GNG4

GNG4 siRNA

20-abx918198
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG4 siRNA

20-abx918199
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG4 Antibody

46006-100ul 100ul
EUR 252.00

GNG4 Antibody

46006-50ul 50ul
EUR 187.00

GNG4 antibody

70R-17532 50 ul
EUR 435.00
Description: Rabbit polyclonal GNG4 antibody

GNG4 Antibody

DF9560 200ul
EUR 304.00
Description: GNG4 Antibody detects endogenous levels of total GNG4.

GNG4 Antibody

1-CSB-PA009616GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GNG4 Antibody

1-CSB-PA009616LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

pENTR223-GNG4

PVT12310 2 ug
EUR 391.00

GNG4 Conjugated Antibody

C46006 100ul
EUR 397.00

GNG4 cloning plasmid

CSB-CL009616HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 228
  • Sequence: atgaaagagggcatgtctaataacagcaccactagcatctcccaagccaggaaagctgtggagcagctaaagatggaagcctgtatggacagggtcaaggtctcccaggcagctgcggacctcctggcctactgtgaagctcacgtgcgggaagatcctctcatcattccagtgcc
  • Show more
Description: A cloning plasmid for the GNG4 gene.

anti- GNG4 antibody

FNab03546 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: guanine nucleotide binding protein(G protein), gamma 4
  • Uniprot ID: P50150
  • Gene ID: 2786
  • Research Area: Signal Transduction
Description: Antibody raised against GNG4

GNG4 Polyclonal Antibody

A59266 100 µg
EUR 570.55
Description: Ask the seller for details

GNG4 Blocking Peptide

DF9560-BP 1mg
EUR 195.00

Anti-GNG4 antibody

PAab03546 100 ug
EUR 386.00

GNG4 ELISA KIT|Human

EF009918 96 Tests
EUR 689.00

Human GNG4 ELISA KIT

ELI-43249h 96 Tests
EUR 824.00

Mouse Gng4 ELISA KIT

ELI-43530m 96 Tests
EUR 865.00

GNG4 protein (His tag)

80R-3652 50 ug
EUR 327.00
Description: Purified recombinant GNG4 protein (His tag)

Mouse GNG4 shRNA Plasmid

20-abx970599
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GNG4 shRNA Plasmid

20-abx951858
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GNG4 Antibody, HRP conjugated

1-CSB-PA009616LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG4 Antibody, FITC conjugated

1-CSB-PA009616LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG4 Antibody, Biotin conjugated

1-CSB-PA009616LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GNG4 Recombinant Protein (Human)

RP013549 100 ug Ask for price

GNG4 Recombinant Protein (Mouse)

RP139031 100 ug Ask for price

GNG4 Polyclonal Antibody, Biotin Conjugated

A59267 100 µg
EUR 570.55
Description: The best epigenetics products

GNG4 Polyclonal Antibody, FITC Conjugated

A59268 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNG4 Polyclonal Antibody, HRP Conjugated

A59269 100 µg
EUR 570.55
Description: fast delivery possible

GNG4 ORF Vector (Human) (pORF)

ORF004517 1.0 ug DNA
EUR 95.00

Gng4 ORF Vector (Mouse) (pORF)

ORF046345 1.0 ug DNA
EUR 506.00

GNG4 sgRNA CRISPR Lentivector set (Human)

K0876801 3 x 1.0 ug
EUR 339.00

Gng4 sgRNA CRISPR Lentivector set (Mouse)

K3157601 3 x 1.0 ug
EUR 339.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0876802 1.0 ug DNA
EUR 154.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0876803 1.0 ug DNA
EUR 154.00

GNG4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0876804 1.0 ug DNA
EUR 154.00

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx112897
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx215655
  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx301196
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Protein

20-abx262737
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

abx233546-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3157602 1.0 ug DNA
EUR 154.00

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3157603 1.0 ug DNA
EUR 154.00

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3157604 1.0 ug DNA
EUR 154.00

GNG4 Protein Vector (Mouse) (pPB-C-His)

PV185378 500 ng
EUR 603.00

GNG4 Protein Vector (Mouse) (pPB-N-His)

PV185379 500 ng
EUR 603.00

GNG4 Protein Vector (Mouse) (pPM-C-HA)

PV185380 500 ng
EUR 603.00

GNG4 Protein Vector (Mouse) (pPM-C-His)

PV185381 500 ng
EUR 603.00

Recombinant Human GNG4 Protein, His, E.coli-10ug

QP12019-10ug 10ug
EUR 201.00

Recombinant Human GNG4 Protein, His, E.coli-1mg

QP12019-1mg 1mg
EUR 5251.00

Recombinant Human GNG4 Protein, His, E.coli-2ug

QP12019-2ug 2ug
EUR 155.00

GNG4 Protein Vector (Human) (pPB-C-His)

PV018065 500 ng
EUR 329.00

GNG4 Protein Vector (Human) (pPB-N-His)

PV018066 500 ng
EUR 329.00

GNG4 Protein Vector (Human) (pPM-C-HA)

PV018067 500 ng
EUR 329.00

GNG4 Protein Vector (Human) (pPM-C-His)

PV018068 500 ng
EUR 329.00

Gng4 3'UTR Luciferase Stable Cell Line

TU205230 1.0 ml Ask for price

Gng4 3'UTR GFP Stable Cell Line

TU158871 1.0 ml Ask for price

GNG4 3'UTR Luciferase Stable Cell Line

TU008993 1.0 ml
EUR 2333.00

Gng4 3'UTR Luciferase Stable Cell Line

TU108871 1.0 ml Ask for price

GNG4 3'UTR GFP Stable Cell Line

TU058993 1.0 ml
EUR 2333.00