MAT2B antibody
70R-18422	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal MAT2B antibody

MAT2B Antibody
42910-100ul	SAB	100ul	EUR 252.00

MAT2B Antibody
1-CSB-PA882157LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:200-1:2000, IF:1:50-1:200

MAT2B Antibody
DF12080	Affbiotech	200ul	EUR 304.00
Description: MAT2B antibody detects endogenous levels of MAT2B.

MAT2B antibody
70R-3455	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal MAT2B antibody raised against the middle region of MAT2B

MAT2B antibody
70R-3571	Fitzgerald	50 ug	EUR 467.00
Description: Rabbit polyclonal MAT2B antibody raised against the N terminal of MAT2B

MAT2B Antibody
1-CSB-PA013518GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

MAT2B siRNA
20-abx903171	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

MAT2B siRNA
20-abx923616	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

MAT2B siRNA
20-abx923617	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

anti-MAT2B
YF-PA26065	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to MAT2B

MAT2B Rabbit pAb
A11608-100ul	Abclonal	100 ul	EUR 308.00

MAT2B Rabbit pAb
A11608-200ul	Abclonal	200 ul	EUR 459.00

MAT2B Rabbit pAb
A11608-20ul	Abclonal	20 ul	EUR 183.00

MAT2B Rabbit pAb
A11608-50ul	Abclonal	50 ul	EUR 223.00

MAT2B Blocking Peptide
33R-3451	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAT2B antibody, catalog no. 70R-3455

MAT2B Blocking Peptide
33R-4332	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MAT2B antibody, catalog no. 70R-3571

MAT2B Blocking Peptide
DF12080-BP	Affbiotech	1mg	EUR 195.00

MAT2B Conjugated Antibody
C42910	SAB	100ul	EUR 397.00

MAT2B cloning plasmid
CSB-CL882157HU1-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1005 Sequence: atggtggggcgggagaaagagctctctatacactttgttcccgggagctgtcggctggtggaggaggaagttaacatccctaataggagggttctggttactggtgccactgggcttcttggcagagctgtacacaaagaatttcagcagaataattggcatgcagttggctgtg Show more
Description: A cloning plasmid for the MAT2B gene.

MAT2B cloning plasmid
CSB-CL882157HU2-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 972 Sequence: atgcctgaaatgccagaggacatggagcaggaggaagttaacatccctaataggagggttctggttactggtgccactgggcttcttggcagagctgtacacaaagaatttcagcagaataattggcatgcagttggctgtggtttcagaagagcaagaccaaaatttgaacaggt Show more
Description: A cloning plasmid for the MAT2B gene.

MAT2B Rabbit pAb
A3421-100ul	Abclonal	100 ul	EUR 308.00

MAT2B Rabbit pAb
A3421-200ul	Abclonal	200 ul	EUR 459.00

MAT2B Rabbit pAb
A3421-20ul	Abclonal	20 ul	Ask for price

MAT2B Rabbit pAb
A3421-50ul	Abclonal	50 ul	Ask for price

anti- MAT2B antibody
FNab05028	FN Test	100µg	EUR 548.75
Immunogen: methionine adenosyltransferase II, beta Uniprot ID: Q9NZL9 Gene ID: 27430 Research Area: Metabolism
Description: Antibody raised against MAT2B

Anti-MAT2B antibody
PAab05028	Lifescience Market	100 ug	EUR 386.00

Anti-MAT2B antibody
STJ24504	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene belongs to the methionine adenosyltransferase (MAT) family. MAT catalyzes the biosynthesis of S-adenosylmethionine from methionine and ATP. This protein is the regulatory beta subunit of MAT. Alternative splicing results in multiple transcript variants encoding different isoforms.

Anti-MAT2B antibody
STJ113213	St John's Laboratory	100 µl	EUR 277.00
Description: The protein encoded by this gene belongs to the methionine adenosyltransferase (MAT) family. MAT catalyzes the biosynthesis of S-adenosylmethionine from methionine and ATP. This protein is the regulatory beta subunit of MAT. Alternative splicing results in multiple transcript variants encoding different isoforms.

MAT2B Antibody, HRP conjugated
1-CSB-PA882157LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MAT2B Antibody, FITC conjugated
1-CSB-PA882157LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MAT2B Antibody, Biotin conjugated
1-CSB-PA882157LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAT2B. Recognizes MAT2B from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Mouse Mat2b ELISA KIT
ELI-19570m	Lifescience Market	96 Tests	EUR 865.00

Bovine MAT2B ELISA KIT
ELI-22759b	Lifescience Market	96 Tests	EUR 928.00

MAT2B ELISA KIT|Human
EF010850	Lifescience Market	96 Tests	EUR 689.00

Rat MAT2B shRNA Plasmid
20-abx991131	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

MAT2B (Isoform 1) Antibody
abx431040-200ul	Abbexa	200 ul	EUR 384.00
Shipped within 1-3 working days.

