In den Nachrichten



  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

IFIH1 antibody

70R-4787 50 ug
EUR 467.00
Description: Rabbit polyclonal IFIH1 antibody raised against the middle region of IFIH1

IFIH1 antibody

70R-32114 100 ug
EUR 327.00
Description: Rabbit polyclonal IFIH1 antibody

IFIH1 Antibody

ABD3423 100 ug
EUR 438.00

IFIH1 Antibody

ABD6926 100 ug
EUR 438.00

IFIH1 Antibody

34051-100ul 100ul
EUR 252.00

IFIH1 Antibody

34051-50ul 50ul
EUR 187.00

IFIH1 Antibody

32665-100ul 100ul
EUR 252.00

IFIH1 antibody

70R-17888 50 ul
EUR 435.00
Description: Rabbit polyclonal IFIH1 antibody

IFIH1 Antibody

DF6926 200ul
EUR 304.00
Description: IFIH1 Antibody detects endogenous levels of total IFIH1.

IFIH1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

IFIH1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

IFIH1 Antibody

DF3423 200ul
EUR 304.00
Description: IFIH1 Antibody detects endogenous levels of total IFIH1.

IFIH1 Antibody

  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/40000

IFIH1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

IFIH1 Antibody

EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

IFIH1 Antibody

CSB-PA255539-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

IFIH1 Conjugated Antibody

C32665 100ul
EUR 397.00

anti- IFIH1 antibody

FNab04134 100µg
EUR 585.00
  • Immunogen: interferon induced with helicase C domain 1
  • Uniprot ID: Q9BYX4
  • Gene ID: 64135
  • Research Area: Immunology, Metabolism
Description: Antibody raised against IFIH1

IFIH1 Rabbit pAb

A13645-100ul 100 ul
EUR 308.00

IFIH1 Rabbit pAb

A13645-200ul 200 ul
EUR 459.00

IFIH1 Rabbit pAb

A13645-20ul 20 ul
EUR 183.00

IFIH1 Rabbit pAb

A13645-50ul 50 ul
EUR 223.00

IFIH1 Polyclonal Antibody

A67670 100 µg
EUR 570.55
Description: kits suitable for this type of research

IFIH1 Blocking Peptide

33R-7591 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of IFIH1 antibody, catalog no. 70R-4787

IFIH1 cloning plasmid

CSB-CL880143HU1-10ug 10ug
EUR 296.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 666
  • Sequence: atgtcgaatgggtattccacagacgagaatttccgctatctcatctcgtgcttcagggccagggtgaaaatgtacatccaggtggagcctgtgctggactacctgacctttctgcctgcagaggtgaaggagcagattcagaggacagtcgccacctccgggaacatgcaggcagt
  • Show more
Description: A cloning plasmid for the IFIH1 gene.

IFIH1 cloning plasmid

CSB-CL880143HU2-10ug 10ug
EUR 1104.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3078
  • Show more
Description: A cloning plasmid for the IFIH1 gene.

IFIH1 Blocking Peptide

DF6926-BP 1mg
EUR 195.00

IFIH1 Blocking Peptide

DF3423-BP 1mg
EUR 195.00

Anti-IFIH1 antibody

PAab04134 100 ug
EUR 412.00

Anti-IFIH1 antibody

STJ24125 100 µl
EUR 277.00
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19.

Anti-IFIH1 antibody

STJ115604 100 µl
EUR 277.00
Description: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon and a protein kinase C-activating compound, mezerein. Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Genetic variation in this gene is associated with diabetes mellitus insulin-dependent type 19.

Mouse IFIH1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.


