GPR119

GPR119 siRNA
20-abx902267	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GPR119 siRNA
20-abx918416	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GPR119 siRNA
20-abx918417	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

GPR119 antibody
70R-31399	Fitzgerald	100 ug	EUR 327.00
Description: Rabbit polyclonal GPR119 antibody

GPR119 Antibody
ABD4892	Lifescience Market	100 ug	EUR 438.00

GPR119 Antibody
DF4892	Affbiotech	200ul	EUR 304.00
Description: GPR119 Antibody detects endogenous levels of total GPR119.

GPR119 Antibody
1-CSB-PA007283	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against GPR119. Recognizes GPR119 from Human. This antibody is Unconjugated. Tested in the following application: WB, IF, ELISA;WB:1/500-1/2000.IF:1/200-1/1000.ELISA:1/10000

GPR119 Polyclonal Antibody
ES4819-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Polyclonal Antibody
ES4819-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against GPR119 from Human. This antibody is tested and validated for WB, ELISA, IF, WB, ELISA

GPR119 Blocking Peptide
20-abx162463	Abbexa	EUR 272.00 EUR 411.00	0 1
Shipped within 5-10 working days.

GPR119 Polyclonal Antibody
ABP53820-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240 Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody
ABP53820-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240 Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

GPR119 Polyclonal Antibody
ABP53820-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240 Applications tips:
Description: A polyclonal antibody for detection of GPR119 from Human. This GPR119 antibody is for WB, IF, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human GPR119 at AA rangle: 160-240

Anti-GPR119 Antibody
A07391	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal Antibody for GPR119 Antibody (GPR119) detection.tested for WB in Human.

GPR119 Rabbit pAb
A18544-100ul	Abclonal	100 ul	EUR 308.00

GPR119 Rabbit pAb
A18544-200ul	Abclonal	200 ul	EUR 459.00

GPR119 Rabbit pAb
A18544-20ul	Abclonal	20 ul	EUR 183.00

GPR119 Rabbit pAb
A18544-50ul	Abclonal	50 ul	EUR 223.00

GPR119 Polyclonal Antibody
40973-100ul	SAB	100ul	EUR 252.00

GPR119 Polyclonal Antibody
40973-50ul	SAB	50ul	EUR 187.00

GPR119 Blocking Peptide
DF4892-BP	Affbiotech	1mg	EUR 195.00

GPR119 cloning plasmid
CSB-CL840575HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1008 Sequence: atggaatcatctttctcatttggagtgatccttgctgtcctggcctccctcatcattgctactaacacactagtggctgtggctgtgctgctgttgatccacaagaatgatggtgtcagtctctgcttcaccttgaatctggctgtggctgacaccttgattggtgtggccatct Show more
Description: A cloning plasmid for the GPR119 gene.

Anti-GPR119 antibody
STJ93327	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to GPR119.

Anti-GPR119 antibody
STJ71609	St John's Laboratory	100 µg	EUR 359.00

Anti-GPR119 antibody
STJ11100495	St John's Laboratory	100 µl	EUR 277.00

GPR119 Polyclonal Conjugated Antibody
C40973	SAB	100ul	EUR 397.00

Rat GPR119 shRNA Plasmid
20-abx989158	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human GPR119 shRNA Plasmid
20-abx965265	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse Gpr119 ELISA KIT
ELI-09750m	Lifescience Market	96 Tests	EUR 865.00

Human GPR119 ELISA KIT
ELI-48829h	Lifescience Market	96 Tests	EUR 824.00

Mouse GPR119 shRNA Plasmid
20-abx982252	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

GPR119 Recombinant Protein (Human)
RP039541	ABM	100 ug	Ask for price

GPR119 Recombinant Protein (Rat)
RP203282	ABM	100 ug	Ask for price

GPR119 Recombinant Protein (Mouse)
RP139418	ABM	100 ug	Ask for price

Polyclonal Goat Anti-GPR119 Antibody
APR16300G	Leading Biology	0.1 mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR119 . This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (aa186-235)
APR16477G	Leading Biology	0.05ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (aa186-235). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16478G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR119 Antibody (Cytoplasmic Domain)
APR16479G	Leading Biology	0.05mg	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR119 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Gpr119 ORF Vector (Rat) (pORF)
ORF067762	ABM	1.0 ug DNA	EUR 506.00

Gpr119 ORF Vector (Mouse) (pORF)
ORF046474	ABM	1.0 ug DNA	EUR 506.00

GPR119 ORF Vector (Human) (pORF)
ORF013181	ABM	1.0 ug DNA	EUR 354.00

GPR119 sgRNA CRISPR Lentivector set (Human)
K0895801	ABM	3 x 1.0 ug	EUR 339.00

Gpr119 sgRNA CRISPR Lentivector set (Mouse)
K3605701	ABM	3 x 1.0 ug	EUR 339.00

Gpr119 sgRNA CRISPR Lentivector set (Rat)
K7204201	ABM	3 x 1.0 ug	EUR 339.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 1)
K0895802	ABM	1.0 ug DNA	EUR 154.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 2)
K0895803	ABM	1.0 ug DNA	EUR 154.00

GPR119 sgRNA CRISPR Lentivector (Human) (Target 3)
K0895804	ABM	1.0 ug DNA	EUR 154.00

G-Protein Coupled Receptor 119 (GPR119) Antibody
20-abx121407	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	0 1 2
Shipped within 5-10 working days.

G Protein-Coupled Receptor 119 (GPR119) Antibody
20-abx324143	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody
abx215630-100ug	Abbexa	100 ug	EUR 439.00
Shipped within 5-10 working days.

G-Protein Coupled Receptor 119 (GPR119) Antibody
abx432763-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3605702	ABM	1.0 ug DNA	EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3605703	ABM	1.0 ug DNA	EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3605704	ABM	1.0 ug DNA	EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7204202	ABM	1.0 ug DNA	EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7204203	ABM	1.0 ug DNA	EUR 154.00

Gpr119 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7204204	ABM	1.0 ug DNA	EUR 154.00

GPR119 Protein Vector (Human) (pPB-C-His)
PV052721	ABM	500 ng	EUR 481.00

GPR119 Protein Vector (Human) (pPB-N-His)
PV052722	ABM	500 ng	EUR 481.00

GPR119 Protein Vector (Human) (pPM-C-HA)
PV052723	ABM	500 ng	EUR 481.00