In den Nachrichten

GPR119

GPR119 siRNA

20-abx902267
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR119 siRNA

20-abx918416
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR119 siRNA

20-abx918417
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR119 antibody

70R-31399 100 ug
EUR 327.00
Description: Rabbit polyclonal GPR119 antibody

GPR119 Antibody

ABD4892 100 ug
EUR 438.00

GPR119 Antibody

DF4892 200ul
EUR 304.00
Description: GPR119 Antibody detects endogenous levels of total GPR119.

GPR119 Antibody

1-CSB-PA007283
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

GPR119 Polyclonal Antibody

ES4819-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody

ES4819-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Blocking Peptide

20-abx162463
  • EUR 272.00
  • EUR 411.00
  • 0
  • 1
  • Shipped within 5-10 working days.

GPR119 Polyclonal Antibody

ABP53820-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody

ABP53820-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240
  • Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

Anti-GPR119 Antibody

A07391 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for GPR119 Antibody (GPR119) detection.tested for WB in Human.

GPR119 Rabbit pAb

A18544-100ul 100 ul
EUR 308.00

GPR119 Rabbit pAb

A18544-200ul 200 ul
EUR 459.00

GPR119 Rabbit pAb

A18544-20ul 20 ul
EUR 183.00

GPR119 Rabbit pAb

A18544-50ul 50 ul
EUR 223.00

GPR119 Polyclonal Antibody

40973-100ul 100ul
EUR 252.00

GPR119 Polyclonal Antibody

40973-50ul 50ul
EUR 187.00

GPR119 Blocking Peptide

DF4892-BP 1mg
EUR 195.00

GPR119 cloning plasmid

CSB-CL840575HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1008
  • Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct
  • Show more
Description: A cloning plasmid for the GPR119 gene.

Anti-GPR119 antibody

STJ93327 200 µl
EUR 197.00
Description: Rabbit polyclonal to GPR119.

Anti-GPR119 antibody

STJ71609 100 µg
EUR 359.00

Anti-GPR119 antibody

STJ11100495 100 µl
EUR 277.00

GPR119 Polyclonal Conjugated Antibody

C40973 100ul
EUR 397.00

Rat GPR119 shRNA Plasmid

20-abx989158
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human GPR119 shRNA Plasmid

20-abx965265
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Gpr119 ELISA KIT

ELI-09750m 96 Tests
EUR 865.00

Human GPR119 ELISA KIT

ELI-48829h 96 Tests
EUR 824.00

Mouse GPR119 shRNA Plasmid

20-abx982252
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

GPR119 Recombinant Protein (Human)

RP039541 100 ug Ask for price

GPR119 Recombinant Protein (Rat)

RP203282 100 ug Ask for price

GPR119 Recombinant Protein (Mouse)

RP139418 100 ug Ask for price

Polyclonal Goat Anti-GPR119 Antibody

APR16300G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (aa186-235)

APR16477G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16478G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)

APR16479G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Gpr119 ORF Vector (Rat) (pORF)

ORF067762 1.0 ug DNA
EUR 506.00

Gpr119 ORF Vector (Mouse) (pORF)

ORF046474 1.0 ug DNA
EUR 506.00

GPR119 ORF Vector (Human) (pORF)

ORF013181 1.0 ug DNA
EUR 354.00

GPR119 sgRNA CRISPR Lentivector set (Human)

K0895801 3 x 1.0 ug
EUR 339.00

Gpr119 sgRNA CRISPR Lentivector set (Mouse)

K3605701 3 x 1.0 ug
EUR 339.00

Gpr119 sgRNA CRISPR Lentivector set (Rat)

K7204201 3 x 1.0 ug
EUR 339.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)

K0895802 1.0 ug DNA
EUR 154.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)

K0895803 1.0 ug DNA
EUR 154.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)

K0895804 1.0 ug DNA
EUR 154.00

G-Protein Coupled Receptor 119 (GPR119) Antibody

20-abx121407
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

G Protein-Coupled Receptor 119 (GPR119) Antibody

20-abx324143
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx215630-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody

abx432763-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3605702 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3605703 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3605704 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7204202 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7204203 1.0 ug DNA
EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7204204 1.0 ug DNA
EUR 154.00

GPR119 Protein Vector (Human) (pPB-C-His)

PV052721 500 ng
EUR 481.00

GPR119 Protein Vector (Human) (pPB-N-His)

PV052722 500 ng
EUR 481.00

GPR119 Protein Vector (Human) (pPM-C-HA)

PV052723 500 ng
EUR 481.00