NUP85 siRNA
20-abx903710	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

NUP85 siRNA
20-abx926645	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

NUP85 siRNA
20-abx926646	Abbexa	EUR 551.00 EUR 732.00	0 1
Shipped within 5-10 working days.

NUP85 Antibody
36685-100ul	SAB	100ul	EUR 252.00

NUP85 antibody
70R-19007	Fitzgerald	50 ul	EUR 435.00
Description: Rabbit polyclonal NUP85 antibody

NUP85 Antibody
1-CSB-PA874821LA01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:5000, IHC:1:20-1:200, IF:1:50-1:200

NUP85 Antibody
1-CSB-PA051469	Cusabio	EUR 317.00 EUR 244.00	0 1
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

NUP85 Antibody
1-CSB-PA016206GA01HU	Cusabio	EUR 597.00 EUR 333.00	0 1
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

pOTB7-NUP85
PVT18935	Lifescience Market	2 ug	EUR 231.00

NUP85 Conjugated Antibody
C36685	SAB	100ul	EUR 397.00

anti- NUP85 antibody
FNab05929	FN Test	100µg	EUR 548.75
Immunogen: nucleoporin 85kDa Uniprot ID: Q9BW27 Gene ID: 79902 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against NUP85

NUP85 Rabbit pAb
A11629-100ul	Abclonal	100 ul	EUR 308.00

NUP85 Rabbit pAb
A11629-200ul	Abclonal	200 ul	EUR 459.00

NUP85 Rabbit pAb
A11629-20ul	Abclonal	20 ul	EUR 183.00

NUP85 Rabbit pAb
A11629-50ul	Abclonal	50 ul	EUR 223.00

NUP85 Rabbit pAb
A3504-100ul	Abclonal	100 ul	EUR 384.00

NUP85 Rabbit pAb
A3504-200ul	Abclonal	200 ul	Ask for price

NUP85 Rabbit pAb
A3504-20ul	Abclonal	20 ul	Ask for price

NUP85 Rabbit pAb
A3504-50ul	Abclonal	50 ul	EUR 265.00

NUP85 Polyclonal Antibody
A67538	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

NUP85 cloning plasmid
CSB-CL874821HU-10ug	Cusabio	10ug	EUR 376.00
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1971 Sequence: atggaggagctcgatggcgagccaacagtcactttgattccaggcgtgaattccaagaagaaccaaatgtattttgactggggtccaggggagatgctggtatgtgaaacctccttcaacaaaaaagaaaaatcagagatggtgccaagttgcccctttatctatatcatccgta Show more
Description: A cloning plasmid for the NUP85 gene.

Anti-NUP85 antibody
PAab05929	Lifescience Market	100 ug	EUR 386.00

Anti-NUP85 antibody
STJ24851	St John's Laboratory	100 µl	EUR 393.00
Description: This gene encodes a protein component of the Nup107-160 subunit of the nuclear pore complex. Nuclear pore complexes are embedded in the nuclear envelope and promote bidirectional transport of macromolecules between the cytoplasm and nucleus. The encoded protein can also bind to the C-terminus of chemokine (C-C motif) receptor 2 (CCR2) and promote chemotaxis of monocytes, thereby participating in the inflammatory response. Alternative splicing results in multiple transcript variants.

Anti-NUP85 antibody
STJ113234	St John's Laboratory	100 µl	EUR 277.00
Description: This gene encodes a protein component of the Nup107-160 subunit of the nuclear pore complex. Nuclear pore complexes are embedded in the nuclear envelope and promote bidirectional transport of macromolecules between the cytoplasm and nucleus. The encoded protein can also bind to the C-terminus of chemokine (C-C motif) receptor 2 (CCR2) and promote chemotaxis of monocytes, thereby participating in the inflammatory response. Alternative splicing results in multiple transcript variants.

Bovine Nuclear pore complex protein Nup85, NUP85 ELISA KIT
ELI-23491b	Lifescience Market	96 Tests	EUR 928.00

Mouse Nuclear pore complex protein Nup85, Nup85 ELISA KIT
ELI-23492m	Lifescience Market	96 Tests	EUR 865.00

Human Nuclear pore complex protein Nup85, NUP85 ELISA KIT
ELI-36779h	Lifescience Market	96 Tests	EUR 824.00

Rat NUP85 shRNA Plasmid
20-abx988280	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Mouse NUP85 shRNA Plasmid
20-abx984082	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human NUP85 shRNA Plasmid
20-abx962654	Abbexa	EUR 801.00 EUR 1121.00	0 1
Shipped within 15-20 working days.

