FCGR3B

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
DLR-FcgR3B-Hu-96T	DL Develop	96T	EUR 647.00
Should the Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RDR-FcgR3B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522.00

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RDR-FcgR3B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724.00

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RD-FcgR3B-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500.00

Human Fc Fragment Of IgG Low Affinity IIIb Receptor (FcgR3B) ELISA Kit
RD-FcgR3B-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692.00

FCGR3B Antibody
1-CSB-PA008544LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

FCGR3B siRNA
20-abx916694	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

FCGR3B Polyclonal Antibody
31372-100ul	SAB	100ul	EUR 252.00

FCGR3B Polyclonal Antibody
31372-50ul	SAB	50ul	EUR 187.00

FCGR3B Polyclonal Antibody
28411-100ul	SAB	100ul	EUR 252.00

FCGR3B Polyclonal Antibody
28411-50ul	SAB	50ul	EUR 187.00

FCGR3B Rabbit pAb
A13980-100ul	Abclonal	100 ul	EUR 308.00

FCGR3B Rabbit pAb
A13980-200ul	Abclonal	200 ul	EUR 459.00

FCGR3B Rabbit pAb
A13980-20ul	Abclonal	20 ul	EUR 183.00

FCGR3B Rabbit pAb
A13980-50ul	Abclonal	50 ul	EUR 223.00

FCGR3A/FCGR3B Antibody
1-CSB-PA676166	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. The antibody was affinity-purified from rabbit serum by affinity-chromatography using specific immunogen.
Description: A polyclonal antibody against FCGR3A/FCGR3B. Recognizes FCGR3A/FCGR3B from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC-p:1:50-300, ELISA:1:10000-20000

FCGR3A / FCGR3B Antibody
20-abx323190	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

FCGR3B cloning plasmid
CSB-CL008544HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 702 Sequence: ATGTGGCAGCTGCTCCTCCCAACTGCTCTGCTACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGGTACAGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCACACA Show more
Description: A cloning plasmid for the FCGR3B gene.

FCGR3B Rabbit pAb
A7894-100ul	Abclonal	100 ul	EUR 308.00

FCGR3B Rabbit pAb
A7894-200ul	Abclonal	200 ul	EUR 459.00

FCGR3B Rabbit pAb
A7894-20ul	Abclonal	20 ul	EUR 183.00

FCGR3B Rabbit pAb
A7894-50ul	Abclonal	50 ul	EUR 223.00

Anti-FCGR3B antibody
STJ110203	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.

Anti-FCGR3B antibody
STJ115915	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.

Human FCGR3b ELISA Kit
EHF0073	Abclonal	96Tests	EUR 521.00

Goat FCGR3b ELISA Kit
EGTF0073	Abclonal	96Tests	EUR 521.00

Bovine FCGR3b ELISA Kit
EBF0073	Abclonal	96Tests	EUR 521.00

Canine FCGR3b ELISA Kit
ECF0073	Abclonal	96Tests	EUR 521.00

Chicken FCGR3b ELISA Kit
ECKF0073	Abclonal	96Tests	EUR 521.00

Anserini FCGR3b ELISA Kit
EAF0073	Abclonal	96Tests	EUR 521.00

Human FCGR3B ELISA Kit
ELA-E9986h	Lifescience Market	96 Tests	EUR 824.00

FCGR3B Polyclonal Conjugated Antibody
C28411	SAB	100ul	EUR 397.00

FCGR3B Polyclonal Conjugated Antibody
C31372	SAB	100ul	EUR 397.00

FCGR3B Antibody, HRP conjugated
1-CSB-PA008544LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

FCGR3B Antibody, FITC conjugated
1-CSB-PA008544LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

FCGR3B Antibody, Biotin conjugated
1-CSB-PA008544LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against FCGR3B. Recognizes FCGR3B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human FCGR3B shRNA Plasmid
20-abx951549	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse FCGR3b ELISA Kit
EMF0073	Abclonal	96Tests	EUR 521.00

