NEGR1

NEGR1 siRNA
20-abx903525	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

NEGR1 siRNA
20-abx925700	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

NEGR1 siRNA
20-abx925701	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

NEGR1 antibody
70R-9341	Fitzgerald	50 ug	EUR 467.00
Description: Affinity purified rabbit polyclonal NEGR1 antibody

NEGR1 Antibody
ABD4240	Lifescience Market	100 ug	EUR 438.00

NEGR1 antibody
22049-100ul	SAB	100ul	EUR 390.00

NEGR1 antibody
70R-13066	Fitzgerald	100 ul	EUR 457.00
Description: Affinity purified Rabbit polyclonal NEGR1 antibody

NEGR1 Antibody
DF4240	Affbiotech	200ul	EUR 304.00
Description: NEGR1 Antibody detects endogenous levels of total NEGR1.

NEGR1 Antibody
1-CSB-PA003394	Cusabio	EUR 222.00 EUR 195.00	0 1
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

NEGR1 Antibody
1-CSB-PA015692LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

anti-NEGR1
YF-PA27010	Abfrontier	50 ul	EUR 334.00
Description: Mouse polyclonal to NEGR1

NEGR1 cloning plasmid
CSB-CL015692HU-10ug	Cusabio	10ug	EUR 233.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 681 Sequence: atgcaggtgcatctaactgtgcaagttcctcctaagatatatgacatctcaaatgatatgaccgtcaatgaaggaaccaacgtcactcttacttgtttggccactgggaaaccagagccttccatttcttggcgacacatctccccatcagcaaaaccatttgaaaatggacaata Show more
Description: A cloning plasmid for the NEGR1 gene.

NEGR1 Polyclonal Antibody
ES2915-100ul	ELK Biotech	100ul	EUR 279.00
Description: A Rabbit Polyclonal antibody against NEGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEGR1 Polyclonal Antibody
ES2915-50ul	ELK Biotech	50ul	EUR 207.00
Description: A Rabbit Polyclonal antibody against NEGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NEGR1 Polyclonal Antibody
ABP51916-003ml	Abbkine	0.03ml	EUR 158.00
Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230 Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody
ABP51916-01ml	Abbkine	0.1ml	EUR 289.00
Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230 Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody
ABP51916-02ml	Abbkine	0.2ml	EUR 414.00
Immunogen information: Synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230 Applications tips:
Description: A polyclonal antibody for detection of NEGR1 from Human, Mouse, Rat. This NEGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human NEGR1 at AA range: 150-230

NEGR1 Polyclonal Antibody
A60010	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NEGR1 Blocking Peptide
33R-9974	Fitzgerald	100 ug	EUR 180.00
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NEGR1 antibody, catalog no. 70R-9341

NEGR1 Blocking Peptide
DF4240-BP	Affbiotech	1mg	EUR 195.00

Anti-NEGR1 antibody
STJ94394	St John's Laboratory	200 µl	EUR 197.00
Description: Rabbit polyclonal to NEGR1.

Anti-NEGR1 (2A8)
YF-MA20073	Abfrontier	100 ug	EUR 363.00
Description: Mouse monoclonal to NEGR1

Polyclonal NEGR1 Antibody (Center)
AMM06609G	Leading Biology	0.1ml	EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NEGR1 (Center). This antibody is tested and proven to work in the following applications:

Mouse NEGR1 shRNA Plasmid
20-abx983461	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Rat NEGR1 shRNA Plasmid
20-abx985997	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

NEGR1 ELISA KIT|Human
EF005342	Lifescience Market	96 Tests	EUR 689.00

Anti-NEGR1/Kilon Antibody
A06730	BosterBio	100ul	EUR 397.00
Description: Rabbit Polyclonal Antibody for NEGR1 Antibody (NEGR1) detection. Tested with WB in Human, Mouse, Rat.

Human NEGR1 shRNA Plasmid
20-abx966784	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

NEGR1 Antibody, HRP conjugated
1-CSB-PA015692LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NEGR1 Antibody, FITC conjugated
1-CSB-PA015692LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NEGR1 Antibody, Biotin conjugated
1-CSB-PA015692LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NEGR1. Recognizes NEGR1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NEGR1 Recombinant Protein (Human)
RP021049	ABM	100 ug	Ask for price

NEGR1 Recombinant Protein (Rat)
RP213647	ABM	100 ug	Ask for price

NEGR1 Recombinant Protein (Mouse)
RP153623	ABM	100 ug	Ask for price

NEGR1 Recombinant Protein (Mouse)
RP153626	ABM	100 ug	Ask for price

NEGR1 Polyclonal Antibody, Biotin Conjugated
A60011	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

NEGR1 Polyclonal Antibody, FITC Conjugated
A60012	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NEGR1 Polyclonal Antibody, HRP Conjugated
A60013	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NEGR1 ORF Vector (Human) (pORF)
ORF007017	ABM	1.0 ug DNA	EUR 95.00

Negr1 ORF Vector (Rat) (pORF)
ORF071217	ABM	1.0 ug DNA	EUR 506.00

Negr1 ORF Vector (Mouse) (pORF)
ORF051209	ABM	1.0 ug DNA	EUR 506.00

Negr1 ORF Vector (Mouse) (pORF)
ORF051210	ABM	1.0 ug DNA	EUR 506.00

NEGR1 ELISA Kit (Human) (OKCA01389)
OKCA01389	Aviva Systems Biology	96 Wells	EUR 846.00
Description: Description of target: May be involved in cell-adhesion. May function as a trans-neural growth-promoting factor in regenerative axon sprouting in the mammalian brain.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 4.69 pg/mL

NEGR1 ELISA Kit (Mouse) (OKCA01729)
OKCA01729	Aviva Systems Biology	96 Wells	EUR 846.00
Description: Description of target: May be involved in cell-adhesion. May function as a trans-neural growth-promoting factor in regenerative axon sprouting in the mammalian brain.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7 pg/mL

Neuronal Growth Regulator 1 (NEGR1) Antibody
20-abx119119	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	0 1 2 3
Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody
abx029178-400ul	Abbexa	400 ul	EUR 523.00
Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody
abx029178-80l	Abbexa	80 µl	EUR 286.00
Shipped within 5-10 working days.

