX 3'UTR GFP Stable Cell Line
TU056700	ABM	1.0 ml	EUR 2333

EIF1AX 3'UTR Luciferase Stable Cell Line
TU006700	ABM	1.0 ml	EUR 2333

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV639421	ABM	1.0 ug DNA	EUR 514

EIF1AX Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV639425	ABM	1.0 ug DNA	EUR 514

EIF1AX Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV639426	ABM	1.0 ug DNA	EUR 514

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody
20-abx004534	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody
20-abx112356	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody
20-abx320527	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody
abx232685-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody
abx232686-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV723941	ABM	1.0 ug DNA	Ask for price

EIF1AX-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV723945	ABM	1.0 ug DNA	Ask for price

EIF1AX-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV723946	ABM	1.0 ug DNA	Ask for price

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) Antibody
30196-05111	AssayPro	150 ug	EUR 276

EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0664705	ABM	3 x 1.0 ug	EUR 376

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7575005	ABM	3 x 1.0 ug	EUR 376

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4533605	ABM	3 x 1.0 ug	EUR 376

Human Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) ELISA Kit
abx387079-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0664706	ABM	1.0 ug DNA	EUR 167

EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0664707	ABM	1.0 ug DNA	EUR 167

EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0664708	ABM	1.0 ug DNA	EUR 167

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV639422	ABM	1.0 ug DNA	EUR 514

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV639423	ABM	1.0 ug DNA	EUR 572

EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV639424	ABM	1.0 ug DNA	EUR 572

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7575006	ABM	1.0 ug DNA	EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7575007	ABM	1.0 ug DNA	EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7575008	ABM	1.0 ug DNA	EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K4533606	ABM	1.0 ug DNA	EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K4533607	ABM	1.0 ug DNA	EUR 167

Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K4533608	ABM	1.0 ug DNA	EUR 167

EIF1AX Eukaryotic Translation Initiation Factor 1 X-linked Human Recombinant Protein
PROTP47813	BosterBio	Regular: 20ug	EUR 317
Description: EIF1AX Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 150 amino acids (1-144a.a.) and having a molecular wieght of 18.6kDa. EIF1AX is fused to 20a.a. His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) Antibody (Biotin Conjugate)
30196-05121	AssayPro	150 ug	EUR 369

EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV723942	ABM	1.0 ug DNA	Ask for price

EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV723943	ABM	1.0 ug DNA	Ask for price

EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV723944	ABM	1.0 ug DNA	Ask for price

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (FITC Conjugate)
30196-05141	AssayPro	150 ug	EUR 428

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (RPE Conjugate)
30196-05151	AssayPro	150 ug	EUR 428

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (APC Conjugate)
30196-05161	AssayPro	150 ug	EUR 428

Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (PerCP Conjugate)
30196-05171	AssayPro	150 ug	EUR 471