EXOC4

EXOC4 siRNA
20-abx901797	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXOC4 siRNA
20-abx915802	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXOC4 siRNA
20-abx915803	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EXOC4 antibody
70R-2859	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal EXOC4 antibody raised against the N terminal of EXOC4

EXOC4 antibody
70R-9378	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal EXOC4 antibody

EXOC4 antibody
70R-17168	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal EXOC4 antibody

EXOC4 Antibody
1-CSB-PA007882GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against EXOC4. Recognizes EXOC4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

EXOC4 cloning plasmid
CSB-CL007882HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1425 Sequence: atggcggcagaagcagctggtgggaaatacagaagcacagtcagcaaaagcaaagacccctcggggctgctcatctctgtgatcaggactctgtctactagtgacgatgtcgaagacagggaaaatgaaaagggtcgccttgaagaagcctacgagaaatgtgaccgtgacctgg Show more
Description: A cloning plasmid for the EXOC4 gene.

EXOC4 Rabbit pAb
A12374-100ul	Abclonal	100 ul	EUR 308

EXOC4 Rabbit pAb
A12374-200ul	Abclonal	200 ul	EUR 459

EXOC4 Rabbit pAb
A12374-20ul	Abclonal	20 ul	EUR 183

EXOC4 Rabbit pAb
A12374-50ul	Abclonal	50 ul	EUR 223

EXOC4 Blocking Peptide
33R-5589	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC4 antibody, catalog no. 70R-2859

EXOC4 Blocking Peptide
33R-8974	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EXOC4 antibody, catalog no. 70R-9378

EXOC4 Polyclonal Antibody
27683-100ul	SAB	100ul	EUR 252

EXOC4 Polyclonal Antibody
27683-50ul	SAB	50ul	EUR 187

Anti-EXOC4 antibody
STJ114252	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized.

EXOC4 Polyclonal Conjugated Antibody
C27683	SAB	100ul	EUR 397

Rat EXOC4 shRNA Plasmid
20-abx987315	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse EXOC4 shRNA Plasmid
20-abx972626	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EXOC4 shRNA Plasmid
20-abx961791	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EXOC4 ORF Vector (Human) (pORF)
ORF003681	ABM	1.0 ug DNA	EUR 95

Exoc4 ORF Vector (Rat) (pORF)
ORF066698	ABM	1.0 ug DNA	EUR 506

Exoc4 ORF Vector (Mouse) (pORF)
ORF044160	ABM	1.0 ug DNA	EUR 506

Polyclonal EXOC4 antibody - N-terminal region
APR11882G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human EXOC4 - N-terminal region. This antibody is tested and proven to work in the following applications:

Exocyst Complex Component 4 (EXOC4) Antibody
20-abx125828	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Exocyst Complex Component 4 (EXOC4) Antibody
20-abx112404	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Exoc4 sgRNA CRISPR Lentivector set (Mouse)
K3420701	ABM	3 x 1.0 ug	EUR 339

EXOC4 sgRNA CRISPR Lentivector set (Human)
K0702601	ABM	3 x 1.0 ug	EUR 339

Exoc4 sgRNA CRISPR Lentivector set (Rat)
K7050701	ABM	3 x 1.0 ug	EUR 339

Monoclonal EXOC4 Antibody (monoclonal) (M06), Clone: 4F1
APR11881G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human EXOC4 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4F1. This antibody is applicable in WB, E

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3420702	ABM	1.0 ug DNA	EUR 154

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3420703	ABM	1.0 ug DNA	EUR 154

Exoc4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3420704	ABM	1.0 ug DNA	EUR 154

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 1)
K0702602	ABM	1.0 ug DNA	EUR 154

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 2)
K0702603	ABM	1.0 ug DNA	EUR 154

EXOC4 sgRNA CRISPR Lentivector (Human) (Target 3)
K0702604	ABM	1.0 ug DNA	EUR 154

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7050702	ABM	1.0 ug DNA	EUR 154

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7050703	ABM	1.0 ug DNA	EUR 154

Exoc4 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7050704	ABM	1.0 ug DNA	EUR 154

EXOC4 Protein Vector (Mouse) (pPB-C-His)
PV176638	ABM	500 ng	EUR 1065

EXOC4 Protein Vector (Mouse) (pPB-N-His)
PV176639	ABM	500 ng	EUR 1065

EXOC4 Protein Vector (Mouse) (pPM-C-HA)
PV176640	ABM	500 ng	EUR 1065

EXOC4 Protein Vector (Mouse) (pPM-C-His)
PV176641	ABM	500 ng	EUR 1065

EXOC4 Protein Vector (Human) (pPB-C-His)
PV014721	ABM	500 ng	EUR 329

EXOC4 Protein Vector (Human) (pPB-N-His)
PV014722	ABM	500 ng	EUR 329

EXOC4 Protein Vector (Human) (pPM-C-HA)
PV014723	ABM	500 ng	EUR 329

EXOC4 Protein Vector (Human) (pPM-C-His)
PV014724	ABM	500 ng	EUR 329

EXOC4 Protein Vector (Rat) (pPB-C-His)
PV266790	ABM	500 ng	EUR 1166

EXOC4 Protein Vector (Rat) (pPB-N-His)
PV266791	ABM	500 ng	EUR 1166

EXOC4 Protein Vector (Rat) (pPM-C-HA)
PV266792	ABM	500 ng	EUR 1166

EXOC4 Protein Vector (Rat) (pPM-C-His)
PV266793	ABM	500 ng	EUR 1166

Exoc4 3'UTR Luciferase Stable Cell Line
TU204151	ABM	1.0 ml	Ask for price

Exoc4 3'UTR GFP Stable Cell Line
TU156009	ABM	1.0 ml	Ask for price

EXOC4 3'UTR Luciferase Stable Cell Line
TU007122	ABM	1.0 ml	EUR 1394

Exoc4 3'UTR Luciferase Stable Cell Line
TU106009	ABM	1.0 ml	Ask for price

EXOC4 3'UTR GFP Stable Cell Line
TU057122	ABM	1.0 ml	EUR 1394

Exoc4 3'UTR GFP Stable Cell Line
TU254151	ABM	1.0 ml	Ask for price

Human Exocyst complex component 4, EXOC4 ELISA KIT
ELI-20566h	Lifescience Market	96 Tests	EUR 824

Mouse Exocyst complex component 4, Exoc4 ELISA KIT
ELI-26990m	Lifescience Market	96 Tests	EUR 865

EXOC4 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV665203	ABM	1.0 ug DNA	EUR 1355

EXOC4 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV665207	ABM	1.0 ug DNA	EUR 1355

EXOC4 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV665208	ABM	1.0 ug DNA	EUR 1355

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3420705	ABM	3 x 1.0 ug	EUR 376

EXOC4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0702605	ABM	3 x 1.0 ug	EUR 376

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7050705	ABM	3 x 1.0 ug	EUR 376

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3420706	ABM	1.0 ug DNA	EUR 167

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3420707	ABM	1.0 ug DNA	EUR 167

Exoc4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3420708	ABM	1.0 ug DNA	EUR 167

EXOC4 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0702606	ABM	1.0 ug DNA	EUR 167