GGCX siRNA

20-abx902134
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GGCX siRNA

20-abx917820
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GGCX siRNA

20-abx917821
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GGCX antibody

70R-6289 50 ug
EUR 467
Description: Rabbit polyclonal GGCX antibody raised against the middle region of GGCX

GGCX Antibody

36501-100ul 100ul
EUR 252

GGCX antibody

70R-17470 50 ul
EUR 435
Description: Rabbit polyclonal GGCX antibody

GGCX Antibody

1-CSB-PA962996
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

GGCX Antibody

DF12616 200ul
EUR 304
Description: GGCX Antibody detects endogenous levels of GGCX.

GGCX Antibody

1-CSB-PA009388GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GGCX Antibody

1-CSB-PA009388LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GGCX Antibody

1-CSB-PA181894
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

anti-GGCX

YF-PA23776 50 ul
EUR 334
Description: Mouse polyclonal to GGCX

GGCX Conjugated Antibody

C36501 100ul
EUR 397

GGCX cloning plasmid

CSB-CL009388HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2277
  • Sequence: atggcggtgtctgccgggtccgcgcggacctcgcccagctcagataaagtacagaaagacaaggctgaactgatctcagggcccaggcaggacagccgaatagggaaactcttgggttttgagtggacagatttgtccagttggcggaggctggtgaccctgctgaatcgaccaa
  • Show more
Description: A cloning plasmid for the GGCX gene.

anti- GGCX antibody

FNab03444 100µg
EUR 505.25
  • Immunogen: gamma-glutamyl carboxylase
  • Uniprot ID: P38435
  • Gene ID: 2677
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against GGCX

GGCX Rabbit pAb

A1806-100ul 100 ul
EUR 308

GGCX Rabbit pAb

A1806-200ul 200 ul
EUR 459

GGCX Rabbit pAb

A1806-20ul 20 ul
EUR 183

GGCX Rabbit pAb

A1806-50ul 50 ul
EUR 223

GGCX Blocking Peptide

33R-2973 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GGCX antibody, catalog no. 70R-6289

GGCX Blocking Peptide

DF12616-BP 1mg
EUR 195

Anti-GGCX antibody

PAab03444 100 ug
EUR 355

Anti-GGCX Antibody

STJ501151 100 µg
EUR 476

Anti-GGCX antibody

STJ71959 100 µg
EUR 359

Anti-GGCX antibody

STJ111114 100 µl
EUR 277
Description: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.

Mouse GGCX shRNA Plasmid

20-abx974692
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat GGCX shRNA Plasmid

20-abx986662
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GGCX ELISA KIT|Human

EF009845 96 Tests
EUR 689

Human GGCX shRNA Plasmid

20-abx951786
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GGCX Antibody, HRP conjugated

1-CSB-PA009388LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GGCX Antibody, FITC conjugated

1-CSB-PA009388LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GGCX Antibody, Biotin conjugated

1-CSB-PA009388LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GGCX. Recognizes GGCX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GGCX Recombinant Protein (Human)

RP013150 100 ug Ask for price

GGCX Recombinant Protein (Rat)

RP202541 100 ug Ask for price

GGCX Recombinant Protein (Mouse)

RP136367 100 ug Ask for price

Anti-GGCX Antibody (Biotin)

STJ501152 100 µg
EUR 586

Anti-GGCX Antibody (FITC)

STJ501153 100 µg
EUR 586

Polyclonal GGCX Antibody (C-Term)

APG00603G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GGCX (C-Term). This antibody is tested and proven to work in the following applications:

Polyclonal GGCX Antibody (C-Terminus)

APG01214G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GGCX (C-Terminus). This antibody is tested and proven to work in the following applications:

gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx124056
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx112671
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx026095-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx026095-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx214843
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx334131
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx432743-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody

20-abx242121
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

gamma-Glutamyl Carboxylase (GGCX) Antibody

abx233444-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

GGCX ORF Vector (Human) (pORF)

ORF004384 1.0 ug DNA
EUR 95

Ggcx ORF Vector (Rat) (pORF)

ORF067515 1.0 ug DNA
EUR 506

Ggcx ORF Vector (Mouse) (pORF)

ORF045457 1.0 ug DNA
EUR 506

pECMV-Ggcx-m-FLAG Plasmid

PVT15269 2 ug
EUR 325

GGCX ELISA Kit (Human) (OKEH08326)

OKEH08326 96 Wells
EUR 896
Description: Description of target: This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.9pg/mL

GGCX ELISA Kit (Rat) (OKEH08327)

OKEH08327 96 Wells
EUR 896
Description: Description of target: catalyzes the posttranslational modification of glutamate to gamma-carboxyglutamate (Gla); may mediate functions of vitamin K-dependent proteins (VKDPs) [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.068ng/mL

GGCX sgRNA CRISPR Lentivector set (Human)

K0853901 3 x 1.0 ug
EUR 339

Gamma-Glutamyl Carboxylase (GGCX) Antibody (HRP)

20-abx338281
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (FITC)

20-abx338282
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Gamma-Glutamyl Carboxylase (GGCX) Antibody (Biotin)

20-abx338283
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ggcx sgRNA CRISPR Lentivector set (Mouse)

K4585301 3 x 1.0 ug
EUR 339

Ggcx sgRNA CRISPR Lentivector set (Rat)

K6943501 3 x 1.0 ug
EUR 339