Human MAT2B shRNA Plasmid
20-abx959103	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse MAT2B shRNA Plasmid
20-abx979908	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human MAT2B ELISA KIT
ELI-48191h	Lifescience Market	96 Tests	EUR 824.00

pCMV-SPORT6-Mat2b-m
PVT18921	Lifescience Market	2 ug	EUR 231.00

MAT2B Recombinant Protein (Human)
RP018871	ABM	100 ug	Ask for price

MAT2B Recombinant Protein (Human)
RP018874	ABM	100 ug	Ask for price

MAT2B Recombinant Protein (Mouse)
RP149570	ABM	100 ug	Ask for price

MAT2B Recombinant Protein (Mouse)
RP149573	ABM	100 ug	Ask for price

MAT2B Recombinant Protein (Rat)
RP210953	ABM	100 ug	Ask for price

Polyclonal MAT2B Antibody (N-term)
APR08338G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MAT2B (N-term). This antibody is tested and proven to work in the following applications:

Mat2b ORF Vector (Rat) (pORF)
ORF070319	ABM	1.0 ug DNA	EUR 506.00

MAT2B ORF Vector (Human) (pORF)
ORF006291	ABM	1.0 ug DNA	EUR 95.00

MAT2B ORF Vector (Human) (pORF)
ORF006292	ABM	1.0 ug DNA	EUR 95.00

Mat2b ORF Vector (Mouse) (pORF)
ORF049858	ABM	1.0 ug DNA	EUR 506.00

Mat2b ORF Vector (Mouse) (pORF)
ORF049859	ABM	1.0 ug DNA	EUR 506.00

Anti-MAT2B (isoform 1) antibody
STJ72835	St John's Laboratory	100 µg	EUR 359.00

MAT2B ELISA Kit (Human) (OKCA00722)
OKCA00722	Aviva Systems Biology	96 Wells	EUR 833.00
Description: Description of target: Regulatory subunit of S-adenosylmethionine synthetase 2, an enzyme that catalyzes the formation of S-adenosylmethionine from methionine and ATP. Regulates MAT2A catalytic activity by changing its kinetic properties, increasing its affinity for L-methionine . Can bind NADP (in vitro) .;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 4.68 pg/mL

Methionine Adenosyltransferase II Beta (MAT2B) Antibody
20-abx113702	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody
20-abx126129	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody
abx146327-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody
abx034413-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody
abx034413-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody
abx235028-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody
20-abx301092	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody
20-abx002455	Abbexa	EUR 411.00 EUR 592.00	0 1
Shipped within 5-10 working days.

Mat2b sgRNA CRISPR Lentivector set (Rat)
K7493301	ABM	3 x 1.0 ug	EUR 339.00

Mat2b sgRNA CRISPR Lentivector set (Mouse)
K4652901	ABM	3 x 1.0 ug	EUR 339.00

MAT2B sgRNA CRISPR Lentivector set (Human)
K1272901	ABM	3 x 1.0 ug	EUR 339.00

Polyclonal MAT2B (isoform 1) Antibody (N-Term)
APR08337G	Leading Biology	0.1 mg	EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MAT2B (isoform 1) (N-Term). This antibody is tested and proven to work in the following applications:

Methionine Adenosyltransferase II Beta (MAT2B) Antibody (HRP)
20-abx316594	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody (FITC)
20-abx316595	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Methionine Adenosyltransferase II Beta (MAT2B) Antibody (Biotin)
20-abx316596	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Mat2b sgRNA CRISPR Lentivector (Rat) (Target 1)
K7493302	ABM	1.0 ug DNA	EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Rat) (Target 2)
K7493303	ABM	1.0 ug DNA	EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Rat) (Target 3)
K7493304	ABM	1.0 ug DNA	EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4652902	ABM	1.0 ug DNA	EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4652903	ABM	1.0 ug DNA	EUR 154.00

Mat2b sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4652904	ABM	1.0 ug DNA	EUR 154.00

MAT2B sgRNA CRISPR Lentivector (Human) (Target 1)
K1272902	ABM	1.0 ug DNA	EUR 154.00

MAT2B sgRNA CRISPR Lentivector (Human) (Target 2)
K1272903	ABM	1.0 ug DNA	EUR 154.00

MAT2B sgRNA CRISPR Lentivector (Human) (Target 3)
K1272904	ABM	1.0 ug DNA	EUR 154.00

MAT2B Protein Vector (Human) (pPB-C-His)
PV025161	ABM	500 ng	Ask for price

MAT2B Protein Vector (Human) (pPB-N-His)
PV025162	ABM	500 ng	Ask for price

MAT2B Protein Vector (Human) (pPM-C-HA)
PV025163	ABM	500 ng	Ask for price

MAT2B Protein Vector (Human) (pPM-C-His)
PV025164	ABM	500 ng	Ask for price

MAT2B Protein Vector (Human) (pPB-C-His)
PV025165	ABM	500 ng	Ask for price

MAT2B Protein Vector (Human) (pPB-N-His)
PV025166	ABM	500 ng	Ask for price

MAT2B Protein Vector (Human) (pPM-C-HA)
PV025167	ABM	500 ng	Ask for price

MAT2B Protein Vector (Human) (pPM-C-His)
PV025168	ABM	500 ng	Ask for price

MAT2B Protein Vector (Rat) (pPB-C-His)
PV281274	ABM	500 ng	EUR 603.00

MAT2B Protein Vector (Rat) (pPB-N-His)
PV281275	ABM	500 ng	EUR 603.00

MAT2B Protein Vector (Rat) (pPM-C-HA)
PV281276	ABM	500 ng	EUR 603.00

MAT2B Protein Vector (Rat) (pPM-C-His)
PV281277	ABM	500 ng	EUR 603.00

MAT2B Protein Vector (Mouse) (pPB-C-His)
PV199430	ABM	500 ng	EUR 603.00

MAT2B Protein Vector (Mouse) (pPB-N-His)
PV199431	ABM	500 ng	EUR 603.00

MAT2B Protein Vector (Mouse) (pPM-C-HA)
PV199432	ABM	500 ng	EUR 603.00

MAT2B Protein Vector (Mouse) (pPM-C-His)
PV199433	ABM	500 ng	EUR 603.00

MAT2B Protein Vector (Mouse) (pPB-C-His)
PV199434	ABM	500 ng	EUR 603.00