In den Nachrichten


EIF2S3 antibody

70R-17045 50 ul
EUR 435.00
Description: Rabbit polyclonal EIF2S3 antibody

EIF2S3 antibody

70R-1058 100 ug
EUR 377.00
Description: Rabbit polyclonal EIF2S3 antibody raised against the N terminal of EIF2S3

EIF2S3 antibody

70R-2892 50 ug
EUR 467.00
Description: Rabbit polyclonal EIF2S3 antibody raised against the N terminal of EIF2S3

EIF2S3 Antibody

47253-100ul 100ul
EUR 252.00

EIF2S3 Antibody

DF12974 200ul
EUR 304.00
Description: EIF2S3 Antibody detects endogenous levels of EIF2S3.

EIF2S3 antibody

70R-36621 100 ug
EUR 349.00
Description: Rabbit Polyclonal EIF2S3 antibody

EIF2S3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EIF2S3 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

EIF2S3 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against EIF2S3. Recognizes EIF2S3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EIF2S3 Blocking Peptide

33R-4841 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF2S3 antibody, catalog no. 70R-1058

EIF2S3 Blocking Peptide

33R-1197 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GRM6 antibody, catalog no. 70R-9576

EIF2S3 Blocking Peptide

DF12974-BP 1mg
EUR 195.00

EIF2S3 Conjugated Antibody

C47253 100ul
EUR 397.00

EIF2S3 cloning plasmid

CSB-CL007528HU-10ug 10ug
EUR 507.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1419
  • Sequence: atggcgggcggagaagctggagtgactctagggcagccgcatctttcgcgtcaggatctcaccaccttggatgttaccaagttgacgccactttcacacgaagttatcagcagacaagccacaattaacataggtacaattggtcatgtagctcatgggaaatccacagtcgtca
  • Show more
Description: A cloning plasmid for the EIF2S3 gene.

EIF2S3 Rabbit pAb

A3848-100ul 100 ul
EUR 308.00

EIF2S3 Rabbit pAb

A3848-200ul 200 ul
EUR 459.00

EIF2S3 Rabbit pAb

A3848-20ul 20 ul
EUR 183.00

EIF2S3 Rabbit pAb

A3848-50ul 50 ul
EUR 223.00

EIF2S3 Rabbit pAb

A6581-100ul 100 ul
EUR 308.00

EIF2S3 Rabbit pAb

A6581-200ul 200 ul
EUR 459.00

EIF2S3 Rabbit pAb

A6581-20ul 20 ul
EUR 183.00

EIF2S3 Rabbit pAb

A6581-50ul 50 ul
EUR 223.00

anti- EIF2S3 antibody

FNab02701 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa
  • Uniprot ID: P41091
  • Gene ID: 1968
  • Research Area: Metabolism
Description: Antibody raised against EIF2S3

Anti-EIF2S3 antibody

PAab02701 100 ug
EUR 386.00

Anti-EIF2S3 antibody

STJ28664 100 µl
EUR 277.00
Description: The protein encoded by this gene is the largest subunit of a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA(i) to the 40 S ribosomal subunit.

Anti-EIF2S3 antibody

STJ23510 100 µl
EUR 277.00
Description: The protein encoded by this gene is the largest subunit of a heterotrimeric GTP-binding protein involved in the recruitment of methionyl-tRNA(i) to the 40 S ribosomal subunit.


ELI-20270h 96 Tests
EUR 824.00


ELI-21435c 96 Tests
EUR 928.00


EF009337 96 Tests
EUR 689.00

Human EIF2S3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


ELI-48207b 96 Tests
EUR 928.00

pCMV-SPORT6-EIF2S3 Plasmid

PVT16227 2 ug
EUR 325.00

EIF2S3 Recombinant Protein (Human)

RP010393 100 ug Ask for price

EIF2S3 ORF Vector (Human) (pORF)

ORF003465 1.0 ug DNA
EUR 95.00

EIF2S3 sgRNA CRISPR Lentivector set (Human)

K0666901 3 x 1.0 ug
EUR 339.00

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 1)

K0666902 1.0 ug DNA
EUR 154.00

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 2)

K0666903 1.0 ug DNA
EUR 154.00

EIF2S3 sgRNA CRISPR Lentivector (Human) (Target 3)

K0666904 1.0 ug DNA
EUR 154.00

EIF2S3 Protein Vector (Human) (pPB-C-His)

PV013857 500 ng
EUR 329.00

EIF2S3 Protein Vector (Human) (pPB-N-His)

PV013858 500 ng
EUR 329.00

EIF2S3 Protein Vector (Human) (pPM-C-HA)

PV013859 500 ng
EUR 329.00

EIF2S3 Protein Vector (Human) (pPM-C-His)

PV013860 500 ng
EUR 329.00

EIF2S3 3'UTR GFP Stable Cell Line

TU056727 1.0 ml
EUR 1394.00

EIF2S3 3'UTR Luciferase Stable Cell Line

TU006727 1.0 ml
EUR 1394.00

EIF2S3 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV791545 1.0 ug DNA
EUR 316.00

EIF2S3 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV791546 1.0 ug DNA
EUR 316.00

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

abx036559-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (eIF2S3) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

abx030059-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

abx030059-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Eukaryotic Translation Initiation Factor 2 Subunit 3 (EIF2S3) Antibody

abx232701-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

EIF2S3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0666905 3 x 1.0 ug
EUR 376.00

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E02E0374-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E02E0374-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E02E0374-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E03E0374-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E03E0374-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E03E0374-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E01E0374-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E01E0374-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E01E0374-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E06E0374-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E06E0374-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) ELISA kit

E06E0374-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Eukaryotic translation initiation factor 2 subunit 3(EIF2S3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.