NEGR1 antibody

22049-100ul 100ul
EUR 390

NEGR1 antibody

70R-13066 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal NEGR1 antibody

NEGR1 Antibody

1-CSB-PA003394
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NEGR1 Antibody

DF4240 200ul
EUR 304
Description: NEGR1 Antibody detects endogenous levels of total NEGR1.

NEGR1 Antibody

1-CSB-PA015692LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NEGR1 antibody

70R-9341 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal NEGR1 antibody

NEGR1 siRNA

20-abx903525
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEGR1 siRNA

20-abx925700
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEGR1 siRNA

20-abx925701
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEGR1 Antibody

ABD4240 100 ug
EUR 438

anti-NEGR1

YF-PA27010 50 ul
EUR 334
Description: Mouse polyclonal to NEGR1

NEGR1 Blocking Peptide

33R-9974 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEGR1 antibody, catalog no. 70R-9341

NEGR1 Blocking Peptide

DF4240-BP 1mg
EUR 195

NEGR1 cloning plasmid

CSB-CL015692HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 681
  • Sequence: atgcaggtgcatctaactgtgcaagttcctcctaagatatatgacatctcaaatgatatgaccgtcaatgaaggaaccaacgtcactcttacttgtttggccactgggaaaccagagccttccatttcttggcgacacatctccccatcagcaaaaccatttgaaaatggacaata
  • Show more
Description: A cloning plasmid for the NEGR1 gene.

NEGR1 Polyclonal Antibody

ABP51916-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody

ABP51916-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody

ABP51916-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody

A60010 100 µg
EUR 570.55
Description: reagents widely cited

NEGR1 Polyclonal Antibody

ES2915-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NEGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEGR1 Polyclonal Antibody

ES2915-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NEGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-NEGR1 antibody

STJ94394 200 µl
EUR 197
Description: Rabbit polyclonal to NEGR1.

Anti-NEGR1 (2A8)

YF-MA20073 100 ug
EUR 363
Description: Mouse monoclonal to NEGR1

Anti-NEGR1/Kilon Antibody

A06730 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for NEGR1 Antibody (NEGR1) detection. Tested with WB in Human, Mouse, Rat.

NEGR1 Antibody, HRP conjugated

1-CSB-PA015692LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NEGR1 Antibody, FITC conjugated

1-CSB-PA015692LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NEGR1 Antibody, Biotin conjugated

1-CSB-PA015692LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NEGR1 ELISA KIT|Human

EF005342 96 Tests
EUR 689

Human NEGR1 shRNA Plasmid

20-abx966784
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat NEGR1 shRNA Plasmid

20-abx985997
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal NEGR1 Antibody (Center)

AMM06609G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEGR1 (Center). This antibody is tested and proven to work in the following applications:

Mouse NEGR1 shRNA Plasmid

20-abx983461
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NEGR1 Recombinant Protein (Human)

RP021049 100 ug Ask for price

NEGR1 Recombinant Protein (Mouse)

RP153623 100 ug Ask for price

NEGR1 Recombinant Protein (Mouse)

RP153626 100 ug Ask for price

NEGR1 Recombinant Protein (Rat)

RP213647 100 ug Ask for price

NEGR1 Polyclonal Antibody, Biotin Conjugated

A60011 100 µg
EUR 570.55
Description: Ask the seller for details

NEGR1 Polyclonal Antibody, FITC Conjugated

A60012 100 µg
EUR 570.55
Description: The best epigenetics products

NEGR1 Polyclonal Antibody, HRP Conjugated

A60013 100 µg
EUR 570.55
Description: kits suitable for this type of research

Negr1 ORF Vector (Rat) (pORF)

ORF071217 1.0 ug DNA
EUR 506

NEGR1 ORF Vector (Human) (pORF)

ORF007017 1.0 ug DNA
EUR 95

Negr1 ORF Vector (Mouse) (pORF)

ORF051209 1.0 ug DNA
EUR 506

Negr1 ORF Vector (Mouse) (pORF)

ORF051210 1.0 ug DNA
EUR 506

NEGR1 ELISA Kit (Human) (OKCA01389)

OKCA01389 96 Wells
EUR 846
Description: Description of target: May be involved in cell-adhesion. May function as a trans-neural growth-promoting factor in regenerative axon sprouting in the mammalian brain.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 4.69 pg/mL

NEGR1 ELISA Kit (Mouse) (OKCA01729)

OKCA01729 96 Wells
EUR 846
Description: Description of target: May be involved in cell-adhesion. May function as a trans-neural growth-promoting factor in regenerative axon sprouting in the mammalian brain.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7 pg/mL

