KIFC3

Kinesin-Like Protein KIFC3 (KIFC3) Antibody

20-abx124088
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Kinesin-Like Protein KIFC3 (KIFC3) Antibody

20-abx321339
  • EUR 439.00
  • EUR 328.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Kinesin-Like Protein KIFC3 (KIFC3) Antibody

abx234574-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

KIFC3 antibody

70R-18128 50 ul
EUR 435.00
Description: Rabbit polyclonal KIFC3 antibody

KIFC3 Antibody

1-CSB-PA887134ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KIFC3. Recognizes KIFC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KIFC3 Antibody

DF12287 200ul
EUR 304.00
Description: KIFC3 antibody detects endogenous levels of KIFC3.

KIFC3 antibody

70R-5600 50 ug
EUR 467.00
Description: Rabbit polyclonal KIFC3 antibody raised against the C terminal of KIFC3

KIFC3 Antibody

1-CSB-PA012350GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KIFC3. Recognizes KIFC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

KIFC3 siRNA

20-abx921655
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

KIFC3 siRNA

20-abx921656
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

anti-KIFC3

YF-PA12833 50 ul
EUR 363.00
Description: Mouse polyclonal to KIFC3

anti-KIFC3

YF-PA12834 50 ug
EUR 363.00
Description: Mouse polyclonal to KIFC3

Human Kinesin- like protein KIFC3, KIFC3 ELISA KIT

ELI-19447h 96 Tests
EUR 824.00

Mouse Kinesin- like protein KIFC3, Kifc3 ELISA KIT

ELI-19448m 96 Tests
EUR 865.00

Human Kinesin-Like Protein KIFC3 (KIFC3) ELISA Kit

abx388158-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

KIFC3 Polyclonal Antibody

31617-100ul 100ul
EUR 252.00

KIFC3 Polyclonal Antibody

31617-50ul 50ul
EUR 187.00

KIFC3 Blocking Peptide

33R-2452 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIFC3 antibody, catalog no. 70R-5600

KIFC3 Blocking Peptide

DF12287-BP 1mg
EUR 195.00

KIFC3 cloning plasmid

CSB-CL887134HU-10ug 10ug
EUR 688.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2064
  • Sequence: atggtggagaatgagcgactgaggcaggagatgcggcgctgtgaggccgagctgcaagagctgcgcacaaagccagcaggtccctgcccaggttgtgagcacagccaggagagcgcccagctccgtgacaagctgtcccagctgcagctggagatggcggaaagcaaaggcatgc
  • Show more
Description: A cloning plasmid for the KIFC3 gene.

KIFC3 Rabbit pAb

A8617-100ul 100 ul
EUR 308.00

KIFC3 Rabbit pAb

A8617-200ul 200 ul
EUR 459.00

KIFC3 Rabbit pAb

A8617-20ul 20 ul
EUR 183.00

KIFC3 Rabbit pAb

A8617-50ul 50 ul
EUR 223.00

anti- KIFC3 antibody

FNab04574 100µg
EUR 505.25
  • Immunogen: kinesin family member C3
  • Uniprot ID: Q9BVG8
  • Gene ID: 3801
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against KIFC3

Anti-KIFC3 antibody

PAab04574 100 ug
EUR 355.00

Anti-KIFC3 antibody

STJ111344 100 µl
EUR 277.00
Description: This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms.

KIFC3 ELISA KIT|Human

EF010530 96 Tests
EUR 689.00

KIFC3 Polyclonal Conjugated Antibody

C31617 100ul
EUR 397.00

Human KIFC3 shRNA Plasmid

20-abx952572
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse KIFC3 shRNA Plasmid

20-abx971195
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

pCMV-SPORT6-KIFC3 Plasmid

PVT16765 2 ug
EUR 325.00

KIFC3 Recombinant Protein (Human)

RP017029 100 ug Ask for price

KIFC3 Recombinant Protein (Rat)

RP207191 100 ug Ask for price

KIFC3 Recombinant Protein (Mouse)

RP145778 100 ug Ask for price

KIFC3 Recombinant Protein (Mouse)

RP145781 100 ug Ask for price

KIFC3 Recombinant Protein (Mouse)

RP145784 100 ug Ask for price

Kifc3 ORF Vector (Rat) (pORF)

ORF069065 1.0 ug DNA
EUR 506.00

KIFC3 ORF Vector (Human) (pORF)

