MCRS1 Antibody

45283-100ul 100ul
EUR 252.00

MCRS1 Antibody

45283-50ul 50ul
EUR 187.00

MCRS1 Antibody

DF8361 200ul
EUR 304.00
Description: MCRS1 Antibody detects endogenous levels of total MCRS1.

MCRS1 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MCRS1 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

MCRS1 Antibody

ABD8361 100 ug
EUR 438.00


YF-PA16966 50 ug
EUR 363.00
Description: Mouse polyclonal to MCRS1


YF-PA16967 100 ul
EUR 403.00
Description: Rabbit polyclonal to MCRS1

MCRS1 Blocking Peptide

DF8361-BP 1mg
EUR 195.00

MCRS1 Conjugated Antibody

C45283 100ul
EUR 397.00

MCRS1 cloning plasmid

CSB-CL013611HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1389
  • Sequence: atggacaaagattctcaggggctgctagattcatccctgatggcatcaggcactgccagccgctcagaggatgaggagtcactggcagggcagaagcgagcctcctcccaggccttgggcaccatccctaaacggagaagctcctccaggttcatcaagaggaagaagttcgatg
  • Show more
Description: A cloning plasmid for the MCRS1 gene.

MCRS1 Rabbit pAb

A8061-100ul 100 ul
EUR 308.00

MCRS1 Rabbit pAb

A8061-200ul 200 ul
EUR 459.00

MCRS1 Rabbit pAb

A8061-20ul 20 ul
EUR 183.00

MCRS1 Rabbit pAb

A8061-50ul 50 ul
EUR 223.00

anti- MCRS1 antibody

FNab05066 100µg
EUR 505.25
  • Immunogen: microspherule protein 1
  • Uniprot ID: Q96EZ8
  • Gene ID: 10445
  • Research Area: Metabolism
Description: Antibody raised against MCRS1

anti- MCRS1 antibody

FNab05067 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500-1:2000
  • Immunogen: microspherule protein 1
  • Uniprot ID: Q96EZ8
  • Gene ID: 10445
  • Research Area: Metabolism
Description: Antibody raised against MCRS1

Anti-MCRS1 antibody

PAab05066 100 ug
EUR 355.00

Anti-MCRS1 antibody

STJ110364 100 µl
EUR 277.00


EF000704 96 Tests
EUR 689.00

Mouse MCRS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

MCRS1 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MCRS1 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MCRS1 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human MCRS1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

MCRS1 Recombinant Protein (Human)

RP019027 100 ug Ask for price

MCRS1 Recombinant Protein (Mouse)

RP149882 100 ug Ask for price

MCRS1 Recombinant Protein (Mouse)

RP149885 100 ug Ask for price

MCRS1 Recombinant Protein (Rat)

RP211175 100 ug Ask for price

Microspherule Protein 1 (MCRS1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody

abx145455-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody

abx029123-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody

abx029123-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody

abx235066-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Microspherule Protein 1 (MCRS1) Antibody

abx235067-100ug 100 ug
EUR 509.00
  • Shipped within 5-12 working days.

Microspherule Protein 1 (MCRS1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Mcrs1 ORF Vector (Rat) (pORF)

ORF070393 1.0 ug DNA
EUR 506.00

MCRS1 ORF Vector (Human) (pORF)

ORF006343 1.0 ug DNA
EUR 95.00

Mcrs1 ORF Vector (Mouse) (pORF)

ORF049962 1.0 ug DNA
EUR 506.00

Mcrs1 ORF Vector (Mouse) (pORF)

ORF049963 1.0 ug DNA
EUR 506.00

MCRS1 ELISA Kit (Human) (OKEI00141)

OKEI00141 96 Wells
EUR 767.00
Description: Description of target: Modulates the transcription repressor activity of DAXX by recruiting it to the nucleolus . As part of the NSL complex it may be involved in acetylation of nucleosomal histone H4 on several lysine residues . Putative regulatory component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair. May also be an inhibitor of TERT telomerase activity . Binds to G-quadruplex structures in mRNA . Binds to RNA homopolymer poly(G) and poly(U) .;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Microspherule Protein 1 (MCRS1) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Mcrs1 sgRNA CRISPR Lentivector set (Rat)

K7154301 3 x 1.0 ug
EUR 339.00

MCRS1 sgRNA CRISPR Lentivector set (Human)

K1282001 3 x 1.0 ug
EUR 339.00

Mcrs1 sgRNA CRISPR Lentivector set (Mouse)

K4740201 3 x 1.0 ug
EUR 339.00

Mouse Microspherule protein 1, Mcrs1 ELISA KIT

ELI-22750m 96 Tests
EUR 865.00

Human Microspherule protein 1, MCRS1 ELISA KIT

ELI-08448h 96 Tests
EUR 824.00

Pig Microspherule Protein 1 (MCRS1) ELISA Kit

abx360957-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Rabbit Microspherule Protein 1 (MCRS1) ELISA Kit

abx362960-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Human Microspherule Protein 1 (MCRS1) ELISA Kit

abx354423-96tests 96 tests
EUR 707.00
  • Shipped within 5-12 working days.

