NEGR1

88  

NEGR1 siRNA
20-abx903525
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

NEGR1 siRNA
20-abx925700
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

NEGR1 siRNA
20-abx925701
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

NEGR1 antibody
70R-9341 50 ug
EUR 467.00
Description: Affinity purified rabbit polyclonal NEGR1 antibody

NEGR1 Antibody
ABD4240 100 ug
EUR 438.00

NEGR1 antibody
22049-100ul 100ul
EUR 390.00

NEGR1 antibody
70R-13066 100 ul
EUR 457.00
Description: Affinity purified Rabbit polyclonal NEGR1 antibody

NEGR1 Antibody
DF4240 200ul
EUR 304.00
Description: NEGR1 Antibody detects endogenous levels of total NEGR1.

NEGR1 Antibody
1-CSB-PA003394
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NEGR1 Antibody
1-CSB-PA015692LA01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

anti-NEGR1
YF-PA27010 50 ul
EUR 334.00
Description: Mouse polyclonal to NEGR1

NEGR1 cloning plasmid
CSB-CL015692HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 681
  • Sequence: atgcaggtgcatctaactgtgcaagttcctcctaagatatatgacatctcaaatgatatgaccgtcaatgaaggaaccaacgtcactcttacttgtttggccactgggaaaccagagccttccatttcttggcgacacatctccccatcagcaaaaccatttgaaaatggacaata
  • Show more
Description: A cloning plasmid for the NEGR1 gene.

NEGR1 Polyclonal Antibody
ES2915-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against NEGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEGR1 Polyclonal Antibody
ES2915-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against NEGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEGR1 Polyclonal Antibody
ABP51916-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody
ABP51916-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody
ABP51916-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230
  • Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody
A60010 100 µg
EUR 570.55
Description: reagents widely cited

NEGR1 Blocking Peptide
33R-9974 100 ug
EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEGR1 antibody, catalog no. 70R-9341

NEGR1 Blocking Peptide
DF4240-BP 1mg
EUR 195.00

Anti-NEGR1 antibody
STJ94394 200 µl
EUR 197.00
Description: Rabbit polyclonal to NEGR1.

Anti-NEGR1 (2A8)
YF-MA20073 100 ug
EUR 363.00
Description: Mouse monoclonal to NEGR1

Polyclonal NEGR1 Antibody (Center)
AMM06609G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEGR1 (Center). This antibody is tested and proven to work in the following applications:

Mouse NEGR1 shRNA Plasmid
20-abx983461
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Rat NEGR1 shRNA Plasmid
20-abx985997
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NEGR1 ELISA KIT|Human
EF005342 96 Tests
EUR 689.00

Anti-NEGR1/Kilon Antibody
A06730 100ul
EUR 397.00
Description: Rabbit Polyclonal Antibody for NEGR1 Antibody (NEGR1) detection. Tested with WB in Human, Mouse, Rat.

Human NEGR1 shRNA Plasmid
20-abx966784
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NEGR1 Antibody, HRP conjugated
1-CSB-PA015692LB01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NEGR1 Antibody, FITC conjugated
1-CSB-PA015692LC01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NEGR1 Antibody, Biotin conjugated
1-CSB-PA015692LD01HU
  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NEGR1 Recombinant Protein (Human)
RP021049 100 ug Ask for price

NEGR1 Recombinant Protein (Rat)
RP213647 100 ug Ask for price

NEGR1 Recombinant Protein (Mouse)
RP153623 100 ug Ask for price

NEGR1 Recombinant Protein (Mouse)
RP153626 100 ug Ask for price

NEGR1 Polyclonal Antibody, Biotin Conjugated
A60011 100 µg
EUR 570.55
Description: Ask the seller for details

NEGR1 Polyclonal Antibody, FITC Conjugated
A60012 100 µg
EUR 570.55
Description: The best epigenetics products

NEGR1 Polyclonal Antibody, HRP Conjugated
A60013 100 µg
EUR 570.55
Description: kits suitable for this type of research

NEGR1 ORF Vector (Human) (pORF)
ORF007017 1.0 ug DNA
EUR 95.00

Negr1 ORF Vector (Rat) (pORF)
ORF071217 1.0 ug DNA
EUR 506.00

Negr1 ORF Vector (Mouse) (pORF)
ORF051209 1.0 ug DNA
EUR 506.00

Negr1 ORF Vector (Mouse) (pORF)
ORF051210 1.0 ug DNA
EUR 506.00

NEGR1 ELISA Kit (Human) (OKCA01389)
OKCA01389 96 Wells
EUR 846.00
Description: Description of target: May be involved in cell-adhesion. May function as a trans-neural growth-promoting factor in regenerative axon sprouting in the mammalian brain.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 4.69 pg/mL

NEGR1 ELISA Kit (Mouse) (OKCA01729)
OKCA01729 96 Wells
EUR 846.00
Description: Description of target: May be involved in cell-adhesion. May function as a trans-neural growth-promoting factor in regenerative axon sprouting in the mammalian brain.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7 pg/mL

