FBXW5

FBXW5 Antibody
1-CSB-PA846577LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

FBXW5 Antibody
DF13011	Affbiotech	200ul	EUR 304.00
Description: FBXW5 Antibody detects endogenous levels of FBXW5.

FBXW5 siRNA
20-abx901921	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

FBXW5 siRNA
20-abx916666	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

FBXW5 siRNA
20-abx916667	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-FBXW5
YF-PA19299	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to FBXW5

FBXW5 Polyclonal Antibody
31706-100ul	SAB	100ul	EUR 252.00

FBXW5 Polyclonal Antibody
31706-50ul	SAB	50ul	EUR 187.00

FBXW5 Blocking Peptide
DF13011-BP	Affbiotech	1mg	EUR 195.00

FBXW5 cloning plasmid
CSB-CL846577HU1-10ug	Cusabio	10ug	EUR 586.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1701 Sequence: atggacgagggcggcacgcccctgctccccgacagcctggtctaccagatcttcctgagcctgggcccggccgacgtgctggccgccgggctggtgtgccgccaatggcaggccgtgtcgcgggacgagttcctgtggagggagcagttctaccgctactaccaggtggcccgcg Show more
Description: A cloning plasmid for the FBXW5 gene.

FBXW5 cloning plasmid
CSB-CL846577HU2-10ug	Cusabio	10ug	EUR 244.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 480 Sequence: atgggcctgtcgcccgacaacaggtacctgtacgtgaacagccgcgcctggcccaacggtgcggtggtggccgaccccatgcagccgccaccaatcgcggaggagattgacctgctggtgttcgacctcaagaccatgcgggaggtgaggcgggctctgcgtgcgcaccgcgccta Show more
Description: A cloning plasmid for the FBXW5 gene.

FBXW5 Rabbit pAb
A9345-100ul	Abclonal	100 ul	EUR 308.00

FBXW5 Rabbit pAb
A9345-200ul	Abclonal	200 ul	EUR 459.00

FBXW5 Rabbit pAb
A9345-20ul	Abclonal	20 ul	EUR 183.00

FBXW5 Rabbit pAb
A9345-50ul	Abclonal	50 ul	EUR 223.00

anti- FBXW5 antibody
FNab03056	FN Test	100µg	EUR 505.25
Immunogen: F-box and WD repeat domain containing 5 Uniprot ID: Q969U6 Gene ID: 54461 Research Area: Metabolism
Description: Antibody raised against FBXW5

Anti-FBXW5 antibody
PAab03056	Lifescience Market	100 ug	EUR 355.00

Anti-FBXW5 antibody
STJ111668	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene contains WD-40 domains, in addition to an F-box motif, so it belongs to the Fbw class. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene, however, they were found to be nonsense-mediated mRNA decay (NMD) candidates, hence not represented.

FBXW5 Antibody, HRP conjugated
1-CSB-PA846577LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FBXW5 Antibody, FITC conjugated
1-CSB-PA846577LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FBXW5 Antibody, Biotin conjugated
1-CSB-PA846577LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FBXW5. Recognizes FBXW5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

FBXW5 ELISA KIT|Human
EF009597	Lifescience Market	96 Tests	EUR 689.00

Rat FBXW5 shRNA Plasmid
20-abx990317	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse FBXW5 shRNA Plasmid
20-abx974031	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

FBXW5 Polyclonal Conjugated Antibody
C31706	SAB	100ul	EUR 397.00

Human FBXW5 shRNA Plasmid
20-abx960068	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

