GNAO1 antibody

70R-17522 50 ul
EUR 435.00
Description: Rabbit polyclonal GNAO1 antibody

GNAO1 Antibody

32682-100ul 100ul
EUR 252.00

GNAO1 Antibody

43020-100ul 100ul
EUR 252.00

GNAO1 Antibody

DF6975 200ul
EUR 304.00
Description: GNAO1 Antibody detects endogenous levels of total GNAO1.

GNAO1 antibody

70R-5233 50 ug
EUR 467.00
Description: Rabbit polyclonal GNAO1 antibody

GNAO1 antibody

70R-5236 50 ug
EUR 467.00
Description: Rabbit polyclonal GNAO1 antibody raised against the middle region of Gnao1

GNAO1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GNAO1. Recognizes GNAO1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GNAO1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNAO1. Recognizes GNAO1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Gnao1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNAO1 Antibody

ABD6975 100 ug
EUR 438.00

GNAO1 Blocking Peptide

33R-1672 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAO1 antibody, catalog no. 70R-5236

GNAO1 Blocking Peptide

33R-7429 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GNAO1 antibody, catalog no. 70R-5233

GNAO1 Blocking Peptide

DF6975-BP 1mg
EUR 195.00

GNAO1 Conjugated Antibody

C43020 100ul
EUR 397.00

GNAO1 Conjugated Antibody

C32682 100ul
EUR 397.00

GNAO1 cloning plasmid

CSB-CL009593HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atgaagatcatccatgaagatggcttctccggagaagacgtgaaacagtacaagcctgttgtctacagcaacactatccagtccctggcagccatcgtccgggccatggacactttgggcatcgaatatggtgataaggagagaaaggctgacgccaagatggtgtgtgatgtggt
  • Show more
Description: A cloning plasmid for the GNAO1 gene.

Gnao1 Polyclonal Antibody

A55105 100 µg
EUR 570.55
Description: Ask the seller for details

GNAO1 Rabbit pAb

A2510-100ul 100 ul
EUR 308.00

GNAO1 Rabbit pAb

A2510-200ul 200 ul
EUR 459.00

GNAO1 Rabbit pAb

A2510-20ul 20 ul
EUR 183.00

GNAO1 Rabbit pAb

A2510-50ul 50 ul
EUR 223.00

anti- GNAO1 antibody

FNab03534 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O
  • Uniprot ID: P09471
  • Gene ID: 2775
  • Research Area: Signal Transduction
Description: Antibody raised against GNAO1

Anti-GNAO1 antibody

PAab03534 100 ug
EUR 355.00

Anti-GNAO1 antibody

STJ23814 100 µl
EUR 277.00
Description: The protein encoded by this gene represents the alpha subunit of the Go heterotrimeric G-protein signal-transducing complex. Defects in this gene are a cause of early-onset epileptic encephalopathy. Two transcript variants encoding different isoforms have been found for this gene.


EF009909 96 Tests
EUR 689.00


ELI-43679h 96 Tests
EUR 824.00

Rat GNAO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Gnao1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA

Gnao1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA

Gnao1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Gnao1. Recognizes Gnao1 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNAO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse GNAO1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Gnao1 ELISA KIT

ELI-31793m 96 Tests
EUR 865.00


ELI-48019b 96 Tests
EUR 928.00

GNAO1 Recombinant Protein (Human)

RP013480 100 ug Ask for price

GNAO1 Recombinant Protein (Rat)

RP202955 100 ug Ask for price

GNAO1 Recombinant Protein (Mouse)

RP138911 100 ug Ask for price

GNAO1 Recombinant Protein (Mouse)

RP138914 100 ug Ask for price

Polyclonal GNAO1 Antibody (C-term)

APR14113G 0.1ml
EUR 528.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNAO1 (C-term). This antibody is tested and proven to work in the following applications:

Gnao1 Polyclonal Antibody, Biotin Conjugated

A57849 100 µg
EUR 570.55
Description: kits suitable for this type of research

Gnao1 Polyclonal Antibody, FITC Conjugated

A55103 100 µg
EUR 570.55
Description: Ask the seller for details

Gnao1 Polyclonal Antibody, HRP Conjugated

A55104 100 µg
EUR 570.55
Description: The best epigenetics products

Gnao1 ORF Vector (Rat) (pORF)

ORF067653 1.0 ug DNA
EUR 506.00

GNAO1 ORF Vector (Human) (pORF)

ORF004494 1.0 ug DNA
EUR 95.00

Gnao1 ORF Vector (Mouse) (pORF)

ORF046305 1.0 ug DNA
EUR 506.00

Gnao1 ORF Vector (Mouse) (pORF)

ORF046306 1.0 ug DNA
EUR 506.00

Gnao1 sgRNA CRISPR Lentivector set (Rat)

K6872701 3 x 1.0 ug
EUR 339.00

GNAO1 sgRNA CRISPR Lentivector set (Human)

K0875001 3 x 1.0 ug
EUR 339.00

Gnao1 sgRNA CRISPR Lentivector set (Mouse)

K4721701 3 x 1.0 ug
EUR 339.00

Gnao1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6872702 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6872703 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6872704 1.0 ug DNA
EUR 154.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0875002 1.0 ug DNA
EUR 154.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 2)

K0875003 1.0 ug DNA
EUR 154.00

GNAO1 sgRNA CRISPR Lentivector (Human) (Target 3)

K0875004 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4721702 1.0 ug DNA
EUR 154.00

Gnao1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4721703 1.0 ug DNA
EUR 154.00