KIFC3

Kinesin-Like Protein KIFC3 (KIFC3) Antibody
20-abx124088	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Kinesin-Like Protein KIFC3 (KIFC3) Antibody
20-abx321339	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Kinesin-Like Protein KIFC3 (KIFC3) Antibody
abx234574-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

KIFC3 antibody
70R-18128	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal KIFC3 antibody

KIFC3 Antibody
1-CSB-PA887134ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KIFC3. Recognizes KIFC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KIFC3 Antibody
DF12287	Affbiotech	200ul	EUR 304
Description: KIFC3 antibody detects endogenous levels of KIFC3.

KIFC3 antibody
70R-5600	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal KIFC3 antibody raised against the C terminal of KIFC3

KIFC3 Antibody
1-CSB-PA012350GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KIFC3. Recognizes KIFC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

KIFC3 siRNA
20-abx921655	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KIFC3 siRNA
20-abx921656	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-KIFC3
YF-PA12833	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to KIFC3

anti-KIFC3
YF-PA12834	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to KIFC3

Human Kinesin- like protein KIFC3, KIFC3 ELISA KIT
ELI-19447h	Lifescience Market	96 Tests	EUR 824

Mouse Kinesin- like protein KIFC3, Kifc3 ELISA KIT
ELI-19448m	Lifescience Market	96 Tests	EUR 865

Human Kinesin-Like Protein KIFC3 (KIFC3) ELISA Kit
abx388158-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

KIFC3 Polyclonal Antibody
31617-100ul	SAB	100ul	EUR 252

KIFC3 Polyclonal Antibody
31617-50ul	SAB	50ul	EUR 187

KIFC3 Blocking Peptide
33R-2452	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIFC3 antibody, catalog no. 70R-5600

KIFC3 Blocking Peptide
DF12287-BP	Affbiotech	1mg	EUR 195

KIFC3 cloning plasmid
CSB-CL887134HU-10ug	Cusabio	10ug	EUR 688
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2064 Sequence: atggtggagaatgagcgactgaggcaggagatgcggcgctgtgaggccgagctgcaagagctgcgcacaaagccagcaggtccctgcccaggttgtgagcacagccaggagagcgcccagctccgtgacaagctgtcccagctgcagctggagatggcggaaagcaaaggcatgc Show more
Description: A cloning plasmid for the KIFC3 gene.

KIFC3 Rabbit pAb
A8617-100ul	Abclonal	100 ul	EUR 308

KIFC3 Rabbit pAb
A8617-200ul	Abclonal	200 ul	EUR 459

KIFC3 Rabbit pAb
A8617-20ul	Abclonal	20 ul	EUR 183

KIFC3 Rabbit pAb
A8617-50ul	Abclonal	50 ul	EUR 223

anti- KIFC3 antibody
FNab04574	FN Test	100µg	EUR 505.25
Immunogen: kinesin family member C3 Uniprot ID: Q9BVG8 Gene ID: 3801 Research Area: Cell Division and Proliferation
Description: Antibody raised against KIFC3

Anti-KIFC3 antibody
PAab04574	Lifescience Market	100 ug	EUR 355

Anti-KIFC3 antibody
STJ111344	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms.

KIFC3 ELISA KIT|Human
EF010530	Lifescience Market	96 Tests	EUR 689

KIFC3 Polyclonal Conjugated Antibody
C31617	SAB	100ul	EUR 397

Human KIFC3 shRNA Plasmid
20-abx952572	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse KIFC3 shRNA Plasmid
20-abx971195	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

