GNG5 Antibody

34726-100ul 100ul
EUR 252.00

GNG5 Antibody

34726-50ul 50ul
EUR 187.00

GNG5 Antibody

46007-100ul 100ul
EUR 252.00

GNG5 Antibody

46007-50ul 50ul
EUR 187.00

GNG5 Antibody

DF9561 200ul
EUR 304.00
Description: GNG5 Antibody detects endogenous levels of total GNG5.

GNG5 Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

GNG5 Antibody

CSB-PA032886-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IF;IF:1:100-1:500

GNG5 antibody

70R-35411 100 ug
EUR 327.00
Description: Purified Rabbit polyclonal GNG5 antibody

GNG5 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IF, ELISA;IF:1/200-1/1000.ELISA:1/20000

GNG5 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GNG5 Antibody

ABD9561 100 ug
EUR 438.00


YF-PA23796 50 ul
EUR 334.00
Description: Mouse polyclonal to GNG5

GNG5 Blocking Peptide

DF9561-BP 1mg
EUR 195.00

GNG5 Conjugated Antibody

C46007 100ul
EUR 397.00

GNG5 Conjugated Antibody

C34726 100ul
EUR 397.00

GNG5 cloning plasmid

CSB-CL009617HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 207
  • Sequence: atgtctggctcctccagcgtcgccgctatgaagaaagtggttcaacagctccggctggaggccggactcaaccgcgtaaaagtttcccaggcagctgcagacttgaaacagttctgtctgcagaatgctcaacatgaccctctgctgactggagtatcttcaagtacaaatccctt
  • Show more
Description: A cloning plasmid for the GNG5 gene.

GNG5 Polyclonal Antibody

A62674 100 µg
EUR 570.55
Description: Ask the seller for details

Anti-GNG5 Antibody

A30716 100ul
EUR 397.00
Description: Rabbit Polyclonal GNG5 Antibody. Validated in IF and tested in Human, Mouse, Rat.

Anti-GNG5 (3B8)

YF-MA13277 100 ug
EUR 363.00
Description: Mouse monoclonal to GNG5

Rat GNG5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GNG5 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GNG5 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GNG5 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GNG5. Recognizes GNG5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human GNG5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse GNG5 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


ELI-48622b 96 Tests
EUR 928.00

Mouse Gng5 ELISA KIT

ELI-48747m 96 Tests
EUR 865.00


ELI-47374h 96 Tests
EUR 824.00

GNG5 Recombinant Protein (Human)

RP013552 100 ug Ask for price

GNG5 Recombinant Protein (Rat)

RP203027 100 ug Ask for price

GNG5 Recombinant Protein (Mouse)

RP139034 100 ug Ask for price

Polyclonal GNG5 Antibody (C-Term)

APR16188G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GNG5 (C-Term). This antibody is tested and proven to work in the following applications:

GNG5 Polyclonal Antibody, HRP Conjugated

A62675 100 µg
EUR 570.55
Description: The best epigenetics products

GNG5 Polyclonal Antibody, FITC Conjugated

A62676 100 µg
EUR 570.55
Description: kits suitable for this type of research

GNG5 Polyclonal Antibody, Biotin Conjugated

A62677 100 µg
EUR 570.55
Description: fast delivery possible

Gng5 ORF Vector (Rat) (pORF)

ORF067677 1.0 ug DNA
EUR 506.00

GNG5 ORF Vector (Human) (pORF)

ORF004518 1.0 ug DNA
EUR 95.00

Gng5 ORF Vector (Mouse) (pORF)

ORF046346 1.0 ug DNA
EUR 506.00

Gng5 sgRNA CRISPR Lentivector set (Mouse)

K4937101 3 x 1.0 ug
EUR 339.00

Gng5 sgRNA CRISPR Lentivector set (Rat)

K7024301 3 x 1.0 ug
EUR 339.00

GNG5 sgRNA CRISPR Lentivector set (Human)

K0876901 3 x 1.0 ug
EUR 339.00

Guanine Nucleotide-Binding Protein G (GNG5) Antibody

  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Guanine Nucleotide-Binding Protein G (GNG5) Antibody

abx331294-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Guanine Nucleotide-Binding Protein G (GNG5) Antibody

  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Guanine Nucleotide-Binding Protein G (GNG5) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Gng5 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4937102 1.0 ug DNA
EUR 154.00

Gng5 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4937103 1.0 ug DNA
EUR 154.00

Gng5 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4937104 1.0 ug DNA
EUR 154.00

Gng5 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7024302 1.0 ug DNA
EUR 154.00

Gng5 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7024303 1.0 ug DNA
EUR 154.00

Gng5 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7024304 1.0 ug DNA
EUR 154.00

GNG5 sgRNA CRISPR Lentivector (Human) (Target 1)

K0876902 1.0 ug DNA
EUR 154.00

GNG5 sgRNA CRISPR Lentivector (Human) (Target 2)

K0876903 1.0 ug DNA
EUR 154.00

GNG5 sgRNA CRISPR Lentivector (Human) (Target 3)

K0876904 1.0 ug DNA
EUR 154.00

GNG5 Protein Vector (Rat) (pPB-C-His)

PV270706 500 ng
EUR 603.00

GNG5 Protein Vector (Rat) (pPB-N-His)

PV270707 500 ng
EUR 603.00

GNG5 Protein Vector (Rat) (pPM-C-HA)

PV270708 500 ng
EUR 603.00