In den Nachrichten


PFDN4 Antibody

  • EUR 597.00
  • EUR 333.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PFDN4. Recognizes PFDN4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

PFDN4 Antibody

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN4. Recognizes PFDN4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA


  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.


YF-PA13730 50 ul
EUR 363.00
Description: Mouse polyclonal to PFDN4


YF-PA13731 100 ug
EUR 403.00
Description: Rabbit polyclonal to PFDN4

PFDN4 Polyclonal Antibody

28904-100ul 100ul
EUR 252.00

PFDN4 Polyclonal Antibody

28904-50ul 50ul
EUR 187.00

PFDN4 Rabbit pAb

A15300-100ul 100 ul
EUR 308.00

PFDN4 Rabbit pAb

A15300-200ul 200 ul
EUR 459.00

PFDN4 Rabbit pAb

A15300-20ul 20 ul
EUR 183.00

PFDN4 Rabbit pAb

A15300-50ul 50 ul
EUR 223.00

PFDN4 cloning plasmid

CSB-CL017814HU-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: atggcggccaccatgaagaaggcggctgcagaagatgtcaatgttactttcgaagatcaacaaaagataaacaaatttgcacggaatacaagtagaatcacagagctgaaggaagaaatagaagtaaaaaagaaacaactccaaaacctagaagatgcttgtgatgacatcatgct
  • Show more
Description: A cloning plasmid for the PFDN4 gene.

PFDN4 Rabbit pAb

A4013-100ul 100 ul
EUR 308.00

PFDN4 Rabbit pAb

A4013-200ul 200 ul
EUR 459.00

PFDN4 Rabbit pAb

A4013-20ul 20 ul Ask for price

PFDN4 Rabbit pAb

A4013-50ul 50 ul Ask for price

anti- PFDN4 antibody

FNab06336 100µg
EUR 585.00
  • Immunogen: prefoldin subunit 4
  • Uniprot ID: Q9NQP4
  • Gene ID: 5203
  • Research Area: Metabolism
Description: Antibody raised against PFDN4

Anti-PFDN4 antibody

PAab06336 100 ug
EUR 412.00

Anti-PFDN4 antibody

STJ26531 100 µl
EUR 277.00
Description: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils.

Anti-PFDN4 antibody

STJ117495 100 µl
EUR 277.00
Description: This gene encodes a member of the prefoldin beta subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils.

Anti-PFDN4 (2G4)

YF-MA20386 100 ug
EUR 363.00
Description: Mouse monoclonal to PFDN4

PFDN4 Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN4. Recognizes PFDN4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PFDN4 Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN4. Recognizes PFDN4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PFDN4 Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PFDN4. Recognizes PFDN4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PFDN4 protein (His tag)

80R-1651 50 ug
EUR 397.00
Description: Purified recombinant Human PFDN4 protein


EF001699 96 Tests
EUR 689.00

PFDN4 Polyclonal Conjugated Antibody

C28904 100ul
EUR 397.00

Human PFDN4 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

PFDN4 Recombinant Protein (Human)

RP023164 100 ug Ask for price

PFDN4 Recombinant Protein (Mouse)

RP161441 100 ug Ask for price

PFDN4 Recombinant Protein (Mouse)

RP161444 100 ug Ask for price

PFDN4 Recombinant Protein (Mouse)

RP161447 100 ug Ask for price

Prefoldin Subunit 4 (PFDN4) Antibody

  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Prefoldin Subunit 4 (PFDN4) Antibody

  • EUR 732.00
  • EUR 398.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Prefoldin Subunit 4 (PFDN4) Antibody

abx030723-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Prefoldin Subunit 4 (PFDN4) Antibody

abx030723-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Polyclonal PFDN4 Antibody (N-term)

AMM07108G 0.1ml
EUR 484.00
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PFDN4 (N-term). This antibody is tested and proven to work in the following applications:

Prefoldin Subunit 4 (PFDN4) Antibody

abx236336-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

PFDN4 ORF Vector (Human) (pORF)

ORF007722 1.0 ug DNA
EUR 95.00

Pfdn4 ORF Vector (Mouse) (pORF)

ORF053815 1.0 ug DNA
EUR 506.00

Pfdn4 ORF Vector (Mouse) (pORF)

ORF053816 1.0 ug DNA
EUR 506.00

Pfdn4 ORF Vector (Mouse) (pORF)

ORF053817 1.0 ug DNA
EUR 506.00

Pfdn4 sgRNA CRISPR Lentivector set (Mouse)

K4762701 3 x 1.0 ug
EUR 339.00

PFDN4 sgRNA CRISPR Lentivector set (Human)

K1630601 3 x 1.0 ug
EUR 339.00

Rabbit Prefoldin subunit 4(PFDN4) ELISA kit

E04P0764-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prefoldin subunit 4(PFDN4) ELISA kit

E04P0764-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prefoldin subunit 4(PFDN4) ELISA kit

E04P0764-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prefoldin subunit 4(PFDN4) ELISA kit

E04P0765-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prefoldin subunit 4(PFDN4) ELISA kit

E04P0765-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Prefoldin subunit 4(PFDN4) ELISA kit

E04P0765-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prefoldin subunit 4(PFDN4) ELISA kit

E02P0764-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prefoldin subunit 4(PFDN4) ELISA kit

E02P0764-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prefoldin subunit 4(PFDN4) ELISA kit

E02P0764-96 1 plate of 96 wells
EUR 685.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prefoldin subunit 4(PFDN4) ELISA kit

E02P0765-192T 192 tests
EUR 1270.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Prefoldin subunit 4(PFDN4) ELISA kit

E02P0765-48 1 plate of 48 wells
EUR 520.00
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Prefoldin subunit 4(PFDN4) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.