FBXW5

FBXW5 siRNA
20-abx901921
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW5 siRNA
20-abx916666
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW5 siRNA
20-abx916667
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FBXW5 Antibody
DF13011 200ul
EUR 304
Description: FBXW5 Antibody detects endogenous levels of FBXW5.

FBXW5 Antibody
1-CSB-PA846577LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

anti-FBXW5
YF-PA19299 50 ug
EUR 363
Description: Mouse polyclonal to FBXW5

anti- FBXW5 antibody
FNab03056 100µg
EUR 505.25
  • Immunogen: F-box and WD repeat domain containing 5
  • Uniprot ID: Q969U6
  • Gene ID: 54461
  • Research Area: Metabolism
Description: Antibody raised against FBXW5

FBXW5 Rabbit pAb
A9345-100ul 100 ul
EUR 308

FBXW5 Rabbit pAb
A9345-200ul 200 ul
EUR 459

FBXW5 Rabbit pAb
A9345-20ul 20 ul
EUR 183

FBXW5 Rabbit pAb
A9345-50ul 50 ul
EUR 223

FBXW5 Polyclonal Antibody
31706-100ul 100ul
EUR 252

FBXW5 Polyclonal Antibody
31706-50ul 50ul
EUR 187

FBXW5 Blocking Peptide
DF13011-BP 1mg
EUR 195

FBXW5 cloning plasmid
CSB-CL846577HU1-10ug 10ug
EUR 586
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1701
  • Sequence: atggacgagggcggcacgcccctgctccccgacagcctggtctaccagatcttcctgagcctgggcccggccgacgtgctggccgccgggctggtgtgccgccaatggcaggccgtgtcgcgggacgagttcctgtggagggagcagttctaccgctactaccaggtggcccgcg
  • Show more
Description: A cloning plasmid for the FBXW5 gene.

FBXW5 cloning plasmid
CSB-CL846577HU2-10ug 10ug
EUR 244
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 480
  • Sequence: atgggcctgtcgcccgacaacaggtacctgtacgtgaacagccgcgcctggcccaacggtgcggtggtggccgaccccatgcagccgccaccaatcgcggaggagattgacctgctggtgttcgacctcaagaccatgcgggaggtgaggcgggctctgcgtgcgcaccgcgccta
  • Show more
Description: A cloning plasmid for the FBXW5 gene.

Anti-FBXW5 antibody
PAab03056 100 ug
EUR 355

Anti-FBXW5 antibody
STJ111668 100 µl
EUR 277
Description: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented.

FBXW5 Polyclonal Conjugated Antibody
C31706 100ul
EUR 397

Mouse FBXW5 shRNA Plasmid
20-abx974031
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat FBXW5 shRNA Plasmid
20-abx990317
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW5 ELISA KIT|Human
EF009597 96 Tests
EUR 689

Human FBXW5 shRNA Plasmid
20-abx960068
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

FBXW5 Antibody, HRP conjugated
1-CSB-PA846577LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW5 Antibody, FITC conjugated
1-CSB-PA846577LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW5 Antibody, Biotin conjugated
1-CSB-PA846577LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FBXW5 Recombinant Protein (Human)
RP011965 100 ug Ask for price

FBXW5 Recombinant Protein (Human)
RP011968 100 ug Ask for price

FBXW5 Recombinant Protein (Rat)
RP201080 100 ug Ask for price

FBXW5 Recombinant Protein (Mouse)
RP134156 100 ug Ask for price

FBXW5 ORF Vector (Human) (pORF)
ORF003989 1.0 ug DNA
EUR 95

FBXW5 ORF Vector (Human) (pORF)
ORF003990 1.0 ug DNA
EUR 95

Fbxw5 ORF Vector (Rat) (pORF)
ORF067028 1.0 ug DNA
EUR 506

Fbxw5 ORF Vector (Mouse) (pORF)
ORF044720 1.0 ug DNA
EUR 506

FBXW5 sgRNA CRISPR Lentivector set (Human)
K0767501 3 x 1.0 ug
EUR 339

Fbxw5 sgRNA CRISPR Lentivector set (Mouse)
K4573401 3 x 1.0 ug
EUR 339

Fbxw5 sgRNA CRISPR Lentivector set (Rat)
K7164801 3 x 1.0 ug
EUR 339

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 1)
K0767502 1.0 ug DNA
EUR 154

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 2)
K0767503 1.0 ug DNA
EUR 154

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 3)
K0767504 1.0 ug DNA
EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4573402 1.0 ug DNA
EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4573403 1.0 ug DNA
EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4573404 1.0 ug DNA
EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7164802 1.0 ug DNA
EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7164803 1.0 ug DNA
EUR 154

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7164804 1.0 ug DNA
EUR 154

FBXW5 Protein Vector (Mouse) (pPB-C-His)
PV178878 500 ng
EUR 603

FBXW5 Protein Vector (Mouse) (pPB-N-His)
PV178879 500 ng
EUR 603

FBXW5 Protein Vector (Mouse) (pPM-C-HA)
PV178880 500 ng
EUR 603

FBXW5 Protein Vector (Mouse) (pPM-C-His)
PV178881 500 ng
EUR 603

FBXW5 Protein Vector (Human) (pPB-C-His)
PV015953 500 ng
EUR 329

FBXW5 Protein Vector (Human) (pPB-N-His)
PV015954 500 ng
EUR 329

FBXW5 Protein Vector (Human) (pPM-C-HA)
PV015955 500 ng
EUR 329

FBXW5 Protein Vector (Human) (pPM-C-His)
PV015956 500 ng
EUR 329

FBXW5 Protein Vector (Human) (pPB-C-His)
PV015957 500 ng
EUR 329

FBXW5 Protein Vector (Human) (pPB-N-His)
PV015958 500 ng
EUR 329

FBXW5 Protein Vector (Human) (pPM-C-HA)
PV015959 500 ng
EUR 329

FBXW5 Protein Vector (Human) (pPM-C-His)
PV015960 500 ng
EUR 329

FBXW5 Protein Vector (Rat) (pPB-C-His)
PV268110 500 ng
EUR 603

FBXW5 Protein Vector (Rat) (pPB-N-His)
PV268111 500 ng
EUR 603

FBXW5 Protein Vector (Rat) (pPM-C-HA)
PV268112 500 ng
EUR 603

FBXW5 Protein Vector (Rat) (pPM-C-His)
PV268113 500 ng
EUR 603

Fbxw5 3'UTR Luciferase Stable Cell Line
TU204532 1.0 ml Ask for price

Fbxw5 3'UTR GFP Stable Cell Line
TU156465 1.0 ml Ask for price

FBXW5 3'UTR Luciferase Stable Cell Line
TU007812 1.0 ml
EUR 1394

Fbxw5 3'UTR Luciferase Stable Cell Line
TU106465 1.0 ml Ask for price

FBXW5 3'UTR GFP Stable Cell Line
TU057812 1.0 ml
EUR 1394

Fbxw5 3'UTR GFP Stable Cell Line
TU254532 1.0 ml Ask for price

FBXW5 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV660133 1.0 ug DNA
EUR 682

FBXW5 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV660137 1.0 ug DNA
EUR 682