FCGR3B

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit

DLR-FcgR3B-Hu-96T 96T
EUR 647.00
  • Should the Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit

RDR-FcgR3B-Hu-48Tests 48 Tests
EUR 522.00

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit

RDR-FcgR3B-Hu-96Tests 96 Tests
EUR 724.00

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit

RD-FcgR3B-Hu-48Tests 48 Tests
EUR 500.00

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit

RD-FcgR3B-Hu-96Tests 96 Tests
EUR 692.00

FCGR3B Antibody

1-CSB-PA008544LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

FCGR3B siRNA

20-abx916694
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

FCGR3B Polyclonal Antibody

31372-100ul 100ul
EUR 252.00

FCGR3B Polyclonal Antibody

31372-50ul 50ul
EUR 187.00

FCGR3B Polyclonal Antibody

28411-100ul 100ul
EUR 252.00

FCGR3B Polyclonal Antibody

28411-50ul 50ul
EUR 187.00

FCGR3B Rabbit pAb

A13980-100ul 100 ul
EUR 308.00

FCGR3B Rabbit pAb

A13980-200ul 200 ul
EUR 459.00

FCGR3B Rabbit pAb

A13980-20ul 20 ul
EUR 183.00

FCGR3B Rabbit pAb

A13980-50ul 50 ul
EUR 223.00

FCGR3A/FCGR3B Antibody

1-CSB-PA676166
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against FCGR3A/FCGR3B. Recognizes FCGR3A/FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

FCGR3A / FCGR3B Antibody

20-abx323190
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

FCGR3B cloning plasmid

CSB-CL008544HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 702
  • Sequence: ATGTGGCAGCTGCTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACA
  • Show more
Description: A cloning plasmid for the FCGR3B gene.

FCGR3B Rabbit pAb

A7894-100ul 100 ul
EUR 308.00

FCGR3B Rabbit pAb

A7894-200ul 200 ul
EUR 459.00

FCGR3B Rabbit pAb

A7894-20ul 20 ul
EUR 183.00

FCGR3B Rabbit pAb

A7894-50ul 50 ul
EUR 223.00

Anti-FCGR3B antibody

STJ110203 100 µl
EUR 277.00
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.

Anti-FCGR3B antibody

STJ115915 100 µl
EUR 277.00
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.

Human FCGR3b ELISA Kit

EHF0073 96Tests
EUR 521.00

Goat FCGR3b ELISA Kit

EGTF0073 96Tests
EUR 521.00

Bovine FCGR3b ELISA Kit

EBF0073 96Tests
EUR 521.00

Canine FCGR3b ELISA Kit

ECF0073 96Tests
EUR 521.00

Chicken FCGR3b ELISA Kit

ECKF0073 96Tests
EUR 521.00

Anserini FCGR3b ELISA Kit

EAF0073 96Tests
EUR 521.00

Human FCGR3B ELISA Kit

ELA-E9986h 96 Tests
EUR 824.00

FCGR3B Polyclonal Conjugated Antibody

C28411 100ul
EUR 397.00

FCGR3B Polyclonal Conjugated Antibody

C31372 100ul
EUR 397.00

FCGR3B Antibody, HRP conjugated

1-CSB-PA008544LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FCGR3B Antibody, FITC conjugated

1-CSB-PA008544LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FCGR3B Antibody, Biotin conjugated

1-CSB-PA008544LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human FCGR3B shRNA Plasmid

20-abx951549
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse FCGR3b ELISA Kit

EMF0073 96Tests
EUR 521.00

Rat FCGR3b ELISA Kit

ERF0073 96Tests
EUR 521.00

Sheep FCGR3b ELISA Kit

ESF0073 96Tests
EUR 521.00

Rabbit FCGR3b ELISA Kit

ERTF0073 96Tests
EUR 521.00

Monkey FCGR3b ELISA Kit

EMKF0073 96Tests
EUR 521.00

Porcine FCGR3b ELISA Kit

EPF0073 96Tests
EUR 521.00

FCGR3B Recombinant Protein (Human)

RP039058 100 ug Ask for price

Polyclonal FCGR3B Antibody (N-term)

APR04631G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FCGR3B (N-term). This antibody is tested and proven to work in the following applications:

Guinea Pig FCGR3b ELISA Kit

EGF0073 96Tests
EUR 521.00

FCGR3B ORF Vector (Human) (pORF)

ORF013020 1.0 ug DNA
EUR 354.00

FCGR3B CD16b Human Recombinant Protein

PROTO75015 Regular: 10ug
EUR 317.00
Description: FCGR3B produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 188 amino acids (21-200a.a.) and having a molecular mass of 21.4kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;FCGR3B is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

FCGR3B ELISA Kit (Human) (OKAN05974)

OKAN05974 96 Wells
EUR 792.00
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.135 ng/mL

FCGR3B ELISA Kit (Human) (OKCD07265)

OKCD07265 96 Wells
EUR 936.00
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.135ng/mL

FCGR3B sgRNA CRISPR Lentivector set (Human)

K0769801 3 x 1.0 ug
EUR 339.00

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 1)

K0769802 1.0 ug DNA
EUR 154.00

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 2)

K0769803 1.0 ug DNA
EUR 154.00

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 3)

K0769804 1.0 ug DNA
EUR 154.00

FCGR3B Protein Vector (Human) (pPB-C-His)

PV052077 500 ng
EUR 481.00

FCGR3B Protein Vector (Human) (pPB-N-His)

PV052078 500 ng
EUR 481.00

FCGR3B Protein Vector (Human) (pPM-C-HA)

PV052079 500 ng
EUR 481.00

FCGR3B Protein Vector (Human) (pPM-C-His)

PV052080 500 ng
EUR 481.00

Recombinant Human FCGR3B Protein, His, Insect-10ug

QP11861-10ug 10ug
EUR 201.00

Recombinant Human FCGR3B Protein, His, Insect-1mg

QP11861-1mg 1mg
EUR 5251.00

Recombinant Human FCGR3B Protein, His, Insect-2ug

QP11861-2ug 2ug
EUR 155.00

FCGR3B 3'UTR GFP Stable Cell Line

TU057835 1.0 ml
EUR 1521.00

FCGR3B 3'UTR Luciferase Stable Cell Line

TU007835 1.0 ml
EUR 1521.00

FCGR3B ELISA Kit (Human) : 96 Wells (OKEH02039)

OKEH02039 96 Wells
EUR 727.00
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)

CB62-10ug 10ug
EUR 156.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)

CB62-1mg 1mg
EUR 2283.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)

CB62-500ug 500ug
EUR 1613.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)

CB62-50ug 50ug
EUR 369.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Fc Fragment of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody

20-abx006572
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody

20-abx104439
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.