FCGR3B

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
DLR-FcgR3B-Hu-96T 96T
EUR 647
  • Should the Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RDR-FcgR3B-Hu-48Tests 48 Tests
EUR 522

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RDR-FcgR3B-Hu-96Tests 96 Tests
EUR 724

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RD-FcgR3B-Hu-48Tests 48 Tests
EUR 500

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RD-FcgR3B-Hu-96Tests 96 Tests
EUR 692

FCGR3B Antibody
1-CSB-PA008544LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

FCGR3B siRNA
20-abx916694
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

FCGR3B Polyclonal Antibody
31372-100ul 100ul
EUR 252

FCGR3B Polyclonal Antibody
31372-50ul 50ul
EUR 187

FCGR3B Polyclonal Antibody
28411-100ul 100ul
EUR 252

FCGR3B Polyclonal Antibody
28411-50ul 50ul
EUR 187

FCGR3B Rabbit pAb
A13980-100ul 100 ul
EUR 308

FCGR3B Rabbit pAb
A13980-200ul 200 ul
EUR 459

FCGR3B Rabbit pAb
A13980-20ul 20 ul
EUR 183

FCGR3B Rabbit pAb
A13980-50ul 50 ul
EUR 223

FCGR3A/FCGR3B Antibody
1-CSB-PA676166
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against FCGR3A/FCGR3B. Recognizes FCGR3A/FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

FCGR3A / FCGR3B Antibody
20-abx323190
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

FCGR3B cloning plasmid
CSB-CL008544HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 702
  • Sequence: ATGTGGCAGCTGCTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACA
  • Show more
Description: A cloning plasmid for the FCGR3B gene.

FCGR3B Rabbit pAb
A7894-100ul 100 ul
EUR 308

FCGR3B Rabbit pAb
A7894-200ul 200 ul
EUR 459

FCGR3B Rabbit pAb
A7894-20ul 20 ul
EUR 183

FCGR3B Rabbit pAb
A7894-50ul 50 ul
EUR 223

Anti-FCGR3B antibody
STJ110203 100 µl
EUR 277
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.

Anti-FCGR3B antibody
STJ115915 100 µl
EUR 277
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.

Human FCGR3b ELISA Kit
EHF0073 96Tests
EUR 521

Goat FCGR3b ELISA Kit
EGTF0073 96Tests
EUR 521

Bovine FCGR3b ELISA Kit
EBF0073 96Tests
EUR 521

Canine FCGR3b ELISA Kit
ECF0073 96Tests
EUR 521

Chicken FCGR3b ELISA Kit
ECKF0073 96Tests
EUR 521

Anserini FCGR3b ELISA Kit
EAF0073 96Tests
EUR 521

Human FCGR3B ELISA Kit
ELA-E9986h 96 Tests
EUR 824

FCGR3B Polyclonal Conjugated Antibody
C28411 100ul
EUR 397

FCGR3B Polyclonal Conjugated Antibody
C31372 100ul
EUR 397

FCGR3B Antibody, HRP conjugated
1-CSB-PA008544LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FCGR3B Antibody, FITC conjugated
1-CSB-PA008544LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FCGR3B Antibody, Biotin conjugated
1-CSB-PA008544LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human FCGR3B shRNA Plasmid
20-abx951549
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse FCGR3b ELISA Kit
EMF0073 96Tests
EUR 521

Rat FCGR3b ELISA Kit
ERF0073 96Tests
EUR 521

Sheep FCGR3b ELISA Kit
ESF0073 96Tests
EUR 521

Rabbit FCGR3b ELISA Kit
ERTF0073 96Tests
EUR 521

Monkey FCGR3b ELISA Kit
EMKF0073 96Tests
EUR 521

Porcine FCGR3b ELISA Kit
EPF0073 96Tests
EUR 521

FCGR3B Recombinant Protein (Human)
RP039058 100 ug Ask for price

Polyclonal FCGR3B Antibody (N-term)
APR04631G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FCGR3B (N-term). This antibody is tested and proven to work in the following applications:

Guinea Pig FCGR3b ELISA Kit
EGF0073 96Tests
EUR 521

FCGR3B ORF Vector (Human) (pORF)
ORF013020 1.0 ug DNA
EUR 354

FCGR3B CD16b Human Recombinant Protein
PROTO75015 Regular: 10ug
EUR 317
Description: FCGR3B produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 188 amino acids (21-200a.a.) and having a molecular mass of 21.4kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;FCGR3B is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

FCGR3B ELISA Kit (Human) (OKAN05974)
OKAN05974 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.135 ng/mL

FCGR3B ELISA Kit (Human) (OKCD07265)
OKCD07265 96 Wells
EUR 936
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.135ng/mL

FCGR3B sgRNA CRISPR Lentivector set (Human)
K0769801 3 x 1.0 ug
EUR 339

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 1)
K0769802 1.0 ug DNA
EUR 154

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 2)
K0769803 1.0 ug DNA
EUR 154

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 3)
K0769804 1.0 ug DNA
EUR 154

FCGR3B Protein Vector (Human) (pPB-C-His)
PV052077 500 ng
EUR 481

FCGR3B Protein Vector (Human) (pPB-N-His)
PV052078 500 ng
EUR 481

FCGR3B Protein Vector (Human) (pPM-C-HA)
PV052079 500 ng
EUR 481

FCGR3B Protein Vector (Human) (pPM-C-His)
PV052080 500 ng
EUR 481

Recombinant Human FCGR3B Protein, His, Insect-10ug
QP11861-10ug 10ug
EUR 201

Recombinant Human FCGR3B Protein, His, Insect-1mg
QP11861-1mg 1mg
EUR 5251

Recombinant Human FCGR3B Protein, His, Insect-2ug
QP11861-2ug 2ug
EUR 155

FCGR3B 3'UTR GFP Stable Cell Line
TU057835 1.0 ml
EUR 1521

FCGR3B 3'UTR Luciferase Stable Cell Line
TU007835 1.0 ml
EUR 1521

FCGR3B ELISA Kit (Human) : 96 Wells (OKEH02039)
OKEH02039 96 Wells
EUR 727
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-10ug 10ug
EUR 156
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-50ug 50ug
EUR 369
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Fc Fragment of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
20-abx006572
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
20-abx104439
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.