Neuronal Growth Regulator 1 (NEGR1) Antibody
20-abx119119
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody
abx029178-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody
abx029178-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Neuronal growth regulator 1 (NEGR1) Antibody
20-abx327618
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody
20-abx302641
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

NEGR1 sgRNA CRISPR Lentivector set (Human)
K1415801 3 x 1.0 ug
EUR 339.00

Negr1 sgRNA CRISPR Lentivector set (Mouse)
K4486301 3 x 1.0 ug
EUR 339.00

Negr1 sgRNA CRISPR Lentivector set (Rat)
K6782901 3 x 1.0 ug
EUR 339.00

NEGR1-AS1 ORF Vector (Human) (pORF)
ORF026028 1.0 ug DNA Ask for price

NEGR1-IT1 ORF Vector (Human) (pORF)
ORF026029 1.0 ug DNA Ask for price

Monoclonal NEGR1 Antibody (monoclonal) (M01), Clone: 2A8
AMM06610G 0.1mg
EUR 484.00
Description: A Monoclonal antibody against Human NEGR1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A8. This antibody is applicable in E

Neuronal Growth Regulator 1 (NEGR1) Antibody (HRP)
20-abx304632
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody (FITC)
20-abx304633
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody (Biotin)
20-abx304634
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1415802 1.0 ug DNA
EUR 154.00

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1415803 1.0 ug DNA
EUR 154.00

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1415804 1.0 ug DNA
EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4486302 1.0 ug DNA
EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4486303 1.0 ug DNA
EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4486304 1.0 ug DNA
EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6782902 1.0 ug DNA
EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6782903 1.0 ug DNA
EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6782904 1.0 ug DNA
EUR 154.00

NEGR1 Protein Vector (Rat) (pPB-C-His)
PV284866 500 ng
EUR 603.00

NEGR1 Protein Vector (Rat) (pPB-N-His)
PV284867 500 ng
EUR 603.00

NEGR1 Protein Vector (Rat) (pPM-C-HA)
PV284868 500 ng
EUR 603.00

NEGR1 Protein Vector (Rat) (pPM-C-His)
PV284869 500 ng
EUR 603.00

NEGR1 Protein Vector (Human) (pPB-C-His)
PV028065 500 ng
EUR 329.00

NEGR1 Protein Vector (Human) (pPB-N-His)
PV028066 500 ng
EUR 329.00

NEGR1 Protein Vector (Human) (pPM-C-HA)
PV028067 500 ng
EUR 329.00

NEGR1 Protein Vector (Human) (pPM-C-His)
PV028068 500 ng
EUR 329.00

NEGR1 Protein Vector (Mouse) (pPB-C-His)
PV204834 500 ng
EUR 603.00

NEGR1 Protein Vector (Mouse) (pPB-N-His)
PV204835 500 ng
EUR 603.00

NEGR1 Protein Vector (Mouse) (pPM-C-HA)
PV204836 500 ng
EUR 603.00

NEGR1 Protein Vector (Mouse) (pPM-C-His)
PV204837 500 ng
EUR 603.00

NEGR1 Protein Vector (Mouse) (pPB-C-His)
PV204838 500 ng
EUR 603.00

NEGR1 Protein Vector (Mouse) (pPB-N-His)
PV204839 500 ng
EUR 603.00

NEGR1 Protein Vector (Mouse) (pPM-C-HA)
PV204840 500 ng
EUR 603.00

NEGR1 Protein Vector (Mouse) (pPM-C-His)
PV204841 500 ng
EUR 603.00

Negr1 3'UTR GFP Stable Cell Line
TU163979 1.0 ml Ask for price

Negr1 3'UTR Luciferase Stable Cell Line
TU213877 1.0 ml Ask for price

NEGR1 3'UTR Luciferase Stable Cell Line
TU015561 1.0 ml
EUR 2333.00

Negr1 3'UTR Luciferase Stable Cell Line
TU113979 1.0 ml Ask for price

NEGR1 3'UTR GFP Stable Cell Line
TU065561 1.0 ml
EUR 2333.00

Negr1 3'UTR GFP Stable Cell Line
TU263877 1.0 ml Ask for price

Human NEGR1(Neuronal growth regulator 1) ELISA Kit
EH14985 96T
EUR 567.60
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q7Z3B1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Neuronal growth regulator 1, Negr1 ELISA KIT
ELI-13797m 96 Tests
EUR 865.00

Chicken Neuronal growth regulator 1, NEGR1 ELISA KIT
ELI-23241c 96 Tests
EUR 928.00

Human Neuronal growth regulator 1, NEGR1 ELISA KIT
ELI-36497h 96 Tests
EUR 824.00

Human Neuronal growth regulator 1 (NEGR1) ELISA Kit
abx385212-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.

Mouse Neuronal growth regulator 1 (NEGR1) ELISA Kit
abx390026-96tests 96 tests
EUR 911.00
  • Shipped within 5-12 working days.