ORF005677 1.0 ug DNA
EUR 95.00

Kifc3 ORF Vector (Mouse) (pORF)

ORF048594 1.0 ug DNA
EUR 506.00

Kifc3 ORF Vector (Mouse) (pORF)

ORF048595 1.0 ug DNA
EUR 506.00

Kifc3 ORF Vector (Mouse) (pORF)

ORF048596 1.0 ug DNA
EUR 506.00

Kifc3 sgRNA CRISPR Lentivector set (Rat)

K7277301 3 x 1.0 ug
EUR 339.00

KIFC3 sgRNA CRISPR Lentivector set (Human)

K1149801 3 x 1.0 ug
EUR 339.00

Kifc3 sgRNA CRISPR Lentivector set (Mouse)

K4745201 3 x 1.0 ug
EUR 339.00

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7277302 1.0 ug DNA
EUR 154.00

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7277303 1.0 ug DNA
EUR 154.00

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7277304 1.0 ug DNA
EUR 154.00

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1149802 1.0 ug DNA
EUR 154.00

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1149803 1.0 ug DNA
EUR 154.00

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1149804 1.0 ug DNA
EUR 154.00

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4745202 1.0 ug DNA
EUR 154.00

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4745203 1.0 ug DNA
EUR 154.00

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4745204 1.0 ug DNA
EUR 154.00

KIFC3 Protein Vector (Human) (pPB-C-His)

PV022705 500 ng
EUR 329.00

KIFC3 Protein Vector (Human) (pPB-N-His)

PV022706 500 ng
EUR 329.00

KIFC3 Protein Vector (Human) (pPM-C-HA)

PV022707 500 ng
EUR 329.00

KIFC3 Protein Vector (Human) (pPM-C-His)

PV022708 500 ng
EUR 329.00

KIFC3 Protein Vector (Rat) (pPB-C-His)

PV276258 500 ng
EUR 1166.00

KIFC3 Protein Vector (Rat) (pPB-N-His)

PV276259 500 ng
EUR 1166.00

KIFC3 Protein Vector (Rat) (pPM-C-HA)

PV276260 500 ng
EUR 1166.00

KIFC3 Protein Vector (Rat) (pPM-C-His)

PV276261 500 ng
EUR 1166.00

KIFC3 Protein Vector (Mouse) (pPB-C-His)

PV194374 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPB-N-His)

PV194375 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPM-C-HA)

PV194376 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPM-C-His)

PV194377 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPB-C-His)

PV194378 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPB-N-His)

PV194379 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPM-C-HA)

PV194380 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPM-C-His)

PV194381 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPB-C-His)

PV194382 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPB-N-His)

PV194383 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPM-C-HA)

PV194384 500 ng
EUR 1065.00

KIFC3 Protein Vector (Mouse) (pPM-C-His)

PV194385 500 ng
EUR 1065.00

Kifc3 3'UTR Luciferase Stable Cell Line

TU110581 1.0 ml Ask for price

Kifc3 3'UTR GFP Stable Cell Line

TU160581 1.0 ml Ask for price

Kifc3 3'UTR Luciferase Stable Cell Line

TU206714 1.0 ml Ask for price

Kifc3 3'UTR GFP Stable Cell Line

TU256714 1.0 ml Ask for price

KIFC3 3'UTR GFP Stable Cell Line

TU061791 1.0 ml
EUR 1394.00

KIFC3 3'UTR Luciferase Stable Cell Line

TU011791 1.0 ml
EUR 1394.00

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV631525 1.0 ug DNA
EUR 1355.00

KIFC3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV631529 1.0 ug DNA
EUR 1355.00

KIFC3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV631530 1.0 ug DNA
EUR 1355.00

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7277305 3 x 1.0 ug
EUR 376.00

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1149805 3 x 1.0 ug
EUR 376.00

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4745205 3 x 1.0 ug
EUR 376.00

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV631526 1.0 ug DNA
EUR 1355.00

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV631527 1.0 ug DNA
EUR 1413.00

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV631528 1.0 ug DNA
EUR 1413.00

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7277306 1.0 ug DNA
EUR 167.00

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7277307 1.0 ug DNA
EUR 167.00

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7277308 1.0 ug DNA
EUR 167.00

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1149806 1.0 ug DNA
EUR 167.00

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1149807 1.0 ug DNA
EUR 167.00

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1149808 1.0 ug DNA
EUR 167.00