GNAO1

GNAO1 siRNA
20-abx902215	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAO1 siRNA
20-abx918150	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAO1 siRNA
20-abx918151	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNAO1 antibody
70R-5233	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal GNAO1 antibody

GNAO1 antibody
70R-5236	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal GNAO1 antibody raised against the middle region of Gnao1

GNAO1 Antibody
ABD6975	Lifescience Market	100 ug	EUR 438.00

GNAO1 Antibody
43020-100ul	SAB	100ul	EUR 252.00

GNAO1 Antibody
32682-100ul	SAB	100ul	EUR 252.00

GNAO1 antibody
70R-17522	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal GNAO1 antibody

GNAO1 Antibody
DF6975	Affbiotech	200ul	EUR 304.00
Description: GNAO1 Antibody detects endogenous levels of total GNAO1.

GNAO1 Antibody
1-CSB-PA009593DSR2HU	Cusabio	EUR 222.00 EUR 335.00	0 1
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNAO1. Recognizes GNAO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNAO1 Antibody
1-CSB-PA009593GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAO1. Recognizes GNAO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Gnao1 Antibody
1-CSB-PA009593LA01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

GNAO1 Conjugated Antibody
C43020	SAB	100ul	EUR 397.00

GNAO1 Conjugated Antibody
C32682	SAB	100ul	EUR 397.00

GNAO1 cloning plasmid
CSB-CL009593HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 909 Sequence: atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggt Show more
Description: A cloning plasmid for the GNAO1 gene.

anti- GNAO1 antibody
FNab03534	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O Uniprot ID: P09471 Gene ID: 2775 Research Area: Signal Transduction
Description: Antibody raised against GNAO1

Gnao1 Polyclonal Antibody
A55105	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GNAO1 Rabbit pAb
A2510-100ul	Abclonal	100 ul	EUR 308.00

GNAO1 Rabbit pAb
A2510-200ul	Abclonal	200 ul	EUR 459.00

GNAO1 Rabbit pAb
A2510-20ul	Abclonal	20 ul	EUR 183.00

GNAO1 Rabbit pAb
A2510-50ul	Abclonal	50 ul	EUR 223.00

GNAO1 Blocking Peptide
33R-1672	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAO1 antibody, catalog no. 70R-5236

GNAO1 Blocking Peptide
33R-7429	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAO1 antibody, catalog no. 70R-5233

GNAO1 Blocking Peptide
DF6975-BP	Affbiotech	1mg	EUR 195.00

Anti-GNAO1 antibody
PAab03534	Lifescience Market	100 ug	EUR 355.00

Anti-GNAO1 antibody
STJ23814	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have been found for this gene.

Rat GNAO1 shRNA Plasmid
20-abx985748	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GNAO1 ELISA KIT|Human
EF009909	Lifescience Market	96 Tests	EUR 689.00

Human GNAO1 ELISA KIT
ELI-43679h	Lifescience Market	96 Tests	EUR 824.00

Mouse Gnao1 ELISA KIT
ELI-31793m	Lifescience Market	96 Tests	EUR 865.00

Bovine GNAO1 ELISA KIT
ELI-48019b	Lifescience Market	96 Tests	EUR 928.00

Mouse GNAO1 shRNA Plasmid
20-abx970578	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GNAO1 shRNA Plasmid
20-abx951845	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Gnao1 Antibody, HRP conjugated
1-CSB-PA009593LB01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Gnao1 Antibody, FITC conjugated
1-CSB-PA009593LC01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Gnao1 Antibody, Biotin conjugated
1-CSB-PA009593LD01MO	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNAO1 Recombinant Protein (Human)
RP013480	ABM	100 ug	Ask for price

GNAO1 Recombinant Protein (Rat)
RP202955	ABM	100 ug	Ask for price

GNAO1 Recombinant Protein (Mouse)
RP138911	ABM	100 ug	Ask for price

GNAO1 Recombinant Protein (Mouse)
RP138914	ABM	100 ug	Ask for price

Polyclonal GNAO1 Antibody (C-term)
APR14113G	Leading Biology	0.1ml	EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAO1 (C-term). This antibody is tested and proven to work in the following applications:

Gnao1 Polyclonal Antibody, Biotin Conjugated
A57849	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

Gnao1 Polyclonal Antibody, FITC Conjugated
A55103	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Gnao1 Polyclonal Antibody, HRP Conjugated
A55104	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

GNAO1 ORF Vector (Human) (pORF)
ORF004494	ABM	1.0 ug DNA	EUR 95.00

Gnao1 ORF Vector (Rat) (pORF)
ORF067653	ABM	1.0 ug DNA	EUR 506.00

Gnao1 ORF Vector (Mouse) (pORF)
ORF046305	ABM	1.0 ug DNA	EUR 506.00

Gnao1 ORF Vector (Mouse) (pORF)
ORF046306	ABM	1.0 ug DNA	EUR 506.00

GNAO1 sgRNA CRISPR Lentivector set (Human)
K0875001	ABM	3 x 1.0 ug	EUR 339.00

Gnao1 sgRNA CRISPR Lentivector set (Mouse)
K4721701	ABM	3 x 1.0 ug	EUR 339.00

Gnao1 sgRNA CRISPR Lentivector set (Rat)
K6872701	ABM	3 x 1.0 ug	EUR 339.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0875002	ABM	1.0 ug DNA	EUR 154.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0875003	ABM	1.0 ug DNA	EUR 154.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0875004	ABM	1.0 ug DNA	EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4721702	ABM	1.0 ug DNA	EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4721703	ABM	1.0 ug DNA	EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4721704	ABM	1.0 ug DNA	EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6872702	ABM	1.0 ug DNA	EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6872703	ABM	1.0 ug DNA	EUR 154.00