GNG4 Antibody

46006-100ul 100ul
EUR 252

GNG4 Antibody

46006-50ul 50ul
EUR 187

GNG4 Antibody

DF9560 200ul
EUR 304
Description: GNG4 Antibody detects endogenous levels of total GNG4.

GNG4 Antibody

1-CSB-PA009616GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

GNG4 Antibody

1-CSB-PA009616LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

GNG4 siRNA

20-abx918198
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG4 siRNA

20-abx918199
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GNG4 Antibody

ABD9560 100 ug
EUR 438

pENTR223-GNG4

PVT12310 2 ug
EUR 391

GNG4 Blocking Peptide

DF9560-BP 1mg
EUR 195

GNG4 Conjugated Antibody

C46006 100ul
EUR 397

GNG4 cloning plasmid

CSB-CL009616HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 228
  • Sequence: atgaaagagggcatgtctaataacagcaccactagcatctcccaagccaggaaagctgtggagcagctaaagatggaagcctgtatggacagggtcaaggtctcccaggcagctgcggacctcctggcctactgtgaagctcacgtgcgggaagatcctctcatcattccagtgcc
  • Show more
Description: A cloning plasmid for the GNG4 gene.

GNG4 Polyclonal Antibody

A59266 100 µg
EUR 570.55
Description: Ask the seller for details

anti- GNG4 antibody

FNab03546 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • IHC: 1:20-1:200
  • Immunogen: guanine nucleotide binding protein(G protein), gamma 4
  • Uniprot ID: P50150
  • Gene ID: 2786
  • Research Area: Signal Transduction
Description: Antibody raised against GNG4

Anti-GNG4 antibody

PAab03546 100 ug
EUR 386

GNG4 protein (His tag)

80R-3652 50 ug
EUR 327
Description: Purified recombinant GNG4 protein (His tag)

GNG4 ELISA KIT|Human

EF009918 96 Tests
EUR 689

Human GNG4 ELISA KIT

ELI-43249h 96 Tests
EUR 824

Mouse Gng4 ELISA KIT

ELI-43530m 96 Tests
EUR 865

GNG4 Antibody, HRP conjugated

1-CSB-PA009616LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG4 Antibody, FITC conjugated

1-CSB-PA009616LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG4 Antibody, Biotin conjugated

1-CSB-PA009616LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG4. Recognizes GNG4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNG4 shRNA Plasmid

20-abx951858
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse GNG4 shRNA Plasmid

20-abx970599
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GNG4 Recombinant Protein (Human)

RP013549 100 ug Ask for price

GNG4 Recombinant Protein (Mouse)

RP139031 100 ug Ask for price

GNG4 Polyclonal Antibody, Biotin Conjugated

A59267 100 µg
EUR 570.55
Description: The best epigenetics products

GNG4 Polyclonal Antibody, FITC Conjugated

A59268 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNG4 Polyclonal Antibody, HRP Conjugated

A59269 100 µg
EUR 570.55
Description: fast delivery possible

GNG4 ORF Vector (Human) (pORF)

ORF004517 1.0 ug DNA
EUR 95

Gng4 ORF Vector (Mouse) (pORF)

ORF046345 1.0 ug DNA
EUR 506

Gng4 sgRNA CRISPR Lentivector set (Mouse)

K3157601 3 x 1.0 ug
EUR 339

GNG4 sgRNA CRISPR Lentivector set (Human)

K0876801 3 x 1.0 ug
EUR 339

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx215655
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx112897
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

abx233546-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

G Protein Subunit Gamma 4 (GNG4) Antibody

20-abx301196
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

G Protein Subunit Gamma 4 (GNG4) Protein

20-abx262737
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3157602 1.0 ug DNA
EUR 154

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3157603 1.0 ug DNA
EUR 154

Gng4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3157604 1.0 ug DNA
EUR 154

GNG4 sgRNA CRISPR Lentivector (Human) (Target 1)

K0876802 1.0 ug DNA
EUR 154

GNG4 sgRNA CRISPR Lentivector (Human) (Target 2)

K0876803 1.0 ug DNA
EUR 154

GNG4 sgRNA CRISPR Lentivector (Human) (Target 3)

K0876804 1.0 ug DNA
EUR 154

GNG4 Protein Vector (Mouse) (pPB-C-His)

PV185378 500 ng
EUR 603

GNG4 Protein Vector (Mouse) (pPB-N-His)

PV185379 500 ng
EUR 603

GNG4 Protein Vector (Mouse) (pPM-C-HA)

PV185380 500 ng
EUR 603

GNG4 Protein Vector (Mouse) (pPM-C-His)

PV185381 500 ng
EUR 603

GNG4 Protein Vector (Human) (pPB-C-His)

PV018065 500 ng
EUR 329

GNG4 Protein Vector (Human) (pPB-N-His)

PV018066 500 ng
EUR 329

GNG4 Protein Vector (Human) (pPM-C-HA)

PV018067 500 ng
EUR 329

GNG4 Protein Vector (Human) (pPM-C-His)

PV018068 500 ng
EUR 329

Recombinant Human GNG4 Protein, His, E.coli-10ug

QP12019-10ug 10ug
EUR 201

Recombinant Human GNG4 Protein, His, E.coli-1mg

QP12019-1mg 1mg
EUR 5251

Recombinant Human GNG4 Protein, His, E.coli-2ug

QP12019-2ug 2ug
EUR 155

Gng4 3'UTR Luciferase Stable Cell Line

TU108871 1.0 ml Ask for price

Gng4 3'UTR Luciferase Stable Cell Line

TU205230 1.0 ml Ask for price

Gng4 3'UTR GFP Stable Cell Line

TU158871 1.0 ml Ask for price

Gng4 3'UTR GFP Stable Cell Line

TU255230 1.0 ml Ask for price

GNG4 3'UTR GFP Stable Cell Line

TU058993 1.0 ml
EUR 2333