NUP85 antibody

70R-19007 50 ul
EUR 435
Description: Rabbit polyclonal NUP85 antibody

NUP85 Antibody

36685-100ul 100ul
EUR 252

NUP85 Antibody

1-CSB-PA051469
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

NUP85 Antibody

1-CSB-PA874821LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NUP85 Antibody

1-CSB-PA016206GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

NUP85 siRNA

20-abx903710
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP85 siRNA

20-abx926645
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NUP85 siRNA

20-abx926646
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-NUP85

PVT18935 2 ug
EUR 231

NUP85 Rabbit pAb

A11629-100ul 100 ul
EUR 308

NUP85 Rabbit pAb

A11629-200ul 200 ul
EUR 459

NUP85 Rabbit pAb

A11629-20ul 20 ul
EUR 183

NUP85 Rabbit pAb

A11629-50ul 50 ul
EUR 223

NUP85 Conjugated Antibody

C36685 100ul
EUR 397

NUP85 cloning plasmid

CSB-CL874821HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1971
  • Sequence: atggaggagctcgatggcgagccaacagtcactttgattccaggcgtgaattccaagaagaaccaaatgtattttgactggggtccaggggagatgctggtatgtgaaacctccttcaacaaaaaagaaaaatcagagatggtgccaagttgcccctttatctatatcatccgta
  • Show more
Description: A cloning plasmid for the NUP85 gene.

NUP85 Polyclonal Antibody

A67538 100 µg
EUR 570.55
Description: The best epigenetics products

NUP85 Rabbit pAb

A3504-100ul 100 ul
EUR 384

NUP85 Rabbit pAb

A3504-200ul 200 ul Ask for price

NUP85 Rabbit pAb

A3504-20ul 20 ul Ask for price

NUP85 Rabbit pAb

A3504-50ul 50 ul
EUR 265

anti- NUP85 antibody

FNab05929 100µg
EUR 548.75
  • Immunogen: nucleoporin 85kDa
  • Uniprot ID: Q9BW27
  • Gene ID: 79902
  • Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP85

Anti-NUP85 antibody

PAab05929 100 ug
EUR 386

Anti-NUP85 antibody

STJ24851 100 µl
EUR 393
Description: This gene encodes a protein component of the Nup107-160 subunit of the nuclear pore complex. Nuclear pore complexes are embedded in the nuclear envelope and promote bidirectional transport of macromolecules between the cytoplasm and nucleus. The encoded protein can also bind to the C-terminus of chemokine (C-C motif) receptor 2 (CCR2) and promote chemotaxis of monocytes, thereby participating in the inflammatory response. Alternative splicing results in multiple transcript variants.

Anti-NUP85 antibody

STJ113234 100 µl
EUR 277
Description: This gene encodes a protein component of the Nup107-160 subunit of the nuclear pore complex. Nuclear pore complexes are embedded in the nuclear envelope and promote bidirectional transport of macromolecules between the cytoplasm and nucleus. The encoded protein can also bind to the C-terminus of chemokine (C-C motif) receptor 2 (CCR2) and promote chemotaxis of monocytes, thereby participating in the inflammatory response. Alternative splicing results in multiple transcript variants.

Bovine Nuclear pore complex protein Nup85, NUP85 ELISA KIT

ELI-23491b 96 Tests
EUR 928

Mouse Nuclear pore complex protein Nup85, Nup85 ELISA KIT

ELI-23492m 96 Tests
EUR 865

Human Nuclear pore complex protein Nup85, NUP85 ELISA KIT

ELI-36779h 96 Tests
EUR 824

NUP85 Antibody, HRP conjugated

1-CSB-PA874821LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP85 Antibody, FITC conjugated

1-CSB-PA874821LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP85 Antibody, Biotin conjugated

1-CSB-PA874821LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Nucleoporin 85 (NUP85) Antibody

20-abx126286
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody

abx122131-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Human NUP85 ELISA Kit

EHN0067 96Tests
EUR 521

Bovine NUP85 ELISA Kit

EBN0067 96Tests
EUR 521

Anserine NUP85 ELISA Kit

EAN0067 96Tests
EUR 521

Canine NUP85 ELISA Kit

ECN0067 96Tests
EUR 521

Goat NUP85 ELISA Kit

EGTN0067 96Tests
EUR 521

NUP85 ELISA KIT|Human

EF001393 96 Tests
EUR 689

Rat NUP85 shRNA Plasmid

20-abx988280
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Nucleoporin 85 (NUP85) Antibody

abx411835-01mg 0.1 mg
EUR 704
  • Shipped within 1 week.