FBXW5 Recombinant Protein (Human)
RP011965	ABM	100 ug	Ask for price

FBXW5 Recombinant Protein (Human)
RP011968	ABM	100 ug	Ask for price

FBXW5 Recombinant Protein (Rat)
RP201080	ABM	100 ug	Ask for price

FBXW5 Recombinant Protein (Mouse)
RP134156	ABM	100 ug	Ask for price

Fbxw5 ORF Vector (Rat) (pORF)
ORF067028	ABM	1.0 ug DNA	EUR 506.00

FBXW5 ORF Vector (Human) (pORF)
ORF003989	ABM	1.0 ug DNA	EUR 95.00

FBXW5 ORF Vector (Human) (pORF)
ORF003990	ABM	1.0 ug DNA	EUR 95.00

Fbxw5 ORF Vector (Mouse) (pORF)
ORF044720	ABM	1.0 ug DNA	EUR 506.00

Fbxw5 sgRNA CRISPR Lentivector set (Rat)
K7164801	ABM	3 x 1.0 ug	EUR 339.00

FBXW5 sgRNA CRISPR Lentivector set (Human)
K0767501	ABM	3 x 1.0 ug	EUR 339.00

Fbxw5 sgRNA CRISPR Lentivector set (Mouse)
K4573401	ABM	3 x 1.0 ug	EUR 339.00

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7164802	ABM	1.0 ug DNA	EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7164803	ABM	1.0 ug DNA	EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7164804	ABM	1.0 ug DNA	EUR 154.00

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 1)
K0767502	ABM	1.0 ug DNA	EUR 154.00

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 2)
K0767503	ABM	1.0 ug DNA	EUR 154.00

FBXW5 sgRNA CRISPR Lentivector (Human) (Target 3)
K0767504	ABM	1.0 ug DNA	EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4573402	ABM	1.0 ug DNA	EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4573403	ABM	1.0 ug DNA	EUR 154.00

Fbxw5 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4573404	ABM	1.0 ug DNA	EUR 154.00

FBXW5 Protein Vector (Mouse) (pPB-C-His)
PV178878	ABM	500 ng	EUR 603.00

FBXW5 Protein Vector (Mouse) (pPB-N-His)
PV178879	ABM	500 ng	EUR 603.00

FBXW5 Protein Vector (Mouse) (pPM-C-HA)
PV178880	ABM	500 ng	EUR 603.00

FBXW5 Protein Vector (Mouse) (pPM-C-His)
PV178881	ABM	500 ng	EUR 603.00

FBXW5 Protein Vector (Rat) (pPB-C-His)
PV268110	ABM	500 ng	EUR 603.00

FBXW5 Protein Vector (Rat) (pPB-N-His)
PV268111	ABM	500 ng	EUR 603.00

FBXW5 Protein Vector (Rat) (pPM-C-HA)
PV268112	ABM	500 ng	EUR 603.00

FBXW5 Protein Vector (Rat) (pPM-C-His)
PV268113	ABM	500 ng	EUR 603.00

FBXW5 Protein Vector (Human) (pPB-C-His)
PV015953	ABM	500 ng	EUR 329.00

FBXW5 Protein Vector (Human) (pPB-N-His)
PV015954	ABM	500 ng	EUR 329.00

FBXW5 Protein Vector (Human) (pPM-C-HA)
PV015955	ABM	500 ng	EUR 329.00

FBXW5 Protein Vector (Human) (pPM-C-His)
PV015956	ABM	500 ng	EUR 329.00

FBXW5 Protein Vector (Human) (pPB-C-His)
PV015957	ABM	500 ng	EUR 329.00

FBXW5 Protein Vector (Human) (pPB-N-His)
PV015958	ABM	500 ng	EUR 329.00

FBXW5 Protein Vector (Human) (pPM-C-HA)
PV015959	ABM	500 ng	EUR 329.00

FBXW5 Protein Vector (Human) (pPM-C-His)
PV015960	ABM	500 ng	EUR 329.00

Fbxw5 3'UTR GFP Stable Cell Line
TU156465	ABM	1.0 ml	Ask for price

Fbxw5 3'UTR Luciferase Stable Cell Line
TU106465	ABM	1.0 ml	Ask for price

Fbxw5 3'UTR Luciferase Stable Cell Line
TU204532	ABM	1.0 ml	Ask for price

Fbxw5 3'UTR GFP Stable Cell Line
TU254532	ABM	1.0 ml	Ask for price

FBXW5 3'UTR GFP Stable Cell Line
TU057812	ABM	1.0 ml	EUR 1394.00

FBXW5 3'UTR Luciferase Stable Cell Line
TU007812	ABM	1.0 ml	EUR 1394.00

FBXW5 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV710091	ABM	1.0 ug DNA	EUR 316.00

FBXW5 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV710095	ABM	1.0 ug DNA	EUR 316.00