Kinesin-Like Protein KIFC3 (KIFC3) Antibody

20-abx124088
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kinesin-Like Protein KIFC3 (KIFC3) Antibody

20-abx321339
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Kinesin-Like Protein KIFC3 (KIFC3) Antibody

abx234574-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

KIFC3 antibody

70R-18128 50 ul
EUR 435
Description: Rabbit polyclonal KIFC3 antibody

KIFC3 Antibody

1-CSB-PA887134ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KIFC3. Recognizes KIFC3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KIFC3 Antibody

DF12287 200ul
EUR 304
Description: KIFC3 antibody detects endogenous levels of KIFC3.

KIFC3 antibody

70R-5600 50 ug
EUR 467
Description: Rabbit polyclonal KIFC3 antibody raised against the C terminal of KIFC3

KIFC3 Antibody

1-CSB-PA012350GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against KIFC3. Recognizes KIFC3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

KIFC3 siRNA

20-abx921655
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KIFC3 siRNA

20-abx921656
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-KIFC3

YF-PA12833 50 ul
EUR 363
Description: Mouse polyclonal to KIFC3

anti-KIFC3

YF-PA12834 50 ug
EUR 363
Description: Mouse polyclonal to KIFC3

Human Kinesin- like protein KIFC3, KIFC3 ELISA KIT

ELI-19447h 96 Tests
EUR 824

Mouse Kinesin- like protein KIFC3, Kifc3 ELISA KIT

ELI-19448m 96 Tests
EUR 865

Human Kinesin-Like Protein KIFC3 (KIFC3) ELISA Kit

abx388158-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

KIFC3 Polyclonal Antibody

31617-100ul 100ul
EUR 252

KIFC3 Polyclonal Antibody

31617-50ul 50ul
EUR 187

KIFC3 Blocking Peptide

33R-2452 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of KIFC3 antibody, catalog no. 70R-5600

KIFC3 Blocking Peptide

DF12287-BP 1mg
EUR 195

KIFC3 cloning plasmid

CSB-CL887134HU-10ug 10ug
EUR 688
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2064
  • Sequence: atggtggagaatgagcgactgaggcaggagatgcggcgctgtgaggccgagctgcaagagctgcgcacaaagccagcaggtccctgcccaggttgtgagcacagccaggagagcgcccagctccgtgacaagctgtcccagctgcagctggagatggcggaaagcaaaggcatgc
  • Show more
Description: A cloning plasmid for the KIFC3 gene.

KIFC3 Rabbit pAb

A8617-100ul 100 ul
EUR 308

KIFC3 Rabbit pAb

A8617-200ul 200 ul
EUR 459

KIFC3 Rabbit pAb

A8617-20ul 20 ul
EUR 183

KIFC3 Rabbit pAb

A8617-50ul 50 ul
EUR 223

anti- KIFC3 antibody

FNab04574 100µg
EUR 505.25
  • Immunogen: kinesin family member C3
  • Uniprot ID: Q9BVG8
  • Gene ID: 3801
  • Research Area: Cell Division and Proliferation
Description: Antibody raised against KIFC3

Anti-KIFC3 antibody

PAab04574 100 ug
EUR 355

Anti-KIFC3 antibody

STJ111344 100 µl
EUR 277
Description: This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms.

KIFC3 ELISA KIT|Human

EF010530 96 Tests
EUR 689

KIFC3 Polyclonal Conjugated Antibody

C31617 100ul
EUR 397

Human KIFC3 shRNA Plasmid

20-abx952572
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse KIFC3 shRNA Plasmid

20-abx971195
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

pCMV-SPORT6-KIFC3 Plasmid

PVT16765 2 ug
EUR 325

KIFC3 Recombinant Protein (Human)

RP017029 100 ug Ask for price

KIFC3 Recombinant Protein (Rat)

RP207191 100 ug Ask for price

KIFC3 Recombinant Protein (Mouse)

RP145778 100 ug Ask for price

KIFC3 Recombinant Protein (Mouse)

RP145781 100 ug Ask for price

KIFC3 Recombinant Protein (Mouse)

RP145784 100 ug Ask for price

Kifc3 ORF Vector (Rat) (pORF)

ORF069065 1.0 ug DNA
EUR 506

KIFC3 ORF Vector (Human) (pORF)