ELA-E2803h 96 Tests
EUR 824.00

Mouse Ifih1 ELISA KIT

ELI-08432m 96 Tests
EUR 865.00


EF006306 96 Tests
EUR 689.00


ELI-31293h 96 Tests
EUR 824.00

Human IFIH1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

IFIH1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IFIH1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IFIH1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IFIH1. Recognizes IFIH1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MDA5 / IFIH1 antibody

STJ70370 100 µg
EUR 359.00

Polyclonal IFIH1 / MDA5 Antibody (Internal)

APR11144G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IFIH1 / MDA5 (Internal). This antibody is tested and proven to work in the following applications:

IFIH1 Polyclonal Antibody, HRP Conjugated

A67671 100 µg
EUR 570.55
Description: fast delivery possible

IFIH1 Polyclonal Antibody, FITC Conjugated

A67672 100 µg
EUR 570.55
Description: reagents widely cited

IFIH1 Polyclonal Antibody, Biotin Conjugated

A67673 100 µg
EUR 570.55
Description: Ask the seller for details

IFIH1 ORF Vector (Human) (pORF)

ORF005203 1.0 ug DNA
EUR 95.00

Ifih1 ORF Vector (Rat) (pORF)

ORF068505 1.0 ug DNA
EUR 506.00

Ifih1 ORF Vector (Mouse) (pORF)

ORF047669 1.0 ug DNA
EUR 506.00

Ifih1 ORF Vector (Mouse) (pORF)

ORF047670 1.0 ug DNA
EUR 506.00

IFIH1 ORF Vector (Human) (pORF)

ORF013322 1.0 ug DNA
EUR 354.00

Anti-MDA5 / Ifih1 (mouse) antibody

STJ71173 100 µg
EUR 260.00

IFIH1 ELISA Kit (Human) (OKCD09315)

OKCD09315 96 Wells
EUR 909.00
Description: Description of target: DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. IFIH1 is a DEAD box protein that is upregulated in response to treatment with beta-interferon (IFNB) and a protein kinase C-activating compound, mezerein (MEZ). Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation.DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein that is upregulated in response to treatment with beta-interferon (IFNB) and a protein kinase C-activating compound, mezerein (MEZ). Irreversible reprogramming of melanomas can be achieved by treatment with both these agents; treatment with either agent alone only achieves reversible differentiation. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.115ng/mL

IFIH1 ELISA Kit (Mouse) (OKEH05150)

OKEH05150 96 Wells
EUR 662.00
Description: Description of target: Innate immune receptor which acts as a cytoplasmic sensor of viral nucleic acids and plays a major role in sensing viral infection and in the activation of a cascade of antiviral responses including the induction of type I interferons and proinflammatory cytokines. Its ligands include mRNA lacking 2'-O-methylation at their 5' cap and long-dsRNA (>1 kb in length). Upon ligand binding it associates with mitochondria antiviral signaling protein (MAVS/IPS1) which activates the IKK-related kinases: TBK1 and IKBKE which phosphorylate interferon regulatory factors: IRF3 and IRF7 which in turn activate transcription of antiviral immunological genes, including interferons (IFNs); IFN-alpha and IFN-beta. Responsible for detecting the Picornaviridae family members such as encephalomyocarditis virus (EMCV), mengo encephalomyocarditis virus (ENMG), and theiler's murine encephalomyelitis virus (TMEV). Can also detect other viruses such as dengue virus (DENV), west Nile virus (WNV), and reovirus. Also involved in antiviral signaling in response to viruses containing a dsDNA genome, such as vaccinia virus. Plays an important role in amplifying innate immune signaling through recognition of RNA metabolites that are produced during virus infection by ribonuclease L (RNase L). May play an important role in enhancing natural killer cell function and may be involved in growth inhibition and apoptosis in several tumor cell lines.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.65 pg/mL

Polyclonal IFIH1 / MDA5 Antibody (C-Terminus)

AMR11139G 0.05mg
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IFIH1 / MDA5 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-MDA5 / IFIH1 Antibody

AMM05378G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MDA5 / IFIH1 . This antibody is tested and proven to work in the following applications:

IFIH1 sgRNA CRISPR Lentivector set (Human)

K1017401 3 x 1.0 ug
EUR 339.00

Ifih1 sgRNA CRISPR Lentivector set (Mouse)

K4039301 3 x 1.0 ug
EUR 339.00

Ifih1 sgRNA CRISPR Lentivector set (Rat)

K6503001 3 x 1.0 ug
EUR 339.00

IFIH1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1017402 1.0 ug DNA
EUR 154.00