Rat FCGR3b ELISA Kit
ERF0073	Abclonal	96Tests	EUR 521.00

Sheep FCGR3b ELISA Kit
ESF0073	Abclonal	96Tests	EUR 521.00

Rabbit FCGR3b ELISA Kit
ERTF0073	Abclonal	96Tests	EUR 521.00

Monkey FCGR3b ELISA Kit
EMKF0073	Abclonal	96Tests	EUR 521.00

Porcine FCGR3b ELISA Kit
EPF0073	Abclonal	96Tests	EUR 521.00

FCGR3B Recombinant Protein (Human)
RP039058	ABM	100 ug	Ask for price

Polyclonal FCGR3B Antibody (N-term)
APR04631G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human FCGR3B (N-term). This antibody is tested and proven to work in the following applications:

Guinea Pig FCGR3b ELISA Kit
EGF0073	Abclonal	96Tests	EUR 521.00

FCGR3B ORF Vector (Human) (pORF)
ORF013020	ABM	1.0 ug DNA	EUR 354.00

FCGR3B CD16b Human Recombinant Protein
PROTO75015	BosterBio	Regular: 10ug	EUR 317.00
Description: FCGR3B produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 188 amino acids (21-200a.a.) and having a molecular mass of 21.4kDa. (Molecular size on SDS-PAGE will appear at approximately 28-40kDa).;FCGR3B is expressed with an 8 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

FCGR3B ELISA Kit (Human) (OKAN05974)
OKAN05974	Aviva Systems Biology	96 Wells	EUR 792.00
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.135 ng/mL

FCGR3B ELISA Kit (Human) (OKCD07265)
OKCD07265	Aviva Systems Biology	96 Wells	EUR 936.00
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.135ng/mL

FCGR3B sgRNA CRISPR Lentivector set (Human)
K0769801	ABM	3 x 1.0 ug	EUR 339.00

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 1)
K0769802	ABM	1.0 ug DNA	EUR 154.00

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 2)
K0769803	ABM	1.0 ug DNA	EUR 154.00

FCGR3B sgRNA CRISPR Lentivector (Human) (Target 3)
K0769804	ABM	1.0 ug DNA	EUR 154.00

FCGR3B Protein Vector (Human) (pPB-C-His)
PV052077	ABM	500 ng	EUR 481.00

FCGR3B Protein Vector (Human) (pPB-N-His)
PV052078	ABM	500 ng	EUR 481.00

FCGR3B Protein Vector (Human) (pPM-C-HA)
PV052079	ABM	500 ng	EUR 481.00

FCGR3B Protein Vector (Human) (pPM-C-His)
PV052080	ABM	500 ng	EUR 481.00

Recombinant Human FCGR3B Protein, His, Insect-10ug
QP11861-10ug	EnQuireBio	10ug	EUR 201.00

Recombinant Human FCGR3B Protein, His, Insect-1mg
QP11861-1mg	EnQuireBio	1mg	EUR 5251.00

Recombinant Human FCGR3B Protein, His, Insect-2ug
QP11861-2ug	EnQuireBio	2ug	EUR 155.00

FCGR3B 3'UTR GFP Stable Cell Line
TU057835	ABM	1.0 ml	EUR 1521.00

FCGR3B 3'UTR Luciferase Stable Cell Line
TU007835	ABM	1.0 ml	EUR 1521.00

FCGR3B ELISA Kit (Human) : 96 Wells (OKEH02039)
OKEH02039	Aviva Systems Biology	96 Wells	EUR 727.00
Description: Description of target: The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.11 ng/mL

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-10ug	Novoprotein	10ug	EUR 156.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-1mg	Novoprotein	1mg	EUR 2283.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-500ug	Novoprotein	500ug	EUR 1613.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Recombinant Human Fc γ RIIIB/FCGR3B/CD16b (C-6His)
CB62-50ug	Novoprotein	50ug	EUR 369.00
Description: Lyophilized from a 0.2 μm filtered solution of PBS, pH7.4.

Fc Fragment of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
20-abx006572	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Fc Fragment Of IgG Low Affinity IIIb Receptor (FCGR3B) Antibody
20-abx104439	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	0 1 2 3 4
Shipped within 5-7 working days.