Neuronal growth regulator 1 (NEGR1) Antibody
20-abx327618	Abbexa	EUR 314.00 EUR 244.00	0 1
Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody
20-abx302641	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

NEGR1 sgRNA CRISPR Lentivector set (Human)
K1415801	ABM	3 x 1.0 ug	EUR 339.00

Negr1 sgRNA CRISPR Lentivector set (Mouse)
K4486301	ABM	3 x 1.0 ug	EUR 339.00

Negr1 sgRNA CRISPR Lentivector set (Rat)
K6782901	ABM	3 x 1.0 ug	EUR 339.00

NEGR1-AS1 ORF Vector (Human) (pORF)
ORF026028	ABM	1.0 ug DNA	Ask for price

NEGR1-IT1 ORF Vector (Human) (pORF)
ORF026029	ABM	1.0 ug DNA	Ask for price

Monoclonal NEGR1 Antibody (monoclonal) (M01), Clone: 2A8
AMM06610G	Leading Biology	0.1mg	EUR 484.00
Description: A Monoclonal antibody against Human NEGR1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 2A8. This antibody is applicable in E

Neuronal Growth Regulator 1 (NEGR1) Antibody (HRP)
20-abx304632	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody (FITC)
20-abx304633	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Neuronal Growth Regulator 1 (NEGR1) Antibody (Biotin)
20-abx304634	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1415802	ABM	1.0 ug DNA	EUR 154.00

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1415803	ABM	1.0 ug DNA	EUR 154.00

NEGR1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1415804	ABM	1.0 ug DNA	EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4486302	ABM	1.0 ug DNA	EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4486303	ABM	1.0 ug DNA	EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4486304	ABM	1.0 ug DNA	EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6782902	ABM	1.0 ug DNA	EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6782903	ABM	1.0 ug DNA	EUR 154.00

Negr1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6782904	ABM	1.0 ug DNA	EUR 154.00

NEGR1 Protein Vector (Rat) (pPB-C-His)
PV284866	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Rat) (pPB-N-His)
PV284867	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Rat) (pPM-C-HA)
PV284868	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Rat) (pPM-C-His)
PV284869	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Human) (pPB-C-His)
PV028065	ABM	500 ng	EUR 329.00

NEGR1 Protein Vector (Human) (pPB-N-His)
PV028066	ABM	500 ng	EUR 329.00

NEGR1 Protein Vector (Human) (pPM-C-HA)
PV028067	ABM	500 ng	EUR 329.00

NEGR1 Protein Vector (Human) (pPM-C-His)
PV028068	ABM	500 ng	EUR 329.00

NEGR1 Protein Vector (Mouse) (pPB-C-His)
PV204834	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Mouse) (pPB-N-His)
PV204835	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Mouse) (pPM-C-HA)
PV204836	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Mouse) (pPM-C-His)
PV204837	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Mouse) (pPB-C-His)
PV204838	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Mouse) (pPB-N-His)
PV204839	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Mouse) (pPM-C-HA)
PV204840	ABM	500 ng	EUR 603.00

NEGR1 Protein Vector (Mouse) (pPM-C-His)
PV204841	ABM	500 ng	EUR 603.00

Negr1 3'UTR GFP Stable Cell Line
TU163979	ABM	1.0 ml	Ask for price

Negr1 3'UTR Luciferase Stable Cell Line
TU213877	ABM	1.0 ml	Ask for price

NEGR1 3'UTR Luciferase Stable Cell Line
TU015561	ABM	1.0 ml	EUR 2333.00

Negr1 3'UTR Luciferase Stable Cell Line
TU113979	ABM	1.0 ml	Ask for price

NEGR1 3'UTR GFP Stable Cell Line
TU065561	ABM	1.0 ml	EUR 2333.00

Negr1 3'UTR GFP Stable Cell Line
TU263877	ABM	1.0 ml	Ask for price

Human NEGR1(Neuronal growth regulator 1) ELISA Kit
EH14985	FN Test	96T	EUR 567.60
Detection range: 0.156-10 ng/ml Uniprot ID: Q7Z3B1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Neuronal growth regulator 1, Negr1 ELISA KIT
ELI-13797m	Lifescience Market	96 Tests	EUR 865.00

Chicken Neuronal growth regulator 1, NEGR1 ELISA KIT
ELI-23241c	Lifescience Market	96 Tests	EUR 928.00

Human Neuronal growth regulator 1, NEGR1 ELISA KIT
ELI-36497h	Lifescience Market	96 Tests	EUR 824.00

Human Neuronal growth regulator 1 (NEGR1) ELISA Kit
abx385212-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.

Mouse Neuronal growth regulator 1 (NEGR1) ELISA Kit
abx390026-96tests	Abbexa	96 tests	EUR 911.00
Shipped within 5-12 working days.