Nucleoporin 85 (NUP85) Antibody

abx235929-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Nucleoporin 85 (NUP85) Antibody

20-abx317993
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse NUP85 shRNA Plasmid

20-abx984082
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NUP85 shRNA Plasmid

20-abx962654
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Nucleoporin 85 (NUP85) Antibody

20-abx002523
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Porcine NUP85 ELISA Kit

EPN0067 96Tests
EUR 521

Rat NUP85 ELISA Kit

ERN0067 96Tests
EUR 521

Rabbit NUP85 ELISA Kit

ERTN0067 96Tests
EUR 521

Mouse NUP85 ELISA Kit

EMN0067 96Tests
EUR 521

Recombinant Nucleoporin 85kDa (NUP85)

4-RPB110Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BW27
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.9kDa
  • Isoelectric Point: 5.3
Description: Recombinant Human Nucleoporin 85kDa expressed in: E.coli

Recombinant porin 85kDa (NUP85)

4-RPB110Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8R480
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 30.8kDa
  • Isoelectric Point: 6.8
Description: Recombinant Mouse Nucleoporin 85kDa expressed in: E.coli

NUP85 Recombinant Protein (Human)

RP021940 100 ug Ask for price

NUP85 Recombinant Protein (Mouse)

RP155516 100 ug Ask for price

NUP85 Recombinant Protein (Rat)

RP214871 100 ug Ask for price

Nucleoporin 85 kDa (NUP85) Antibody

20-abx114231
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nucleoporin 85 kDa (NUP85) Antibody

20-abx128760
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nucleoporin 85 kDa (NUP85) Antibody

20-abx129741
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nucleoporin 85 kDa (NUP85) Antibody

20-abx242299
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Guinea Pig NUP85 ELISA Kit

EGN0067 96Tests
EUR 521

Nucleoporin 85 (NUP85) Antibody (HRP)

20-abx311310
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody (FITC)

20-abx311311
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody (Biotin)

20-abx311312
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NUP85 Polyclonal Antibody, HRP Conjugated

A67539 100 µg
EUR 570.55
Description: kits suitable for this type of research

NUP85 Polyclonal Antibody, FITC Conjugated

A67540 100 µg
EUR 570.55
Description: fast delivery possible

NUP85 Polyclonal Antibody, Biotin Conjugated

A67541 100 µg
EUR 570.55
Description: reagents widely cited

Nup85 ORF Vector (Rat) (pORF)

ORF071625 1.0 ug DNA
EUR 506

NUP85 ORF Vector (Human) (pORF)

ORF007314 1.0 ug DNA
EUR 95

Nup85 ORF Vector (Mouse) (pORF)

ORF051840 1.0 ug DNA
EUR 506

Anti-Pericentrin 1 / NUP85 antibody

STJ70477 100 µg
EUR 359

NUP85 ELISA Kit (Human) (OKEI00224)

OKEI00224 96 Wells
EUR 767
Description: Description of target: Essential component of the nuclear pore complex (NPC) that seems to be required for NPC assembly and maintenance. As part of the NPC Nup107-160 subcomplex plays a role in RNA export and in tethering NUP98/Nup98 and NUP153 to the nucleus. The Nup107-160 complex seems to be required for spindle assembly during mitosis. NUP85 is required for membrane clustering of CCL2-activated CCR2. Seems to be involved in CCR2-mediated chemotaxis of monocytes and may link activated CCR2 to the phosphatidyl-inositol 3-kinase-Rac-lammellipodium protrusion cascade.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

NUP85 ELISA Kit (Mouse) (OKEI00488)

