GGCX

GGCX antibody
70R-17470	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal GGCX antibody

GGCX Antibody
36501-100ul	SAB	100ul	EUR 252.00

GGCX Antibody
1-CSB-PA962996	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GGCX Antibody
DF12616	Affbiotech	200ul	EUR 304.00
Description: GGCX Antibody detects endogenous levels of GGCX.

GGCX Antibody
1-CSB-PA181894	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

GGCX antibody
70R-6289	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal GGCX antibody raised against the middle region of GGCX

GGCX Antibody
1-CSB-PA009388GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GGCX Antibody
1-CSB-PA009388LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GGCX siRNA
20-abx902134	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GGCX siRNA
20-abx917820	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GGCX siRNA
20-abx917821	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-GGCX
YF-PA23776	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to GGCX

GGCX Blocking Peptide
33R-2973	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GGCX antibody, catalog no. 70R-6289

GGCX Blocking Peptide
DF12616-BP	Affbiotech	1mg	EUR 195.00

GGCX Conjugated Antibody
C36501	SAB	100ul	EUR 397.00

GGCX cloning plasmid
CSB-CL009388HU-10ug	Cusabio	10ug	EUR 474.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2277 Sequence: atggcggtgtctgccgggtccgcgcggacctcgcccagctcagataaagtacagaaagacaaggctgaactgatctcagggcccaggcaggacagccgaatagggaaactcttgggttttgagtggacagatttgtccagttggcggaggctggtgaccctgctgaatcgaccaa Show more
Description: A cloning plasmid for the GGCX gene.

GGCX Rabbit pAb
A1806-100ul	Abclonal	100 ul	EUR 308.00

GGCX Rabbit pAb
A1806-200ul	Abclonal	200 ul	EUR 459.00

GGCX Rabbit pAb
A1806-20ul	Abclonal	20 ul	EUR 183.00

GGCX Rabbit pAb
A1806-50ul	Abclonal	50 ul	EUR 223.00

anti- GGCX antibody
FNab03444	FN Test	100µg	EUR 505.25
Immunogen: gamma-glutamyl carboxylase Uniprot ID: P38435 Gene ID: 2677 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GGCX

Anti-GGCX antibody
PAab03444	Lifescience Market	100 ug	EUR 355.00

Anti-GGCX antibody
STJ111114	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.

Anti-GGCX Antibody
STJ501151	St John's Laboratory	100 µg	EUR 476.00

Anti-GGCX antibody
STJ71959	St John's Laboratory	100 µg	EUR 359.00

GGCX ELISA KIT|Human
EF009845	Lifescience Market	96 Tests	EUR 689.00

Mouse GGCX shRNA Plasmid
20-abx974692	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat GGCX shRNA Plasmid
20-abx986662	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GGCX Antibody, HRP conjugated
1-CSB-PA009388LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GGCX Antibody, FITC conjugated
1-CSB-PA009388LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GGCX Antibody, Biotin conjugated
1-CSB-PA009388LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GGCX shRNA Plasmid
20-abx951786	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GGCX Recombinant Protein (Human)
RP013150	ABM	100 ug	Ask for price

GGCX Recombinant Protein (Rat)
RP202541	ABM	100 ug	Ask for price

GGCX Recombinant Protein (Mouse)
RP136367	ABM	100 ug	Ask for price

Anti-GGCX Antibody (Biotin)
STJ501152	St John's Laboratory	100 µg	EUR 586.00

Anti-GGCX Antibody (FITC)
STJ501153	St John's Laboratory	100 µg	EUR 586.00

Polyclonal GGCX Antibody (C-Term)
APG00603G	Leading Biology	0.1mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GGCX (C-Term). This antibody is tested and proven to work in the following applications:

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx026095-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx026095-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx214843	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx112671	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx124056	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx242121	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

Polyclonal GGCX Antibody (C-Terminus)
APG01214G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GGCX (C-Terminus). This antibody is tested and proven to work in the following applications:

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx233444-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody
20-abx334131	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody
abx432743-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

Ggcx ORF Vector (Rat) (pORF)
ORF067515	ABM	1.0 ug DNA	EUR 506.00

GGCX ORF Vector (Human) (pORF)
ORF004384	ABM	1.0 ug DNA	EUR 95.00

Ggcx ORF Vector (Mouse) (pORF)
ORF045457	ABM	1.0 ug DNA	EUR 506.00

pECMV-Ggcx-m-FLAG Plasmid
PVT15269	Lifescience Market	2 ug	EUR 325.00

GGCX ELISA Kit (Human) (OKEH08326)
OKEH08326	Aviva Systems Biology	96 Wells	EUR 896.00
Description: Description of target: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9pg/mL

GGCX ELISA Kit (Rat) (OKEH08327)
OKEH08327	Aviva Systems Biology	96 Wells	EUR 896.00
Description: Description of target: catalyzes the posttranslational modification of glutamate to gamma-carboxyglutamate (Gla); may mediate functions of vitamin K-dependent proteins (VKDPs) [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.068ng/mL

Gamma-Glutamyl Carboxylase (GGCX) Antibody (HRP)
20-abx338281	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (FITC)
20-abx338282	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (Biotin)
20-abx338283	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Ggcx sgRNA CRISPR Lentivector set (Rat)
K6943501	ABM	3 x 1.0 ug	EUR 339.00

Ggcx sgRNA CRISPR Lentivector set (Mouse)
K4585301	ABM	3 x 1.0 ug	EUR 339.00

GGCX sgRNA CRISPR Lentivector set (Human)
K0853901	ABM	3 x 1.0 ug	EUR 339.00