In den Nachrichten

GNG11

GNG11 Antibody

44667-100ul 100ul
EUR 252.00

GNG11 Antibody

44667-50ul 50ul
EUR 187.00

GNG11 Antibody

DF2206 200ul
EUR 304.00
Description: GNG11 antibody detects endogenous levels of total GNG11.

GNG11 Antibody

1-CSB-PA009611LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GNG11 siRNA

20-abx902226
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG11 siRNA

20-abx918188
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG11 siRNA

20-abx918189
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG11 Antibody

ABD2206 100 ug
EUR 438.00

anti-GNG11

YF-PA12066 50 ug
EUR 363.00
Description: Mouse polyclonal to GNG11

anti-GNG11

YF-PA23797 50 ul
EUR 334.00
Description: Mouse polyclonal to GNG11

Human GNG11 Antibody

32692-05111 150 ug
EUR 261.00

GNG11 Blocking Peptide

DF2206-BP 1mg
EUR 195.00

GNG11 Conjugated Antibody

C44667 100ul
EUR 397.00

GNG11 Antibody (HRP)

20-abx304013
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNG11 Antibody (FITC)

20-abx304014
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNG11 Antibody (Biotin)

20-abx304015
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

GNG11 cloning plasmid

CSB-CL009611HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 222
  • Sequence: atgcctgcccttcacatcgaagatttgccagagaaggaaaaactgaaaatggaagttgagcagcttcgcaaagaagtgaagttgcagagacaacaagtgtctaaatgttctgaagaaataaagaactatattgaagaacgttctggagaggatcctctagtaaagggaattccaga
  • Show more
Description: A cloning plasmid for the GNG11 gene.

GNG11 Polyclonal Antibody

A62670 100 µg
EUR 570.55
Description: fast delivery possible

pCMV-SPORT6-GNG11

PVT13249 2 ug
EUR 391.00

Anti-GNG11 (2H5)

YF-MA13279 100 ug
EUR 363.00
Description: Mouse monoclonal to GNG11

GNG11 protein (His tag)

80R-3666 100 ug
EUR 327.00
Description: Purified recombinant GNG11 protein (His tag)

Bovine GNG11 ELISA KIT

ELI-26649b 96 Tests
EUR 928.00

Mouse Gng11 ELISA KIT

ELI-26650m 96 Tests
EUR 865.00

Mouse GNG11 shRNA Plasmid

20-abx975374
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat GNG11 shRNA Plasmid

20-abx986184
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GNG11 Antibody, HRP conjugated

1-CSB-PA009611LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG11 Antibody, FITC conjugated

1-CSB-PA009611LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG11 Antibody, Biotin conjugated

1-CSB-PA009611LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG11. Recognizes GNG11 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNG11 shRNA Plasmid

20-abx951862
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GNG11 ELISA KIT

ELI-37685h 96 Tests
EUR 824.00

GNG11 Recombinant Protein (Human)

RP013537 100 ug Ask for price

GNG11 Recombinant Protein (Rat)

RP203012 100 ug Ask for price

GNG11 Recombinant Protein (Mouse)

RP138998 100 ug Ask for price

Human GNG11 Antibody (Biotin Conjugate)

32692-05121 150 ug
EUR 369.00

GNG11 Polyclonal Antibody, HRP Conjugated

A62671 100 µg
EUR 570.55
Description: reagents widely cited

GNG11 Polyclonal Antibody, FITC Conjugated

A62672 100 µg
EUR 570.55
Description: Ask the seller for details

GNG11 Polyclonal Antibody, Biotin Conjugated

A62673 100 µg
EUR 570.55
Description: The best epigenetics products

Gng11 ORF Vector (Rat) (pORF)

ORF067672 1.0 ug DNA
EUR 506.00

GNG11 ORF Vector (Human) (pORF)

ORF004513 1.0 ug DNA
EUR 95.00

Gng11 ORF Vector (Mouse) (pORF)

ORF046334 1.0 ug DNA
EUR 506.00

Human GNG11 AssayLite Antibody (FITC Conjugate)

32692-05141 150 ug
EUR 428.00

Human GNG11 AssayLite Antibody (RPE Conjugate)

32692-05151 150 ug
EUR 428.00

Human GNG11 AssayLite Antibody (APC Conjugate)

32692-05161 150 ug
EUR 428.00

Human GNG11 AssayLite Antibody (PerCP Conjugate)

32692-05171 150 ug
EUR 471.00

Gng11 sgRNA CRISPR Lentivector set (Rat)

K6977801 3 x 1.0 ug
EUR 339.00

Gng11 sgRNA CRISPR Lentivector set (Mouse)

K3659501 3 x 1.0 ug
EUR 339.00

GNG11 sgRNA CRISPR Lentivector set (Human)

K0877801 3 x 1.0 ug
EUR 339.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6977802 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6977803 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6977804 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3659502 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3659503 1.0 ug DNA
EUR 154.00

Gng11 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3659504 1.0 ug DNA
EUR 154.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 1)

K0877802 1.0 ug DNA
EUR 154.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 2)

K0877803 1.0 ug DNA
EUR 154.00

GNG11 sgRNA CRISPR Lentivector (Human) (Target 3)

K0877804 1.0 ug DNA
EUR 154.00

GNG11 Protein Vector (Rat) (pPB-C-His)

PV270686 500 ng
EUR 603.00

GNG11 Protein Vector (Rat) (pPB-N-His)

PV270687 500 ng
EUR 603.00

GNG11 Protein Vector (Rat) (pPM-C-HA)

PV270688 500 ng
EUR 603.00

GNG11 Protein Vector (Rat) (pPM-C-His)

PV270689 500 ng
EUR 603.00