OKEI00488 96 Wells
EUR 767
Description: Description of target: Essential component of the nuclear pore complex (NPC) that seems to be required for NPC assembly and maintenance. As part of the NPC Nup107-160 subcomplex plays a role in RNA export and in tethering NUP98/Nup98 and NUP153 to the nucleus. The Nup107-160 complex seems to be required for spindle assembly during mitosis. NUP85 is required for membrane clustering of CCL2-activated CCR2. Seems to be involved in CCR2-mediated chemotaxis of monocytes and may link activated CCR2 to the phosphatidyl-inositol 3-kinase-Rac-lammellipodium protrusion cascade. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

NUP85 ELISA Kit (Rat) (OKEI00803)

OKEI00803 96 Wells
EUR 767
Description: Description of target: Essential component of the nuclear pore complex (NPC) that seems to be required for NPC assembly and maintenance. As part of the NPC Nup107-160 subcomplex plays a role in RNA export and in tethering NUP98/Nup98 and NUP153 to the nucleus. The Nup107-160 complex seems to be required for spindle assembly during mitosis. NUP85 is required for membrane clustering of CCL2-activated CCR2. Seems to be involved in CCR2-mediated chemotaxis of monocytes and may link activated CCR2 to the phosphatidyl-inositol 3-kinase-Rac-lammellipodium protrusion cascade.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Mouse porin 85 kDa (NUP85) Protein

20-abx167410
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Nucleoporin 85 kDa (NUP85) Protein

20-abx168228
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nup85 sgRNA CRISPR Lentivector set (Mouse)

K4800601 3 x 1.0 ug
EUR 339

Nup85 sgRNA CRISPR Lentivector set (Rat)

K6302501 3 x 1.0 ug
EUR 339

NUP85 sgRNA CRISPR Lentivector set (Human)

K1468401 3 x 1.0 ug
EUR 339

Nucleoporin 85kDa (NUP85) Polyclonal Antibody (Human)

4-PAB110Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP85 (Arg130~Leu368)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 85kDa (NUP85)

Nucleoporin 85kDa (NUP85) Polyclonal Antibody (Mouse)

4-PAB110Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NUP85 (Gln418~Leu653)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nucleoporin 85kDa (NUP85)

Human Nucleoporin 85kDa(NUP85)ELISA Kit

QY-E05183 96T
EUR 361

ELISA kit for Human NUP85 (Nucleoporin 85kDa)

E-EL-H1376 1 plate of 96 wells
EUR 534
  • Gentaur's NUP85 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NUP85. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human NUP85 (Nucleoporin 85kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Mouse NUP85 (Nucleoporin 85kDa)

E-EL-M0844 1 plate of 96 wells
EUR 534
  • Gentaur's NUP85 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse NUP85. Standards or samples are added to the micro ELISA plate wells and combined with
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse NUP85 (Nucleoporin 85kDa) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat NUP85 (Nucleoporin 85kDa)

E-EL-R0686 1 plate of 96 wells
EUR 534
  • Gentaur's NUP85 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat NUP85. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat NUP85 (Nucleoporin 85kDa) in samples from Serum, Plasma, Cell supernatant

Monkey Nucleoporin 85 kDa (NUP85) ELISA Kit

abx359279-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Nucleoporin 85 kDa (NUP85) ELISA Kit

abx361116-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Nucleoporin 85 kDa (NUP85) ELISA Kit

abx362744-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Mouse Nucleoporin 85 kDa (NUP85) ELISA Kit

abx352905-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Nucleoporin 85 kDa (NUP85) ELISA Kit

abx353813-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Human Nucleoporin 85 kDa (NUP85) ELISA Kit

abx354448-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Chicken Nucleoporin 85 kDa (NUP85) ELISA Kit

abx356318-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Nup85 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4800602 1.0 ug DNA
EUR 154

Nup85 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4800603 1.0 ug DNA
EUR 154

Nup85 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4800604 1.0 ug DNA
EUR 154

Nup85 sgRNA CRISPR Lentivector (Rat) (Target 1)

K6302502 1.0 ug DNA
EUR 154

Nup85 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6302503 1.0 ug DNA
EUR 154