Human NUP85 ELISA Kit
EHN0067	Abclonal	96Tests	EUR 521.00

Goat NUP85 ELISA Kit
EGTN0067	Abclonal	96Tests	EUR 521.00

Bovine NUP85 ELISA Kit
EBN0067	Abclonal	96Tests	EUR 521.00

Canine NUP85 ELISA Kit
ECN0067	Abclonal	96Tests	EUR 521.00

Anserine NUP85 ELISA Kit
EAN0067	Abclonal	96Tests	EUR 521.00

NUP85 ELISA KIT|Human
EF001393	Lifescience Market	96 Tests	EUR 689.00

Porcine NUP85 ELISA Kit
EPN0067	Abclonal	96Tests	EUR 521.00

Rat NUP85 ELISA Kit
ERN0067	Abclonal	96Tests	EUR 521.00

Rabbit NUP85 ELISA Kit
ERTN0067	Abclonal	96Tests	EUR 521.00

Mouse NUP85 ELISA Kit
EMN0067	Abclonal	96Tests	EUR 521.00

Nucleoporin 85 (NUP85) Antibody
20-abx126286	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	0 1 2 3
Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody
abx122131-100ug	Abbexa	100 ug	EUR 391.00
Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody
20-abx002523	Abbexa	EUR 495.00 EUR 356.00	0 1
Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody
20-abx317993	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody
abx411835-01mg	Abbexa	0.1 mg	EUR 704.00
Shipped within 1 week.

Nucleoporin 85 (NUP85) Antibody
abx235929-100ug	Abbexa	100 ug	EUR 509.00
Shipped within 5-12 working days.

NUP85 Antibody, HRP conjugated
1-CSB-PA874821LB01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NUP85 Antibody, FITC conjugated
1-CSB-PA874821LC01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NUP85 Antibody, Biotin conjugated
1-CSB-PA874821LD01HU	Cusabio	EUR 317.00 EUR 335.00	0 1
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NUP85. Recognizes NUP85 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Recombinant Nucleoporin 85kDa (NUP85)
4-RPB110Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	0 1 2 3 4 5 6
Uniprot ID: Q9BW27 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.9kDa Isoelectric Point: 5.3
Description: Recombinant Human Nucleoporin 85kDa expressed in: E.coli

Recombinant porin 85kDa (NUP85)
4-RPB110Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	0 1 2 3 4 5 6
Uniprot ID: Q8R480 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 30.8kDa Isoelectric Point: 6.8
Description: Recombinant Mouse Nucleoporin 85kDa expressed in: E.coli

NUP85 Recombinant Protein (Human)
RP021940	ABM	100 ug	Ask for price

NUP85 Recombinant Protein (Rat)
RP214871	ABM	100 ug	Ask for price

NUP85 Recombinant Protein (Mouse)
RP155516	ABM	100 ug	Ask for price

Guinea Pig NUP85 ELISA Kit
EGN0067	Abclonal	96Tests	EUR 521.00

Nucleoporin 85 kDa (NUP85) Antibody
20-abx114231	Abbexa	EUR 732.00 EUR 398.00	0 1
Shipped within 5-10 working days.

Nucleoporin 85 kDa (NUP85) Antibody
20-abx128760	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	0 1 2 3 4
Shipped within 5-7 working days.

Nucleoporin 85 kDa (NUP85) Antibody
20-abx129741	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	0 1 2 3 4
Shipped within 5-7 working days.

Nucleoporin 85 (NUP85) Antibody (HRP)
20-abx311310	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody (FITC)
20-abx311311	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Nucleoporin 85 (NUP85) Antibody (Biotin)
20-abx311312	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	0 1 2 3 4
Shipped within 5-10 working days.

Nucleoporin 85 kDa (NUP85) Antibody
20-abx242299	Abbexa	EUR 411.00 EUR 300.00	0 1
Shipped within 5-10 working days.

NUP85 Polyclonal Antibody, HRP Conjugated
A67539	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

NUP85 Polyclonal Antibody, FITC Conjugated
A67540	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

NUP85 Polyclonal Antibody, Biotin Conjugated
A67541	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

NUP85 ORF Vector (Human) (pORF)
ORF007314	ABM	1.0 ug DNA	EUR 95.00

Nup85 ORF Vector (Rat) (pORF)
ORF071625	ABM	1.0 ug DNA	EUR 506.00

Nup85 ORF Vector (Mouse) (pORF)
ORF051840	ABM	1.0 ug DNA	EUR 506.00

Anti-Pericentrin 1 / NUP85 antibody
STJ70477	St John's Laboratory	100 µg	EUR 359.00

NUP85 ELISA Kit (Human) (OKEI00224)
OKEI00224	Aviva Systems Biology	96 Wells	EUR 767.00
Description: Description of target: Essential component of the nuclear pore complex (NPC) that seems to be required for NPC assembly and maintenance. As part of the NPC Nup107-160 subcomplex plays a role in RNA export and in tethering NUP98/Nup98 and NUP153 to the nucleus. The Nup107-160 complex seems to be required for spindle assembly during mitosis. NUP85 is required for membrane clustering of CCL2-activated CCR2. Seems to be involved in CCR2-mediated chemotaxis of monocytes and may link activated CCR2 to the phosphatidyl-inositol 3-kinase-Rac-lammellipodium protrusion cascade.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