ORF005677 1.0 ug DNA
EUR 95

Kifc3 ORF Vector (Mouse) (pORF)

ORF048594 1.0 ug DNA
EUR 506

Kifc3 ORF Vector (Mouse) (pORF)

ORF048595 1.0 ug DNA
EUR 506

Kifc3 ORF Vector (Mouse) (pORF)

ORF048596 1.0 ug DNA
EUR 506

Kifc3 sgRNA CRISPR Lentivector set (Rat)

K7277301 3 x 1.0 ug
EUR 339

KIFC3 sgRNA CRISPR Lentivector set (Human)

K1149801 3 x 1.0 ug
EUR 339

Kifc3 sgRNA CRISPR Lentivector set (Mouse)

K4745201 3 x 1.0 ug
EUR 339

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7277302 1.0 ug DNA
EUR 154

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7277303 1.0 ug DNA
EUR 154

Kifc3 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7277304 1.0 ug DNA
EUR 154

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1149802 1.0 ug DNA
EUR 154

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1149803 1.0 ug DNA
EUR 154

KIFC3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1149804 1.0 ug DNA
EUR 154

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4745202 1.0 ug DNA
EUR 154

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4745203 1.0 ug DNA
EUR 154

Kifc3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4745204 1.0 ug DNA
EUR 154

KIFC3 Protein Vector (Human) (pPB-C-His)

PV022705 500 ng
EUR 329

KIFC3 Protein Vector (Human) (pPB-N-His)

PV022706 500 ng
EUR 329

KIFC3 Protein Vector (Human) (pPM-C-HA)

PV022707 500 ng
EUR 329

KIFC3 Protein Vector (Human) (pPM-C-His)

PV022708 500 ng
EUR 329

KIFC3 Protein Vector (Rat) (pPB-C-His)

PV276258 500 ng
EUR 1166

KIFC3 Protein Vector (Rat) (pPB-N-His)

PV276259 500 ng
EUR 1166

KIFC3 Protein Vector (Rat) (pPM-C-HA)

PV276260 500 ng
EUR 1166

KIFC3 Protein Vector (Rat) (pPM-C-His)

PV276261 500 ng
EUR 1166

KIFC3 Protein Vector (Mouse) (pPB-C-His)

PV194374 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-N-His)

PV194375 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-HA)

PV194376 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-His)

PV194377 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-C-His)

PV194378 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-N-His)

PV194379 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-HA)

PV194380 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-His)

PV194381 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-C-His)

PV194382 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPB-N-His)

PV194383 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-HA)

PV194384 500 ng
EUR 1065

KIFC3 Protein Vector (Mouse) (pPM-C-His)

PV194385 500 ng
EUR 1065

Kifc3 3'UTR Luciferase Stable Cell Line

TU110581 1.0 ml Ask for price

Kifc3 3'UTR GFP Stable Cell Line

TU160581 1.0 ml Ask for price

Kifc3 3'UTR Luciferase Stable Cell Line

TU206714 1.0 ml Ask for price

Kifc3 3'UTR GFP Stable Cell Line

TU256714 1.0 ml Ask for price

KIFC3 3'UTR GFP Stable Cell Line

TU061791 1.0 ml
EUR 1394

KIFC3 3'UTR Luciferase Stable Cell Line

TU011791 1.0 ml
EUR 1394

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV631525 1.0 ug DNA
EUR 1355

KIFC3 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV631529 1.0 ug DNA
EUR 1355

KIFC3 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV631530 1.0 ug DNA
EUR 1355

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7277305 3 x 1.0 ug
EUR 376

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1149805 3 x 1.0 ug
EUR 376

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4745205 3 x 1.0 ug
EUR 376

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV631526 1.0 ug DNA
EUR 1355

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV631527 1.0 ug DNA
EUR 1413

KIFC3 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV631528 1.0 ug DNA
EUR 1413

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7277306 1.0 ug DNA
EUR 167

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7277307 1.0 ug DNA
EUR 167

Kifc3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7277308 1.0 ug DNA
EUR 167

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1149806 1.0 ug DNA
EUR 167

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1149807 1.0 ug DNA
EUR 167

KIFC3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1149808 1.0 ug DNA
EUR 167