  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

EXOC4 antibody

70R-2859 50 ug
EUR 467.00
Description: Rabbit polyclonal EXOC4 antibody raised against the N terminal of EXOC4

EXOC4 antibody

70R-9378 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal EXOC4 antibody

EXOC4 antibody

70R-17168 50 ul
EUR 435.00
Description: Rabbit polyclonal EXOC4 antibody

EXOC4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC4. Recognizes EXOC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EXOC4 cloning plasmid

CSB-CL007882HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1425
  • Sequence: atggcggcagaagcagctggtgggaaatacagaagcacagtcagcaaaagcaaagacccctcggggctgctcatctctgtgatcaggactctgtctactagtgacgatgtcgaagacagggaaaatgaaaagggtcgccttgaagaagcctacgagaaatgtgaccgtgacctgg
  • Show more
Description: A cloning plasmid for the EXOC4 gene.

EXOC4 Rabbit pAb

A12374-100ul 100 ul
EUR 308.00

EXOC4 Rabbit pAb

A12374-200ul 200 ul
EUR 459.00

EXOC4 Rabbit pAb

A12374-20ul 20 ul
EUR 183.00

EXOC4 Rabbit pAb

A12374-50ul 50 ul
EUR 223.00

EXOC4 Blocking Peptide

33R-5589 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC4 antibody, catalog no. 70R-2859

EXOC4 Blocking Peptide

33R-8974 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC4 antibody, catalog no. 70R-9378

EXOC4 Polyclonal Antibody

27683-100ul 100ul
EUR 252.00

EXOC4 Polyclonal Antibody

27683-50ul 50ul
EUR 187.00

Anti-EXOC4 antibody

STJ114252 100 µl
EUR 277.00
Description: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

EXOC4 Polyclonal Conjugated Antibody

C27683 100ul
EUR 397.00

Rat EXOC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse EXOC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human EXOC4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

EXOC4 ORF Vector (Human) (pORF)

ORF003681 1.0 ug DNA
EUR 95.00

Exoc4 ORF Vector (Rat) (pORF)

ORF066698 1.0 ug DNA
EUR 506.00

Exoc4 ORF Vector (Mouse) (pORF)

ORF044160 1.0 ug DNA
EUR 506.00

Polyclonal EXOC4 antibody - N-terminal region

APR11882G 0.05mg
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXOC4 - N-terminal region. This antibody is tested and proven to work in the following applications:

Exocyst Complex Component 4 (EXOC4) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Exocyst Complex Component 4 (EXOC4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Exoc4 sgRNA CRISPR Lentivector set (Mouse)

K3420701 3 x 1.0 ug
EUR 339.00

EXOC4 sgRNA CRISPR Lentivector set (Human)

K0702601 3 x 1.0 ug
EUR 339.00

Exoc4 sgRNA CRISPR Lentivector set (Rat)

K7050701 3 x 1.0 ug
EUR 339.00

Monoclonal EXOC4 Antibody (monoclonal) (M06), Clone: 4F1

APR11881G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human EXOC4 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4F1. This antibody is applicable in WB, E

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3420702 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3420703 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3420704 1.0 ug DNA
EUR 154.00

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0702602 1.0 ug DNA
EUR 154.00

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0702603 1.0 ug DNA
EUR 154.00

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0702604 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7050702 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7050703 1.0 ug DNA
EUR 154.00

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7050704 1.0 ug DNA
EUR 154.00

EXOC4 Protein Vector (Mouse) (pPB-C-His)

PV176638 500 ng
EUR 1065.00

EXOC4 Protein Vector (Mouse) (pPB-N-His)

PV176639 500 ng
EUR 1065.00

EXOC4 Protein Vector (Mouse) (pPM-C-HA)

PV176640 500 ng
EUR 1065.00

EXOC4 Protein Vector (Mouse) (pPM-C-His)

PV176641 500 ng
EUR 1065.00

EXOC4 Protein Vector (Human) (pPB-C-His)

PV014721 500 ng
EUR 329.00

EXOC4 Protein Vector (Human) (pPB-N-His)

PV014722 500 ng
EUR 329.00

EXOC4 Protein Vector (Human) (pPM-C-HA)

PV014723 500 ng
EUR 329.00

EXOC4 Protein Vector (Human) (pPM-C-His)

PV014724 500 ng
EUR 329.00

EXOC4 Protein Vector (Rat) (pPB-C-His)

PV266790 500 ng
EUR 1166.00

EXOC4 Protein Vector (Rat) (pPB-N-His)

PV266791 500 ng
EUR 1166.00

EXOC4 Protein Vector (Rat) (pPM-C-HA)

PV266792 500 ng
EUR 1166.00

EXOC4 Protein Vector (Rat) (pPM-C-His)

PV266793 500 ng
EUR 1166.00

Exoc4 3'UTR Luciferase Stable Cell Line

TU204151 1.0 ml Ask for price

Exoc4 3'UTR GFP Stable Cell Line

TU156009 1.0 ml Ask for price

EXOC4 3'UTR Luciferase Stable Cell Line

TU007122 1.0 ml
EUR 1394.00

Exoc4 3'UTR Luciferase Stable Cell Line

TU106009 1.0 ml Ask for price

EXOC4 3'UTR GFP Stable Cell Line

TU057122 1.0 ml
EUR 1394.00

Exoc4 3'UTR GFP Stable Cell Line

TU254151 1.0 ml Ask for price

Human Exocyst complex component 4, EXOC4 ELISA KIT

ELI-20566h 96 Tests
EUR 824.00

Mouse Exocyst complex component 4, Exoc4 ELISA KIT

ELI-26990m 96 Tests
EUR 865.00

EXOC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV665203 1.0 ug DNA
EUR 1355.00

EXOC4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV665207 1.0 ug DNA
EUR 1355.00

EXOC4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV665208 1.0 ug DNA
EUR 1355.00

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3420705 3 x 1.0 ug
EUR 376.00

EXOC4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0702605 3 x 1.0 ug
EUR 376.00

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7050705 3 x 1.0 ug
EUR 376.00

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3420706 1.0 ug DNA
EUR 167.00

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3420707 1.0 ug DNA
EUR 167.00

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3420708 1.0 ug DNA
EUR 167.00

EXOC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0702606 1.0 ug DNA
EUR 167.00