MCRS1

MCRS1 siRNA
20-abx923770	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

MCRS1 Antibody
ABD8361	Lifescience Market	100 ug	EUR 438.00

MCRS1 Antibody
45283-100ul	SAB	100ul	EUR 252.00

MCRS1 Antibody
45283-50ul	SAB	50ul	EUR 187.00

MCRS1 antibody
70R-18449	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal MCRS1 antibody

MCRS1 Antibody
DF8361	Affbiotech	200ul	EUR 304.00
Description: MCRS1 Antibody detects endogenous levels of total MCRS1.

MCRS1 Antibody
1-CSB-PA013611GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MCRS1 Antibody
1-CSB-PA013611LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

anti-MCRS1
YF-PA16966	Abfrontier	50 ug	EUR 363.00
Description: Mouse polyclonal to MCRS1

anti-MCRS1
YF-PA16967	Abfrontier	100 ul	EUR 403.00
Description: Rabbit polyclonal to MCRS1

MCRS1 Conjugated Antibody
C45283	SAB	100ul	EUR 397.00

MCRS1 cloning plasmid
CSB-CL013611HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1389 Sequence: atggacaaagattctcaggggctgctagattcatccctgatggcatcaggcactgccagccgctcagaggatgaggagtcactggcagggcagaagcgagcctcctcccaggccttgggcaccatccctaaacggagaagctcctccaggttcatcaagaggaagaagttcgatg Show more
Description: A cloning plasmid for the MCRS1 gene.

anti- MCRS1 antibody
FNab05066	FN Test	100µg	EUR 505.25
Immunogen: microspherule protein 1 Uniprot ID: Q96EZ8 Gene ID: 10445 Research Area: Metabolism
Description: Antibody raised against MCRS1

anti- MCRS1 antibody
FNab05067	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 Immunogen: microspherule protein 1 Uniprot ID: Q96EZ8 Gene ID: 10445 Research Area: Metabolism
Description: Antibody raised against MCRS1

MCRS1 Rabbit pAb
A8061-100ul	Abclonal	100 ul	EUR 308.00

MCRS1 Rabbit pAb
A8061-200ul	Abclonal	200 ul	EUR 459.00

MCRS1 Rabbit pAb
A8061-20ul	Abclonal	20 ul	EUR 183.00

MCRS1 Rabbit pAb
A8061-50ul	Abclonal	50 ul	EUR 223.00

MCRS1 Blocking Peptide
DF8361-BP	Affbiotech	1mg	EUR 195.00

Anti-MCRS1 antibody
PAab05066	Lifescience Market	100 ug	EUR 355.00

Anti-MCRS1 antibody
STJ110364	St John's Laboratory	100 µl	EUR 277.00

Mouse MCRS1 shRNA Plasmid
20-abx974190	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

MCRS1 ELISA KIT|Human
EF000704	Lifescience Market	96 Tests	EUR 689.00

Human MCRS1 shRNA Plasmid
20-abx957085	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

MCRS1 Antibody, HRP conjugated
1-CSB-PA013611LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MCRS1 Antibody, FITC conjugated
1-CSB-PA013611LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MCRS1 Antibody, Biotin conjugated
1-CSB-PA013611LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MCRS1. Recognizes MCRS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MCRS1 Recombinant Protein (Human)
RP019027	ABM	100 ug	Ask for price

MCRS1 Recombinant Protein (Rat)
RP211175	ABM	100 ug	Ask for price

MCRS1 Recombinant Protein (Mouse)
RP149882	ABM	100 ug	Ask for price

MCRS1 Recombinant Protein (Mouse)
RP149885	ABM	100 ug	Ask for price

Microspherule Protein 1 (MCRS1) Antibody
20-abx113737	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody
abx145455-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody
20-abx006606	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody
abx029123-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody
abx029123-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody
20-abx312896	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody
20-abx216763	Abbexa	EUR 425.00 EUR 342.00	0 1
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody
abx235066-100ug	Abbexa	100 ug	EUR 481.00
Shipped within 5-12 working days.

Microspherule Protein 1 (MCRS1) Antibody
abx235067-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

MCRS1 ORF Vector (Human) (pORF)
ORF006343	ABM	1.0 ug DNA	EUR 95.00

Mcrs1 ORF Vector (Mouse) (pORF)
ORF049962	ABM	1.0 ug DNA	EUR 506.00

Mcrs1 ORF Vector (Mouse) (pORF)
ORF049963	ABM	1.0 ug DNA	EUR 506.00

Mcrs1 ORF Vector (Rat) (pORF)
ORF070393	ABM	1.0 ug DNA	EUR 506.00

MCRS1 ELISA Kit (Human) (OKEI00141)
OKEI00141	Aviva Systems Biology	96 Wells	EUR 767.00
Description: Description of target: Modulates the transcription repressor activity of DAXX by recruiting it to the nucleolus . As part of the NSL complex it may be involved in acetylation of nucleosomal histone H4 on several lysine residues . Putative regulatory component of the chromatin remodeling INO80 complex which is involved in transcriptional regulation, DNA replication and probably DNA repair. May also be an inhibitor of TERT telomerase activity . Binds to G-quadruplex structures in mRNA . Binds to RNA homopolymer poly(G) and poly(U) .;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

