MAT2B

MAT2B siRNA

20-abx903171
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MAT2B siRNA

20-abx923616
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MAT2B siRNA

20-abx923617
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MAT2B antibody

70R-3571 50 ug
EUR 467.00
Description: Rabbit polyclonal MAT2B antibody raised against the N terminal of MAT2B

MAT2B antibody

70R-3455 50 ug
EUR 467.00
Description: Rabbit polyclonal MAT2B antibody raised against the middle region of MAT2B

MAT2B Antibody

42910-100ul 100ul
EUR 252.00

MAT2B antibody

70R-18422 50 ul
EUR 435.00
Description: Rabbit polyclonal MAT2B antibody

MAT2B Antibody

1-CSB-PA882157LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:200-1:2000, IF:1:50-1:200

MAT2B Antibody

DF12080 200ul
EUR 304.00
Description: MAT2B antibody detects endogenous levels of MAT2B.

MAT2B Antibody

1-CSB-PA013518GA01HU
  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

anti-MAT2B

YF-PA26065 50 ul
EUR 334.00
Description: Mouse polyclonal to MAT2B

MAT2B Conjugated Antibody

C42910 100ul
EUR 397.00

anti- MAT2B antibody

FNab05028 100µg
EUR 548.75
  • Immunogen: methionine adenosyltransferase II, beta
  • Uniprot ID: Q9NZL9
  • Gene ID: 27430
  • Research Area: Metabolism
Description: Antibody raised against MAT2B

MAT2B Rabbit pAb

A11608-100ul 100 ul
EUR 308.00

MAT2B Rabbit pAb

A11608-200ul 200 ul
EUR 459.00

MAT2B Rabbit pAb

A11608-20ul 20 ul
EUR 183.00

MAT2B Rabbit pAb

A11608-50ul 50 ul
EUR 223.00

MAT2B Rabbit pAb

A3421-100ul 100 ul
EUR 308.00

MAT2B Rabbit pAb

A3421-200ul 200 ul
EUR 459.00

MAT2B Rabbit pAb

A3421-20ul 20 ul Ask for price

MAT2B Rabbit pAb

A3421-50ul 50 ul Ask for price

MAT2B Blocking Peptide

33R-3451 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAT2B antibody, catalog no. 70R-3455

MAT2B Blocking Peptide

33R-4332 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAT2B antibody, catalog no. 70R-3571

MAT2B cloning plasmid

CSB-CL882157HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1005
  • Sequence: atggtggggcgggagaaagagctctctatacactttgttcccgggagctgtcggctggtggaggaggaagttaacatccctaataggagggttctggttactggtgccactgggcttcttggcagagctgtacacaaagaatttcagcagaataattggcatgcagttggctgtg
  • Show more
Description: A cloning plasmid for the MAT2B gene.

MAT2B cloning plasmid

CSB-CL882157HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atgcctgaaatgccagaggacatggagcaggaggaagttaacatccctaataggagggttctggttactggtgccactgggcttcttggcagagctgtacacaaagaatttcagcagaataattggcatgcagttggctgtggtttcagaagagcaagaccaaaatttgaacaggt
  • Show more
Description: A cloning plasmid for the MAT2B gene.

MAT2B Blocking Peptide

DF12080-BP 1mg
EUR 195.00

Anti-MAT2B antibody

PAab05028 100 ug
EUR 386.00

Anti-MAT2B antibody

STJ24504 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the methionine adenosyltransferase (MAT) family. MAT catalyzes the biosynthesis of S-adenosylmethionine from methionine and ATP. This protein is the regulatory beta subunit of MAT. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-MAT2B antibody

STJ113213 100 µl
EUR 277.00
Description: The protein encoded by this gene belongs to the methionine adenosyltransferase (MAT) family. MAT catalyzes the biosynthesis of S-adenosylmethionine from methionine and ATP. This protein is the regulatory beta subunit of MAT. Alternative splicing results in multiple transcript variants encoding different isoforms.

Mouse MAT2B shRNA Plasmid

20-abx979908
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse Mat2b ELISA KIT

ELI-19570m 96 Tests
EUR 865.00

Bovine MAT2B ELISA KIT

ELI-22759b 96 Tests
EUR 928.00

MAT2B ELISA KIT|Human

EF010850 96 Tests
EUR 689.00

Human MAT2B ELISA KIT

ELI-48191h 96 Tests
EUR 824.00

MAT2B (Isoform 1) Antibody

abx431040-200ul 200 ul
EUR 384.00
  • Shipped within 1-3 working days.