Neuronal Growth Regulator 1 (NEGR1) Antibody

20-abx119119
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody

abx029178-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody

abx029178-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuronal growth regulator 1 (NEGR1) Antibody

20-abx327618
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody

20-abx302641
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Negr1 sgRNA CRISPR Lentivector set (Rat)

K6782901 3 x 1.0 ug
EUR 339

Negr1 sgRNA CRISPR Lentivector set (Mouse)

K4486301 3 x 1.0 ug
EUR 339

NEGR1 sgRNA CRISPR Lentivector set (Human)

K1415801 3 x 1.0 ug
EUR 339

NEGR1-AS1 ORF Vector (Human) (pORF)

ORF026028 1.0 ug DNA Ask for price

NEGR1-IT1 ORF Vector (Human) (pORF)

ORF026029 1.0 ug DNA Ask for price

Monoclonal NEGR1 Antibody (monoclonal) (M01), Clone: 2A8

AMM06610G 0.1mg
EUR 484
Description: A Monoclonal antibody against Human NEGR1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A8. This antibody is applicable in E

Neuronal Growth Regulator 1 (NEGR1) Antibody (HRP)

20-abx304632
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody (FITC)

20-abx304633
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody (Biotin)

20-abx304634
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6782902 1.0 ug DNA
EUR 154

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6782903 1.0 ug DNA
EUR 154

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K6782904 1.0 ug DNA
EUR 154

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4486302 1.0 ug DNA
EUR 154

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4486303 1.0 ug DNA
EUR 154

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4486304 1.0 ug DNA
EUR 154

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1415802 1.0 ug DNA
EUR 154

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 2)

K1415803 1.0 ug DNA
EUR 154

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 3)

K1415804 1.0 ug DNA
EUR 154

NEGR1 Protein Vector (Mouse) (pPB-C-His)

PV204834 500 ng
EUR 603

NEGR1 Protein Vector (Mouse) (pPB-N-His)

PV204835 500 ng
EUR 603

NEGR1 Protein Vector (Mouse) (pPM-C-HA)

PV204836 500 ng
EUR 603

NEGR1 Protein Vector (Mouse) (pPM-C-His)

PV204837 500 ng
EUR 603

NEGR1 Protein Vector (Mouse) (pPB-C-His)

PV204838 500 ng
EUR 603

NEGR1 Protein Vector (Mouse) (pPB-N-His)

PV204839 500 ng
EUR 603

NEGR1 Protein Vector (Mouse) (pPM-C-HA)

PV204840 500 ng
EUR 603

NEGR1 Protein Vector (Mouse) (pPM-C-His)

PV204841 500 ng
EUR 603

NEGR1 Protein Vector (Rat) (pPB-C-His)

PV284866 500 ng
EUR 603

NEGR1 Protein Vector (Rat) (pPB-N-His)

PV284867 500 ng
EUR 603

NEGR1 Protein Vector (Rat) (pPM-C-HA)

PV284868 500 ng
EUR 603

NEGR1 Protein Vector (Rat) (pPM-C-His)

PV284869 500 ng
EUR 603

NEGR1 Protein Vector (Human) (pPB-C-His)

PV028065 500 ng
EUR 329

NEGR1 Protein Vector (Human) (pPB-N-His)

PV028066 500 ng
EUR 329

NEGR1 Protein Vector (Human) (pPM-C-HA)

PV028067 500 ng
EUR 329

NEGR1 Protein Vector (Human) (pPM-C-His)

PV028068 500 ng
EUR 329

Negr1 3'UTR Luciferase Stable Cell Line

TU113979 1.0 ml Ask for price

Negr1 3'UTR GFP Stable Cell Line

TU163979 1.0 ml Ask for price

Negr1 3'UTR Luciferase Stable Cell Line

TU213877 1.0 ml Ask for price

Negr1 3'UTR GFP Stable Cell Line

TU263877 1.0 ml Ask for price

NEGR1 3'UTR GFP Stable Cell Line

TU065561 1.0 ml
EUR 2333

NEGR1 3'UTR Luciferase Stable Cell Line

TU015561 1.0 ml
EUR 2333

Human NEGR1(Neuronal growth regulator 1) ELISA Kit

EH14985 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q7Z3B1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Neuronal growth regulator 1, Negr1 ELISA KIT

ELI-13797m 96 Tests
EUR 865

Chicken Neuronal growth regulator 1, NEGR1 ELISA KIT

ELI-23241c 96 Tests
EUR 928

Rat Neuronal growth regulator 1 (NEGR1) ELISA Kit

abx391694-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neuronal growth regulator 1 (NEGR1) ELISA Kit

abx385212-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neuronal growth regulator 1 (NEGR1) ELISA Kit

abx390026-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.