HSPA9

HSPA9 antibody
70R-14326	Fitzgerald	100 ug	EUR 322.00
Description: Affinity purified Rabbit polyclonal HSPA9 antibody

HSPA9 Antibody
32077-100ul	SAB	100ul	EUR 252.00

HSPA9 antibody
10R-4404	Fitzgerald	100 ul	EUR 691.00
Description: Mouse monoclonal HSPA9 antibody

HSPA9 Antibody
1-CSB-PA002982	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human, Mouse, Rat, Monkey. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/40000

HSPA9 Antibody
1-CSB-PA104816	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

HSPA9 Antibody
1-CSB-PA933674	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

HSPA9 Antibody
DF6108	Affbiotech	200ul	EUR 304.00
Description: HSPA9 Antibody detects endogenous levels of total HSPA9.

HSPA9 antibody
70R-7827	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal HSPA9 antibody

HSPA9 Antibody
1-CSB-PA010830GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

HSPA9 Antibody
1-CSB-PA010830HA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

HSPA9 Antibody
20-abx330079	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

HSPA9 siRNA
20-abx919984	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

HSPA9 siRNA
20-abx919985	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

HSPA9 Antibody
ABD6108	Lifescience Market	100 ug	EUR 438.00

pOTB7-HSPA9
PVT18516	Lifescience Market	2 ug	EUR 258.00

HSPA9 Rabbit pAb
A0558-100ul	Abclonal	100 ul	EUR 308.00

HSPA9 Rabbit pAb
A0558-200ul	Abclonal	200 ul	EUR 459.00

HSPA9 Rabbit pAb
A0558-20ul	Abclonal	20 ul	EUR 183.00

HSPA9 Rabbit pAb
A0558-50ul	Abclonal	50 ul	EUR 223.00

HSPA9 Blocking Peptide
33R-3240	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of HSPA9 antibody, catalog no. 70R-7827

HSPA9 Blocking Peptide
DF6108-BP	Affbiotech	1mg	EUR 195.00

HSPA9 Conjugated Antibody
C32077	SAB	100ul	EUR 397.00

HSPA9 cloning plasmid
CSB-CL010830HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2040 Sequence: atgataagtgccagccgagctgcagcagcccgtctcgtgggcgccgcagcctcccggggccctacggccgcccgccaccaggatagctggaatggccttagtcatgaggcttttagacttgtttcaaggcgggattatgcatcagaagcaatcaagggagcagttgttggtattg Show more
Description: A cloning plasmid for the HSPA9 gene.

Anti-HSPA9 Antibody
A1861-100	Biovision		EUR 403.00

Anti-HSPA9 antibody
STJ24100	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a member of the heat shock protein 70 gene family. The encoded protein is primarily localized to the mitochondria but is also found in the endoplasmic reticulum, plasma membrane and cytoplasmic vesicles. This protein is a heat-shock cognate protein. This protein plays a role in cell proliferation, stress response and maintenance of the mitochondria. A pseudogene of this gene is found on chromosome 2.

HSPA9 protein (His tag)
80R-1090	Fitzgerald	100 ug	EUR 224.00
Description: Purified recombinant Human HSPA9 protein

Polyclonal HSPA9 Antibody (Center)
APR07836G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPA9 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal HSPA9 Antibody (Center)
APR07837G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPA9 (Center). This antibody is tested and proven to work in the following applications:

HSPA9 Antibody, HRP conjugated
1-CSB-PA010830HB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HSPA9 Antibody, FITC conjugated
1-CSB-PA010830HC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HSPA9 Antibody, Biotin conjugated
1-CSB-PA010830HD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HSPA9. Recognizes HSPA9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human HSPA9 shRNA Plasmid
20-abx952266	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse HSPA9 shRNA Plasmid
20-abx970926	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Anti-Grp75/HSPA9 Antibody
PA1789	BosterBio	100ug/vial	EUR 334.00

Anti-Grp75/HSPA9 Antibody
PB9642	BosterBio	100ug/vial	EUR 334.00

HSPA9 Recombinant Protein (Human)
RP015370	ABM	100 ug	Ask for price

HSPA9 Recombinant Protein (Rat)
RP205253	ABM	100 ug	Ask for price

HSPA9 Recombinant Protein (Mouse)
RP142631	ABM	100 ug	Ask for price

Hspa9 ORF Vector (Rat) (pORF)
ORF068419	ABM	1.0 ug DNA	EUR 506.00

HSPA9 ORF Vector (Human) (pORF)
ORF005124	ABM	1.0 ug DNA	EUR 95.00

Hspa9 ORF Vector (Mouse) (pORF)
ORF047545	ABM	1.0 ug DNA	EUR 506.00

HSPA9 ELISA Kit (Human) (OKEI00259)
OKEI00259	Aviva Systems Biology	96 Wells	EUR 663.00
Description: Description of target: Chaperone protein which is implicated in the control of cell proliferation and cellular aging. Plays a role in the erythropoiesis process.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL

HSPA9 ELISA Kit (Porcine) (OKEI00637)
OKEI00637	Aviva Systems Biology	96 Wells	EUR 741.00
Description: Description of target: ;Species reactivity: Porcine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.375 ng/mL

HSPA9 ELISA Kit (Rat) (OKEI00784)
OKEI00784	Aviva Systems Biology	96 Wells	EUR 663.00
Description: Description of target: Chaperone protein which is implicated in the control of cell proliferation and cellular aging. Plays a role in the erythropoiesis process.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Hspa9 sgRNA CRISPR Lentivector set (Rat)
K6755001	ABM	3 x 1.0 ug	EUR 339.00

Hspa9 sgRNA CRISPR Lentivector set (Mouse)
K4822801	ABM	3 x 1.0 ug	EUR 339.00

HSPA9 sgRNA CRISPR Lentivector set (Human)
K0998501	ABM	3 x 1.0 ug	EUR 339.00

Polyclonal HSPA9 / Mortalin / GRP75 Antibody (aa630-679)
APR07834G	Leading Biology	0.05ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPA9 / Mortalin / GRP75 (aa630-679). This antibody is tested and proven to work in the following applications:

Polyclonal HSPA9 / Mortalin / GRP75 Antibody (N-Terminus)
APR07835G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HSPA9 / Mortalin / GRP75 (N-Terminus). This antibody is tested and proven to work in the following applications:

Hspa9 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6755002	ABM	1.0 ug DNA	EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6755003	ABM	1.0 ug DNA	EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6755004	ABM	1.0 ug DNA	EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4822802	ABM	1.0 ug DNA	EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4822803	ABM	1.0 ug DNA	EUR 154.00

Hspa9 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4822804	ABM	1.0 ug DNA	EUR 154.00

HSPA9 sgRNA CRISPR Lentivector (Human) (Target 1)
K0998502	ABM	1.0 ug DNA	EUR 154.00

HSPA9 sgRNA CRISPR Lentivector (Human) (Target 2)
K0998503	ABM	1.0 ug DNA	EUR 154.00

HSPA9 sgRNA CRISPR Lentivector (Human) (Target 3)
K0998504	ABM	1.0 ug DNA	EUR 154.00

HSPA9 Protein Vector (Human) (pPB-C-His)
PV020493	ABM	500 ng	EUR 329.00

HSPA9 Protein Vector (Human) (pPB-N-His)
PV020494	ABM	500 ng	EUR 329.00