pCMV-SPORT6-KIFC3 Plasmid
PVT16765	Lifescience Market	2 ug	EUR 325

KIFC3 Recombinant Protein (Human)
RP017029	ABM	100 ug	Ask for price

KIFC3 Recombinant Protein (Rat)
RP207191	ABM	100 ug	Ask for price

KIFC3 Recombinant Protein (Mouse)
RP145778	ABM	100 ug	Ask for price

KIFC3 Recombinant Protein (Mouse)
RP145781	ABM	100 ug	Ask for price

KIFC3 Recombinant Protein (Mouse)
RP145784	ABM	100 ug	Ask for price

Kifc3 ORF Vector (Rat) (pORF)
ORF069065	ABM	1.0 ug DNA	EUR 506

KIFC3 ORF Vector (Human) (pORF)
ORF005677	ABM	1.0 ug DNA	EUR 95

Kifc3 ORF Vector (Mouse) (pORF)
ORF048594	ABM	1.0 ug DNA	EUR 506

Kifc3 ORF Vector (Mouse) (pORF)
ORF048595	ABM	1.0 ug DNA	EUR 506

Kifc3 ORF Vector (Mouse) (pORF)
ORF048596	ABM	1.0 ug DNA	EUR 506

Kifc3 sgRNA CRISPR Lentivector set (Rat)
K7277301	ABM	3 x 1.0 ug	EUR 339

KIFC3 sgRNA CRISPR Lentivector set (Human)
K1149801	ABM	3 x 1.0 ug	EUR 339

Kifc3 sgRNA CRISPR Lentivector set (Mouse)
K4745201	ABM	3 x 1.0 ug	EUR 339

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7277302	ABM	1.0 ug DNA	EUR 154

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7277303	ABM	1.0 ug DNA	EUR 154

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7277304	ABM	1.0 ug DNA	EUR 154

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1149802	ABM	1.0 ug DNA	EUR 154

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1149803	ABM	1.0 ug DNA	EUR 154

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1149804	ABM	1.0 ug DNA	EUR 154

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4745202	ABM	1.0 ug DNA	EUR 154

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4745203	ABM	1.0 ug DNA	EUR 154

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4745204	ABM	1.0 ug DNA	EUR 154

KIFC3 Protein Vector (Human) (pPB-C-His)
PV022705	ABM	500 ng	EUR 329

KIFC3 Protein Vector (Human) (pPB-N-His)
PV022706	ABM	500 ng	EUR 329

KIFC3 Protein Vector (Human) (pPM-C-HA)
PV022707	ABM	500 ng	EUR 329

KIFC3 Protein Vector (Human) (pPM-C-His)
PV022708	ABM	500 ng	EUR 329

KIFC3 Protein Vector (Rat) (pPB-C-His)
PV276258	ABM	500 ng	EUR 1166

KIFC3 Protein Vector (Rat) (pPB-N-His)
PV276259	ABM	500 ng	EUR 1166

KIFC3 Protein Vector (Rat) (pPM-C-HA)
PV276260	ABM	500 ng	EUR 1166

KIFC3 Protein Vector (Rat) (pPM-C-His)
PV276261	ABM	500 ng	EUR 1166

KIFC3 Protein Vector (Mouse) (pPB-C-His)
PV194374	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-N-His)
PV194375	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-HA)
PV194376	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-His)
PV194377	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-C-His)
PV194378	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-N-His)
PV194379	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-HA)
PV194380	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-His)
PV194381	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-C-His)
PV194382	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-N-His)
PV194383	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-HA)
PV194384	ABM	500 ng	EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-His)
PV194385	ABM	500 ng	EUR 1065

Kifc3 3'UTR Luciferase Stable Cell Line
TU110581	ABM	1.0 ml	Ask for price

Kifc3 3'UTR GFP Stable Cell Line
TU160581	ABM	1.0 ml	Ask for price

Kifc3 3'UTR Luciferase Stable Cell Line
TU206714	ABM	1.0 ml	Ask for price

Kifc3 3'UTR GFP Stable Cell Line
TU256714	ABM	1.0 ml	Ask for price

KIFC3 3'UTR GFP Stable Cell Line
TU061791	ABM	1.0 ml	EUR 1394

KIFC3 3'UTR Luciferase Stable Cell Line
TU011791	ABM	1.0 ml	EUR 1394

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV631525	ABM	1.0 ug DNA	EUR 1355

KIFC3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV631529	ABM	1.0 ug DNA	EUR 1355

KIFC3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV631530	ABM	1.0 ug DNA	EUR 1355

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K7277305	ABM	3 x 1.0 ug	EUR 376

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K1149805	ABM	3 x 1.0 ug	EUR 376

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K4745205	ABM	3 x 1.0 ug	EUR 376

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV631526	ABM	1.0 ug DNA	EUR 1355

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV631527	ABM	1.0 ug DNA	EUR 1413

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV631528	ABM	1.0 ug DNA	EUR 1413

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K7277306	ABM	1.0 ug DNA	EUR 167

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K7277307	ABM	1.0 ug DNA	EUR 167

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K7277308	ABM	1.0 ug DNA	EUR 167

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K1149806	ABM	1.0 ug DNA	EUR 167

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1149807	ABM	1.0 ug DNA	EUR 167

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K1149808	ABM	1.0 ug DNA	EUR 167