Microspherule Protein 1 (MCRS1) Antibody (HRP)
20-abx312897	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody (FITC)
20-abx312898	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Microspherule Protein 1 (MCRS1) Antibody (Biotin)
20-abx312899	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

MCRS1 sgRNA CRISPR Lentivector set (Human)
K1282001	ABM	3 x 1.0 ug	EUR 339.00

Mcrs1 sgRNA CRISPR Lentivector set (Mouse)
K4740201	ABM	3 x 1.0 ug	EUR 339.00

Mcrs1 sgRNA CRISPR Lentivector set (Rat)
K7154301	ABM	3 x 1.0 ug	EUR 339.00

Pig Microspherule Protein 1 (MCRS1) ELISA Kit
abx360957-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Rabbit Microspherule Protein 1 (MCRS1) ELISA Kit
abx362960-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Mouse Microspherule protein 1, Mcrs1 ELISA KIT
ELI-22750m	Lifescience Market	96 Tests	EUR 865.00

Human Microspherule protein 1, MCRS1 ELISA KIT
ELI-08448h	Lifescience Market	96 Tests	EUR 824.00

Human Microspherule Protein 1 (MCRS1) ELISA Kit
abx354423-96tests	Abbexa	96 tests	EUR 707.00
Shipped within 5-12 working days.

Chicken Microspherule Protein 1 (MCRS1) ELISA Kit
abx356065-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Monkey Microspherule Protein 1 (MCRS1) ELISA Kit
abx359226-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Mouse Microspherule Protein 1 (MCRS1) ELISA Kit
abx389887-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

MCRS1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1282002	ABM	1.0 ug DNA	EUR 154.00

MCRS1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1282003	ABM	1.0 ug DNA	EUR 154.00

MCRS1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1282004	ABM	1.0 ug DNA	EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4740202	ABM	1.0 ug DNA	EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4740203	ABM	1.0 ug DNA	EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4740204	ABM	1.0 ug DNA	EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7154302	ABM	1.0 ug DNA	EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7154303	ABM	1.0 ug DNA	EUR 154.00

Mcrs1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7154304	ABM	1.0 ug DNA	EUR 154.00

Human Microspherule Protein 1(MCRS1)ELISA Kit
QY-E01082	Qayee Biotechnology	96T	EUR 361.00

MCRS1 Protein Vector (Rat) (pPB-C-His)
PV281570	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Rat) (pPB-N-His)
PV281571	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Rat) (pPM-C-HA)
PV281572	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Rat) (pPM-C-His)
PV281573	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Human) (pPB-C-His)
PV025369	ABM	500 ng	EUR 329.00

MCRS1 Protein Vector (Human) (pPB-N-His)
PV025370	ABM	500 ng	EUR 329.00

MCRS1 Protein Vector (Human) (pPM-C-HA)
PV025371	ABM	500 ng	EUR 329.00

MCRS1 Protein Vector (Human) (pPM-C-His)
PV025372	ABM	500 ng	EUR 329.00

MCRS1 Protein Vector (Mouse) (pPB-C-His)
PV199846	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Mouse) (pPB-N-His)
PV199847	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Mouse) (pPM-C-HA)
PV199848	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Mouse) (pPM-C-His)
PV199849	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Mouse) (pPB-C-His)
PV199850	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Mouse) (pPB-N-His)
PV199851	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Mouse) (pPM-C-HA)
PV199852	ABM	500 ng	EUR 603.00

MCRS1 Protein Vector (Mouse) (pPM-C-His)
PV199853	ABM	500 ng	EUR 603.00

Mcrs1 3'UTR GFP Stable Cell Line
TU163014	ABM	1.0 ml	Ask for price

Mcrs1 3'UTR Luciferase Stable Cell Line
TU212986	ABM	1.0 ml	Ask for price

MCRS1 3'UTR Luciferase Stable Cell Line
TU013140	ABM	1.0 ml	EUR 1394.00

Mcrs1 3'UTR Luciferase Stable Cell Line
TU113014	ABM	1.0 ml	Ask for price

MCRS1 3'UTR GFP Stable Cell Line
TU063140	ABM	1.0 ml	EUR 1394.00

Mcrs1 3'UTR GFP Stable Cell Line
TU262986	ABM	1.0 ml	Ask for price

Guinea pig Microspherule Protein 1 (MCRS1) ELISA Kit
abx357231-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

ELISA kit for Human MCRS1 (Microspherule Protein 1)
E-EL-H0541	Elabscience Biotech	1 plate of 96 wells	EUR 534.00
Gentaur's MCRS1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MCRS1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MCRS1 (Microspherule Protein 1) in samples from Serum, Plasma, Cell supernatant

MCRS1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV627565	ABM	1.0 ug DNA	EUR 682.00

MCRS1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV627569	ABM	1.0 ug DNA	EUR 682.00