HSPA9

HSPA9 antibody

70R-14326 100 ug
EUR 322.00
Description: Affinity purified Rabbit polyclonal HSPA9 antibody

HSPA9 Antibody

32077-100ul 100ul
EUR 252.00

HSPA9 antibody

10R-4404 100 ul
EUR 691.00
Description: Mouse monoclonal HSPA9 antibody

HSPA9 Antibody

1-CSB-PA002982
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

HSPA9 Antibody

1-CSB-PA104816
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

HSPA9 Antibody

1-CSB-PA933674
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

HSPA9 Antibody

DF6108 200ul
EUR 304.00
Description: HSPA9 Antibody detects endogenous levels of total HSPA9.

HSPA9 antibody

70R-7827 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal HSPA9 antibody

HSPA9 Antibody

1-CSB-PA010830GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HSPA9 Antibody

1-CSB-PA010830HA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HSPA9 Antibody

20-abx330079
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HSPA9 siRNA

20-abx919984
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HSPA9 siRNA

20-abx919985
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

HSPA9 Antibody

ABD6108 100 ug
EUR 438.00

pOTB7-HSPA9

PVT18516 2 ug
EUR 258.00

HSPA9 Rabbit pAb

A0558-100ul 100 ul
EUR 308.00

HSPA9 Rabbit pAb

A0558-200ul 200 ul
EUR 459.00

HSPA9 Rabbit pAb

A0558-20ul 20 ul
EUR 183.00

HSPA9 Rabbit pAb

A0558-50ul 50 ul
EUR 223.00

HSPA9 Blocking Peptide

33R-3240 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPA9 antibody, catalog no. 70R-7827

HSPA9 Blocking Peptide

DF6108-BP 1mg
EUR 195.00

HSPA9 Conjugated Antibody

C32077 100ul
EUR 397.00

HSPA9 cloning plasmid

CSB-CL010830HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2040
  • Sequence: atgataagtgccagccgagctgcagcagcccgtctcgtgggcgccgcagcctcccggggccctacggccgcccgccaccaggatagctggaatggccttagtcatgaggcttttagacttgtttcaaggcgggattatgcatcagaagcaatcaagggagcagttgttggtattg
  • Show more
Description: A cloning plasmid for the HSPA9 gene.

Anti-HSPA9 Antibody

A1861-100
EUR 403.00

Anti-HSPA9 antibody

STJ24100 100 µl
EUR 277.00
Description: This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.

HSPA9 protein (His tag)

80R-1090 100 ug
EUR 224.00
Description: Purified recombinant Human HSPA9 protein

Polyclonal HSPA9 Antibody (Center)

APR07836G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPA9 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HSPA9 Antibody (Center)

APR07837G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPA9 (Center). This antibody is tested and proven to work in the following applications:

HSPA9 Antibody, HRP conjugated

1-CSB-PA010830HB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HSPA9 Antibody, FITC conjugated

1-CSB-PA010830HC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HSPA9 Antibody, Biotin conjugated

1-CSB-PA010830HD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human HSPA9 shRNA Plasmid

20-abx952266
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse HSPA9 shRNA Plasmid

20-abx970926
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Anti-Grp75/HSPA9 Antibody

PA1789 100ug/vial
EUR 334.00

Anti-Grp75/HSPA9 Antibody

PB9642 100ug/vial
EUR 334.00

HSPA9 Recombinant Protein (Human)

RP015370 100 ug Ask for price

HSPA9 Recombinant Protein (Rat)

RP205253 100 ug Ask for price

HSPA9 Recombinant Protein (Mouse)

RP142631 100 ug Ask for price

Hspa9 ORF Vector (Rat) (pORF)

ORF068419 1.0 ug DNA
EUR 506.00

HSPA9 ORF Vector (Human) (pORF)

ORF005124 1.0 ug DNA
EUR 95.00

Hspa9 ORF Vector (Mouse) (pORF)

ORF047545 1.0 ug DNA
EUR 506.00

HSPA9 ELISA Kit (Human) (OKEI00259)

OKEI00259 96 Wells
EUR 663.00
Description: Description of target: Chaperone protein which is implicated in the control of cell proliferation and cellular aging. Plays a role in the erythropoiesis process.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL

HSPA9 ELISA Kit (Porcine) (OKEI00637)

OKEI00637 96 Wells
EUR 741.00
Description: Description of target: ;Species reactivity: Porcine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.375 ng/mL

HSPA9 ELISA Kit (Rat) (OKEI00784)

OKEI00784 96 Wells
EUR 663.00
Description: Description of target: Chaperone protein which is implicated in the control of cell proliferation and cellular aging. Plays a role in the erythropoiesis process.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Hspa9 sgRNA CRISPR Lentivector set (Rat)

K6755001 3 x 1.0 ug
EUR 339.00

Hspa9 sgRNA CRISPR Lentivector set (Mouse)

K4822801 3 x 1.0 ug
EUR 339.00

HSPA9 sgRNA CRISPR Lentivector set (Human)

K0998501 3 x 1.0 ug
EUR 339.00

Polyclonal HSPA9 / Mortalin / GRP75 Antibody (aa630-679)

APR07834G 0.05ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPA9 / Mortalin / GRP75 (aa630-679). This antibody is tested and proven to work in the following applications:

Polyclonal HSPA9 / Mortalin / GRP75 Antibody (N-Terminus)

APR07835G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPA9 / Mortalin / GRP75 (N-Terminus). This antibody is tested and proven to work in the following applications:

Hspa9 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6755002 1.0 ug DNA
EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6755003 1.0 ug DNA
EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6755004 1.0 ug DNA
EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4822802 1.0 ug DNA
EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4822803 1.0 ug DNA
EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4822804 1.0 ug DNA
EUR 154.00

HSPA9 sgRNA CRISPR Lentivector (Human) (Target 1)

K0998502 1.0 ug DNA
EUR 154.00

HSPA9 sgRNA CRISPR Lentivector (Human) (Target 2)

K0998503 1.0 ug DNA
EUR 154.00

HSPA9 sgRNA CRISPR Lentivector (Human) (Target 3)

K0998504 1.0 ug DNA
EUR 154.00

HSPA9 Protein Vector (Human) (pPB-C-His)

PV020493 500 ng
EUR 329.00

HSPA9 Protein Vector (Human) (pPB-N-His)

PV020494 500 ng
EUR 329.00