GNG11

GNG11 Antibody
44667-100ul	SAB	100ul	EUR 252.00

GNG11 Antibody
44667-50ul	SAB	50ul	EUR 187.00

GNG11 Antibody
DF2206	Affbiotech	200ul	EUR 304.00
Description: GNG11 antibody detects endogenous levels of total GNG11.

GNG11 Antibody
1-CSB-PA009611LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GNG11 siRNA
20-abx902226	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNG11 siRNA
20-abx918188	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNG11 siRNA
20-abx918189	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GNG11 Antibody
ABD2206	Lifescience Market	100 ug	EUR 438.00

anti-GNG11
YF-PA12066	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to GNG11

anti-GNG11
YF-PA23797	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to GNG11

Human GNG11 Antibody
32692-05111	AssayPro	150 ug	EUR 261.00

GNG11 Blocking Peptide
DF2206-BP	Affbiotech	1mg	EUR 195.00

GNG11 Conjugated Antibody
C44667	SAB	100ul	EUR 397.00

GNG11 Antibody (HRP)
20-abx304013	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNG11 Antibody (FITC)
20-abx304014	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNG11 Antibody (Biotin)
20-abx304015	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

GNG11 cloning plasmid
CSB-CL009611HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 222 Sequence: atgcctgcccttcacatcgaagatttgccagagaaggaaaaactgaaaatggaagttgagcagcttcgcaaagaagtgaagttgcagagacaacaagtgtctaaatgttctgaagaaataaagaactatattgaagaacgttctggagaggatcctctagtaaagggaattccaga Show more
Description: A cloning plasmid for the GNG11 gene.

GNG11 Polyclonal Antibody
A62670	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

pCMV-SPORT6-GNG11
PVT13249	Lifescience Market	2 ug	EUR 391.00

Anti-GNG11 (2H5)
YF-MA13279	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to GNG11

GNG11 protein (His tag)
80R-3666	Fitzgerald	100 ug	EUR 327.00
Description: Purified recombinant GNG11 protein (His tag)

Bovine GNG11 ELISA KIT
ELI-26649b	Lifescience Market	96 Tests	EUR 928.00

Mouse Gng11 ELISA KIT
ELI-26650m	Lifescience Market	96 Tests	EUR 865.00

Mouse GNG11 shRNA Plasmid
20-abx975374	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat GNG11 shRNA Plasmid
20-abx986184	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GNG11 Antibody, HRP conjugated
1-CSB-PA009611LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG11 Antibody, FITC conjugated
1-CSB-PA009611LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG11 Antibody, Biotin conjugated
1-CSB-PA009611LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNG11 shRNA Plasmid
20-abx951862	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GNG11 ELISA KIT
ELI-37685h	Lifescience Market	96 Tests	EUR 824.00

GNG11 Recombinant Protein (Human)
RP013537	ABM	100 ug	Ask for price

GNG11 Recombinant Protein (Rat)
RP203012	ABM	100 ug	Ask for price

GNG11 Recombinant Protein (Mouse)
RP138998	ABM	100 ug	Ask for price

Human GNG11 Antibody (Biotin Conjugate)
32692-05121	AssayPro	150 ug	EUR 369.00

GNG11 Polyclonal Antibody, HRP Conjugated
A62671	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GNG11 Polyclonal Antibody, FITC Conjugated
A62672	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

GNG11 Polyclonal Antibody, Biotin Conjugated
A62673	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Gng11 ORF Vector (Rat) (pORF)
ORF067672	ABM	1.0 ug DNA	EUR 506.00

GNG11 ORF Vector (Human) (pORF)
ORF004513	ABM	1.0 ug DNA	EUR 95.00

Gng11 ORF Vector (Mouse) (pORF)
ORF046334	ABM	1.0 ug DNA	EUR 506.00

Human GNG11 AssayLite Antibody (FITC Conjugate)
32692-05141	AssayPro	150 ug	EUR 428.00

Human GNG11 AssayLite Antibody (RPE Conjugate)
32692-05151	AssayPro	150 ug	EUR 428.00

Human GNG11 AssayLite Antibody (APC Conjugate)
32692-05161	AssayPro	150 ug	EUR 428.00

Human GNG11 AssayLite Antibody (PerCP Conjugate)
32692-05171	AssayPro	150 ug	EUR 471.00

Gng11 sgRNA CRISPR Lentivector set (Rat)
K6977801	ABM	3 x 1.0 ug	EUR 339.00

Gng11 sgRNA CRISPR Lentivector set (Mouse)
K3659501	ABM	3 x 1.0 ug	EUR 339.00

GNG11 sgRNA CRISPR Lentivector set (Human)
K0877801	ABM	3 x 1.0 ug	EUR 339.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6977802	ABM	1.0 ug DNA	EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6977803	ABM	1.0 ug DNA	EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6977804	ABM	1.0 ug DNA	EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3659502	ABM	1.0 ug DNA	EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3659503	ABM	1.0 ug DNA	EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3659504	ABM	1.0 ug DNA	EUR 154.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 1)
K0877802	ABM	1.0 ug DNA	EUR 154.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 2)
K0877803	ABM	1.0 ug DNA	EUR 154.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 3)
K0877804	ABM	1.0 ug DNA	EUR 154.00

GNG11 Protein Vector (Rat) (pPB-C-His)
PV270686	ABM	500 ng	EUR 603.00

GNG11 Protein Vector (Rat) (pPB-N-His)
PV270687	ABM	500 ng	EUR 603.00

GNG11 Protein Vector (Rat) (pPM-C-HA)
PV270688	ABM	500 ng	EUR 603.00

GNG11 Protein Vector (Rat) (pPM-C-His)
PV270689	ABM	500 ng	EUR 603.00