Chicken Microspherule Protein 1 (MCRS1) ELISA Kit

abx356065-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Monkey Microspherule Protein 1 (MCRS1) ELISA Kit

abx359226-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

Mouse Microspherule Protein 1 (MCRS1) ELISA Kit

abx389887-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mcrs1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7154302 1.0 ug DNA
EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7154303 1.0 ug DNA
EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7154304 1.0 ug DNA
EUR 154.00

MCRS1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1282002 1.0 ug DNA
EUR 154.00

MCRS1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1282003 1.0 ug DNA
EUR 154.00

MCRS1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1282004 1.0 ug DNA
EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4740202 1.0 ug DNA
EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4740203 1.0 ug DNA
EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4740204 1.0 ug DNA
EUR 154.00

MCRS1 Protein Vector (Rat) (pPB-C-His)

PV281570 500 ng
EUR 603.00

MCRS1 Protein Vector (Rat) (pPB-N-His)

PV281571 500 ng
EUR 603.00

MCRS1 Protein Vector (Rat) (pPM-C-HA)

PV281572 500 ng
EUR 603.00

MCRS1 Protein Vector (Rat) (pPM-C-His)

PV281573 500 ng
EUR 603.00

MCRS1 Protein Vector (Mouse) (pPB-C-His)

PV199846 500 ng
EUR 603.00

MCRS1 Protein Vector (Mouse) (pPB-N-His)

PV199847 500 ng
EUR 603.00

MCRS1 Protein Vector (Mouse) (pPM-C-HA)

PV199848 500 ng
EUR 603.00

MCRS1 Protein Vector (Mouse) (pPM-C-His)

PV199849 500 ng
EUR 603.00

MCRS1 Protein Vector (Mouse) (pPB-C-His)

PV199850 500 ng
EUR 603.00

MCRS1 Protein Vector (Mouse) (pPB-N-His)

PV199851 500 ng
EUR 603.00

MCRS1 Protein Vector (Mouse) (pPM-C-HA)

PV199852 500 ng
EUR 603.00

MCRS1 Protein Vector (Mouse) (pPM-C-His)

PV199853 500 ng
EUR 603.00

Human Microspherule Protein 1(MCRS1)ELISA Kit

QY-E01082 96T
EUR 361.00

MCRS1 Protein Vector (Human) (pPB-C-His)

PV025369 500 ng
EUR 329.00

MCRS1 Protein Vector (Human) (pPB-N-His)

PV025370 500 ng
EUR 329.00

MCRS1 Protein Vector (Human) (pPM-C-HA)

PV025371 500 ng
EUR 329.00

MCRS1 Protein Vector (Human) (pPM-C-His)

PV025372 500 ng
EUR 329.00

Mcrs1 3'UTR Luciferase Stable Cell Line

TU113014 1.0 ml Ask for price

Mcrs1 3'UTR GFP Stable Cell Line

TU163014 1.0 ml Ask for price

Mcrs1 3'UTR Luciferase Stable Cell Line

TU212986 1.0 ml Ask for price

Mcrs1 3'UTR GFP Stable Cell Line

TU262986 1.0 ml Ask for price

MCRS1 3'UTR GFP Stable Cell Line

TU063140 1.0 ml
EUR 1394.00

MCRS1 3'UTR Luciferase Stable Cell Line

TU013140 1.0 ml
EUR 1394.00

ELISA kit for Human MCRS1 (Microspherule Protein 1)

E-EL-H0541 1 plate of 96 wells
EUR 534.00
  • Gentaur's MCRS1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MCRS1. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MCRS1 (Microspherule Protein 1) in samples from Serum, Plasma, Cell supernatant

Guinea pig Microspherule Protein 1 (MCRS1) ELISA Kit

abx357231-96tests 96 tests
EUR 825.00
  • Shipped within 5-12 working days.

MCRS1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV627565 1.0 ug DNA
EUR 682.00

MCRS1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV627569 1.0 ug DNA
EUR 682.00