NUP85 ELISA Kit (Mouse) (OKEI00488)
OKEI00488	Aviva Systems Biology	96 Wells	EUR 767.00
Description: Description of target: Essential component of the nuclear pore complex (NPC) that seems to be required for NPC assembly and maintenance. As part of the NPC Nup107-160 subcomplex plays a role in RNA export and in tethering NUP98/Nup98 and NUP153 to the nucleus. The Nup107-160 complex seems to be required for spindle assembly during mitosis. NUP85 is required for membrane clustering of CCL2-activated CCR2. Seems to be involved in CCR2-mediated chemotaxis of monocytes and may link activated CCR2 to the phosphatidyl-inositol 3-kinase-Rac-lammellipodium protrusion cascade. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL

NUP85 ELISA Kit (Rat) (OKEI00803)
OKEI00803	Aviva Systems Biology	96 Wells	EUR 767.00
Description: Description of target: Essential component of the nuclear pore complex (NPC) that seems to be required for NPC assembly and maintenance. As part of the NPC Nup107-160 subcomplex plays a role in RNA export and in tethering NUP98/Nup98 and NUP153 to the nucleus. The Nup107-160 complex seems to be required for spindle assembly during mitosis. NUP85 is required for membrane clustering of CCL2-activated CCR2. Seems to be involved in CCR2-mediated chemotaxis of monocytes and may link activated CCR2 to the phosphatidyl-inositol 3-kinase-Rac-lammellipodium protrusion cascade.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL

Mouse porin 85 kDa (NUP85) Protein
20-abx167410	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	0 1 2 3 4
Shipped within 5-7 working days.

Human Nucleoporin 85 kDa (NUP85) Protein
20-abx168228	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	0 1 2 3 4
Shipped within 5-7 working days.

NUP85 sgRNA CRISPR Lentivector set (Human)
K1468401	ABM	3 x 1.0 ug	EUR 339.00

Nup85 sgRNA CRISPR Lentivector set (Mouse)
K4800601	ABM	3 x 1.0 ug	EUR 339.00

Nup85 sgRNA CRISPR Lentivector set (Rat)
K6302501	ABM	3 x 1.0 ug	EUR 339.00

Nucleoporin 85kDa (NUP85) Polyclonal Antibody (Human)
4-PAB110Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	0 1 2 3 4
Sequence of the immunogen: NUP85 (Arg130~Leu368) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nucleoporin 85kDa (NUP85)

Nucleoporin 85kDa (NUP85) Polyclonal Antibody (Mouse)
4-PAB110Mu01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	0 1 2 3 4
Sequence of the immunogen: NUP85 (Gln418~Leu653) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Nucleoporin 85kDa (NUP85)

Human Nucleoporin 85kDa(NUP85)ELISA Kit
QY-E05183	Qayee Biotechnology	96T	EUR 361.00

Pig Nucleoporin 85 kDa (NUP85) ELISA Kit
abx361116-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Rabbit Nucleoporin 85 kDa (NUP85) ELISA Kit
abx362744-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

ELISA kit for Mouse NUP85 (Nucleoporin 85kDa)
E-EL-M0844	Elabscience Biotech	1 plate of 96 wells	EUR 534.00
Gentaur's NUP85 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Mouse NUP85. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Mouse NUP85 (Nucleoporin 85kDa) in samples from Serum, Plasma, Cell supernatant

Mouse Nucleoporin 85 kDa (NUP85) ELISA Kit
abx352905-96tests	Abbexa	96 tests	EUR 786.00
Shipped within 5-12 working days.

Rat Nucleoporin 85 kDa (NUP85) ELISA Kit
abx353813-96tests	Abbexa	96 tests	EUR 786.00
Shipped within 5-12 working days.

Human Nucleoporin 85 kDa (NUP85) ELISA Kit
abx354448-96tests	Abbexa	96 tests	EUR 707.00
Shipped within 5-12 working days.

Chicken Nucleoporin 85 kDa (NUP85) ELISA Kit
abx356318-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

Monkey Nucleoporin 85 kDa (NUP85) ELISA Kit
abx359279-96tests	Abbexa	96 tests	EUR 825.00
Shipped within 5-12 working days.

NUP85 sgRNA CRISPR Lentivector (Human) (Target 1)
K1468402	ABM	1.0 ug DNA	EUR 154.00

NUP85 sgRNA CRISPR Lentivector (Human) (Target 2)
K1468403	ABM	1.0 ug DNA	EUR 154.00

NUP85 sgRNA CRISPR Lentivector (Human) (Target 3)
K1468404	ABM	1.0 ug DNA	EUR 154.00

Nup85 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4800602	ABM	1.0 ug DNA	EUR 154.00

Nup85 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4800603	ABM	1.0 ug DNA	EUR 154.00

Nup85 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4800604	ABM	1.0 ug DNA	EUR 154.00

Nup85 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6302502	ABM	1.0 ug DNA	EUR 154.00