Human MAT2B shRNA Plasmid

20-abx959103
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat MAT2B shRNA Plasmid

20-abx991131
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

MAT2B Antibody, HRP conjugated

1-CSB-PA882157LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAT2B Antibody, FITC conjugated

1-CSB-PA882157LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAT2B Antibody, Biotin conjugated

1-CSB-PA882157LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MAT2B Recombinant Protein (Human)

RP018871 100 ug Ask for price

MAT2B Recombinant Protein (Human)

RP018874 100 ug Ask for price

MAT2B Recombinant Protein (Rat)

RP210953 100 ug Ask for price

pCMV-SPORT6-Mat2b-m

PVT18921 2 ug
EUR 231.00

MAT2B Recombinant Protein (Mouse)

RP149570 100 ug Ask for price

MAT2B Recombinant Protein (Mouse)

RP149573 100 ug Ask for price

Polyclonal MAT2B Antibody (N-term)

APR08338G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAT2B (N-term). This antibody is tested and proven to work in the following applications:

MAT2B ORF Vector (Human) (pORF)

ORF006291 1.0 ug DNA
EUR 95.00

MAT2B ORF Vector (Human) (pORF)

ORF006292 1.0 ug DNA
EUR 95.00

Mat2b ORF Vector (Mouse) (pORF)

ORF049858 1.0 ug DNA
EUR 506.00

Mat2b ORF Vector (Mouse) (pORF)

ORF049859 1.0 ug DNA
EUR 506.00

Mat2b ORF Vector (Rat) (pORF)

ORF070319 1.0 ug DNA
EUR 506.00

Anti-MAT2B (isoform 1) antibody

STJ72835 100 µg
EUR 359.00

MAT2B ELISA Kit (Human) (OKCA00722)

OKCA00722 96 Wells
EUR 833.00
Description: Description of target: Regulatory subunit of S-adenosylmethionine synthetase 2, an enzyme that catalyzes the formation of S-adenosylmethionine from methionine and ATP. Regulates MAT2A catalytic activity by changing its kinetic properties, increasing its affinity for L-methionine . Can bind NADP (in vitro) .;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.68 pg/mL

Methionine Adenosyltransferase II Beta (MAT2B) Antibody

20-abx126129
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody

20-abx113702
  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody

20-abx002455
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody

abx146327-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody

abx034413-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody

abx034413-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody

abx235028-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody

20-abx301092
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

MAT2B sgRNA CRISPR Lentivector set (Human)

K1272901 3 x 1.0 ug
EUR 339.00

Mat2b sgRNA CRISPR Lentivector set (Mouse)

K4652901 3 x 1.0 ug
EUR 339.00

Mat2b sgRNA CRISPR Lentivector set (Rat)

K7493301 3 x 1.0 ug
EUR 339.00

Polyclonal MAT2B (isoform 1) Antibody (N-Term)

APR08337G 0.1 mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MAT2B (isoform 1) (N-Term). This antibody is tested and proven to work in the following applications:

Methionine Adenosyltransferase II Beta (MAT2B) Antibody (HRP)

20-abx316594
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody (FITC)

20-abx316595
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody (Biotin)

20-abx316596
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

MAT2B sgRNA CRISPR Lentivector (Human) (Target 1)

K1272902 1.0 ug DNA
EUR 154.00

MAT2B sgRNA CRISPR Lentivector (Human) (Target 2)

K1272903 1.0 ug DNA
EUR 154.00

MAT2B sgRNA CRISPR Lentivector (Human) (Target 3)

K1272904 1.0 ug DNA
EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4652902 1.0 ug DNA
EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4652903 1.0 ug DNA
EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4652904 1.0 ug DNA
EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Rat) (Target 1)

K7493302 1.0 ug DNA
EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Rat) (Target 2)

K7493303 1.0 ug DNA
EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Rat) (Target 3)

K7493304 1.0 ug DNA
EUR 154.00

Recombinant Human MAT2B Protein, Untagged, E.coli-1mg

QP12651-1mg 1mg
EUR 3655.00

Recombinant Human MAT2B Protein, Untagged, E.coli-20ug

QP12651-20ug 20ug
EUR 201.00

Recombinant Human MAT2B Protein, Untagged, E.coli-5ug

QP12651-5ug 5ug
EUR 155.00

MAT2B Protein Vector (Rat) (pPB-C-His)

PV281274 500 ng
EUR 603.00

MAT2B Protein Vector (Rat) (pPB-N-His)

PV281275 500 ng
EUR 603.00

MAT2B Protein Vector (Rat) (pPM-C-HA)

PV281276 500 ng
EUR 603.00

MAT2B Protein Vector (Rat) (pPM-C-His)

PV281277 500 ng
EUR 603.00

MAT2B Protein Vector (Human) (pPB-C-His)

PV025161 500 ng Ask for price

MAT2B Protein Vector (Human) (pPB-N-His)

PV025162 500 ng Ask for price

MAT2B Protein Vector (Human) (pPM-C-HA)

PV025163 500 ng Ask for price

MAT2B Protein Vector (Human) (pPM-C-His)

PV025164 500 ng Ask for price

MAT2B Protein Vector (Human) (pPB-C-His)

PV025165 500 ng Ask for price

MAT2B Protein Vector (Human) (pPB-N-His)

PV025166 500 ng Ask for price

MAT2B Protein Vector (Human) (pPM-C-HA)

PV025167 500 ng Ask for price

MAT2B Protein Vector (Human) (pPM-C-His)

PV025168 500 ng Ask for price

MAT2B Protein Vector (Mouse) (pPB-C-His)

PV199430 500 ng
EUR 603.00

MAT2B Protein Vector (Mouse) (pPB-N-His)

PV199431 500 ng
EUR 603.00